Original Article L-3-n-butylphthalide improves cognitive impairment of APP/PS1 mice by BDNF/TrkB/PI3K/AKT pathway
|
|
- Lorraine Whitehead
- 6 years ago
- Views:
Transcription
1 Int J Clin Exp Med 2014;7(7): /ISSN: /IJCEM Original Article L-3-n-butylphthalide improves cognitive impairment of APP/PS1 mice by BDNF/TrkB/PI3K/AKT pathway Jing Xiang 1*, Jie Pan 2*, Fujun Chen 1, Linlin Zheng 1, Yue Chen 1, Shutao Zhang 1, Wanyu Feng 1 1 Department of Pharmacology, First Hospital of China Medical University, Shenyang , China; 2 Department of Pharmacology, Xiangyang No. 1 People s Hospital, Hubei University of Medicine, Xiangyang , China. * Equal contributors. Received May 19, 2014; Accepted June 28, 2014; Epub July 15, 2014; Published July 30, 2014 Abstract: L-3-n-butylphthalide (L-NBP), an extract from seeds of Apium graveolens Linn (Chinese celery), has been shown to have neuroprotective effects on cerebral ischemic, vascular dementia and amyloid-beta (Abeta)-induced animal models by inhibiting oxidative injury, neuronal apoptosis and glial activation, regulating amyloid-beta protein precursor (AbetaPP) processing and reducing Abeta generation. The objective of this study was to investigate the effects of L-3-n-butylphthalide on memory impairment and the expression of brain neurotrophic derived factor (BNDF), kinaseb (TrkB), phosphatidylinositol 3 kinase (PI3K) and Akt in APP/PS1 double transgenic mouse models. APP/PS1 double transgenic mice were administered 30 mg/kg d L-NBP and 10 mg/kg d L-NBP for one month. The learning and memory ability were studied using the water maze test. Protein expression and transcript levels of genes in the mice hippocampus were evaluated using western blot and quantitative reverse transcription-polymerase chain reaction (qrt-pcr), respectively. The results demonstrated that both 30 mg/kg d L-NBP and 10 mg/ kg d L-NBP doses of L-NBP significantly increased memory capability and the expression of hippocampal BDNF/ TrkB/PI3K/AKT in mice The results suggested that L-NBP treatment may reverse memory impairment in APP/PS1 transgenic mice, and BDNF/TrkB/PI3K/AKT, may be involved in this process. Keywords: L-3-n-butylphthalide, APP/PS1, mice, BDNF/TrkB/PI3K/AKT Introduction Alzheimer s disease (AD) is a progressive neurodegenerative disorder that is characterized mainly by memory disorder, visuospatial impairment, attentional impairment, and executive dysfunction as its core symptoms [1]. The most prominent feature of AD is the clinical decline in cognitive function, with an early impairment of episodic memory that later manifest as mild cognitive impairment and then later as AD dementia [2]. Typical pathological features of AD include β-amyloid protein (Aβ) deposition in the brain that forms senile plaques (SPs), neurofibrillary tangles (NFTs) and neuronal apoptosis [3-5]. One feature is the selective loss of neurons, including basal forebrain cholinergic neurons and neurons in the cortex, hippocampus and certain subcortical regions. This neuronal loss contributes to progressive cognitive deficits [6, 7]. Another feature is synaptic loss, incticity [8], probably attributable to the aberrant increase of β-amyloid (Aβ) deposits in the brain [9, 10]. Brain-derived neurotrophic factor (BDNF) is a potent target-derived pro-survival protein that supports the viability of both peripheral and central neurons. Several studies reported BDNF deficiency begins in the early stage of AD and eventually causes neuronal degeneration, cell death and loss of cholinergic neurotransmission in the late stage of AD [11, 12]. And evidence has proven that expression of BDNF is impaired in AD patients and AD-like animal models [13]. Exogenous addition of BDNF can rescue neurons from death by preventing Aβ-induced neurodegeneration in vitro and in vivo [14]. BDNF exerts its pro-survival effects by binding tropomyosin receptor kinaseb (TrkB), TrkB-induced phosphatidylinositol 3 kinase (PI3K) activity leads to Akt activation [15], which, in turn, phosphorylates and deactivates pro-apoptotic targets, including bcl2 and Bad. In addition, evidence suggests a proapoptotic state in neurons of the AD brain [16]. Bcl-2 plays an important role in inhibiting both apoptosis and necrosis of central nervous system cells against several kinds of insults [17]. Bcl-2
2 Table 1. Primers used for qrt-pcr Gene inhibits cytochrome c release from mitochondria elicited by the proapoptotic molecule Bax, resulting in inhibition of caspase activation and apoptotic death [18, 19]. L-3-n-butylphthalide (L-NBP) was extracted as a pure component from seeds of Apium graveolens Linn, Chinese celery. Afterward, dl-nbp was synthesized, and it received approval by the State Food and Drug Administration of China for clinical use in stroke patients in Previous studies showed that L-NBP significantly improved microcirculation in pial arterioles [20], reduced the area of cerebral infarct, and inhibited platelet aggregation [21]. Moreover, L-NBP showed potent neuroprotective effects by improving mitochondrial function [22], decreasing oxidative damage [23], reducing neuronal apoptosis [24], reduces tau phosphorylation [25], inhibiting inflammatory responses [26] in middle cerebral artery occlusion rat models. In the present study, we investigated the effects of L-NBP on improving cognitive impairment in APP/PS1 transgenic mice. Furthermore, we examine the effect of L-NBP on BDNF/Trk pathway. Materials and methods Animals Primer sequence Amplicon length β-actin ATCATGTTTGAGACCTTCAACA 318 bp CATCTCTTGCTCGAAGTCCA BDNF AACCATAAGGACGCGGACTT 222 bp TGCAGTCTTTTTATCTGCCG TRKB CAGCACCAAGCAGCAAGAG 177 bp CAAGACCAGCAGGCATAAGC AKT GTTTGTTGCTGTGTCCCATG 245 bp AACGACATGGTGCAGCAAT PI3K TTCCTCACCTTCAAGCCACCCAAG 184 bp AGGTTAGAAACGTCTGGTCATCCAAC The APP/PS1 heterozygous mice were purchased from the Model Animal Research Center of Nanjing University. The mice had free access to food and water, under a 12/12 h light/dark cycle. Genotyping was performed at 1~2 weeks after birth. A total of 30 male mice (24 double mutant mice, 6 C57BL6 control mice) aged 9 months were randomly assigned into five groups: an Alzheimer s model group (model group), 6 APP/PS1 mice treated with nothing; a control group, 6 normal mice treated with nothing; an APP/PS1 vehicle control group (vehicle group), 6 APP/PS1 mice treated with vegetable oil for 1 month; an high level L-NBP treated APP/PS1 mice (HL-NBP group) 30 mg/kg d L-NBP treated APP/PS1 mice for 1 month; and low level L-NBP treated APP/PS1 mice (LL-NBP group) 10 mg/kg d L-NBP treated APP/PS1 mice for 1 month. After behavioral testing was completed, mice were killed by spine dislocation. The brain was removed. One hemi brain was snap frozen in liquid nitrogen and stored at -80 C until analysis, and the other hemi brain was fixed in 4% paraformaldehyde for 2 h, followed by incubation in graded sucrose at 4 C. The study was approved by the local ethics committee of animal research in China Medical University (Liaoning, China). Materials L-NBP (purity 98%) was synthesized by the Department of Medical Synthetic Chemistry, Institute of Material Medica and dissolved in vegetable oil at a concentration of 15 mg/ml. Primary antibodies used in this study were bought from Santa Cruz Biotechnology, including BDNF, TrkB, PI3K and AKT. Morris water maze The Morris water maze task was used to evaluate the drug-related changes in learning and memory in mice [27]. Briefly, the apparatus consisted of a circular metal pool (80 cm in diameter) filled with water made opaque by the addition of white beads. A translucent acrylic platform (9 cm in diameter), located in the center of the northwest or southeast quadrant, was placed 2 cm under the surface of the water. There were prominent visible cues around the room. The mouse was gently released with its nose against the wall into the water from one of the four preplanned starting positions (north, south, east, or west). The swimming path of each mouse was tracked. Spatial learning training Spatial training of the hidden platform in the water maze was performed for 5 consecutive days. On each day, training consisted of Int J Clin Exp Med 2014;7(7):
3 Table 2. Improved learning ability in APP/PS1 mice treated with L-NBP (time taken to find the hidden platform, sec) D3 D4 D5 D6 Control group ± ± ± ± LL-NBP group ± # ± #,* ± 6.89 #,* ± #,* HL-NBP group ± # 45.48±12.43 #,* 29.44±14.40 #,* 17.84±2.73 #,* Vehicle control group ± ± ± ± APP/PS1 group ± ± ± ± Footnotes: *P < 0.05, compared with Vehicle control group; # P < 0.05, compared with APP/PS1 group; P < 0.05, compared with Control group. blocks, with each interblock interval being 2 h. In each block, there were two consecutive training trials, and the intertrial interval was 15 s. The starting position for each trial was pseudo randomly chosen and counterbalanced across all the experimental groups. The mice were given a maximum of 60 s to find the hidden platform. If a mouse failed to find the platform within 120 s, the training was terminated, a maximum score of 120 s was assigned, and the mouse was manually guided to the hidden platform. The mouse was allowed to stay on the platform for 30 s before it was removed from the pool. Probe trial Two probe trials were performed at 48 h after the last training trial, to assess long-term memory consolidation, the platform was removed and the mice were placed into the pool from the quadrant opposite to the training quadrant. Starting positions were counterbalanced across mice. In each probe trial, mice were allowed to swim for 120 s. Western blotting At the end of the experiment, the mice were decapitated and the brains were rapidly removed on ice, the hippocampus was quickly dissected and stored at -70 C until required. The hippocampus was homogenized in RIPA buffer (Beyotime, China) supplemented with the protease inhibitor PMSF (100 µg/ml, Solarbio, China) on ice. The homogenate was centrifuged at 1500 g for 10 min, at 4 C and the supernatant was stored at -70 C. Total protein concentrations were determined with a modified BCA assay [28-30] (Beyotime, China). Equal amounts (20 µl) of protein from each sample (3 µg/µl) were mixed with 20 µl sample buffer and 100 µl RIPA buffer and then boiled for 5 min. Proteins were separated by electrophoresis on 8% or 15% polyacrylamide gels. Separated proteins were transferred onto PVDF membrane. The membrane was blocked for 2 h at room temperature with 5% BSA in TBS buffer (50 mm Tris-HCl, ph 7.5, 150 mm NaCl) containing 0.1% Tween-20 (TBST). Blots were probed with primary antibodies against rabbit monoclonal BDNF (1:400, Cell Signaling Technology, USA), rabbit monoclonal TrkB (1:400, Cell Signaling Technology, USA), rabbit monoclonal PI3K (1:400, Cell Signaling Technology, USA), rabbit monoclonal Akt (1:1000, Cell Signaling Technology, USA), rabbit monoclonal BAD (1:400, Cell Signaling Technology, USA), and rabbit monoclonal Bcl2 (1:1000, Cell Signaling Technology, USA) for 2 h at room temperature. After washing with TBST, the membranes were incubated for 2 h at room temperature with a secondary antirabbit antibody conjugated to horseradish peroxidase (KPL, USA) and developed using the enhanced chemiluminescence system (GE Healthcare, Canada). The relative optical densities of the specific bands visible on X-ray film were scanned and measured by image analysis software (BandScan 5.0). All relative intensities were normalized to β-actin expression. Real-time quantitative PCR (qpcr) Messenger RNA was extracted from frozen hippocampus tissue using TRIzol, and reverse transcribed with the High Capacity cdna Reverse Transcription kit (Applied Biosystems, Carlsbad, CA, USA). qpcr was performed using the ABI 7500 in the default thermal cycling mode with Power SYBR (Applied Biosystems, Foster City, CA, USA) using the primers shown in Table 1. Mouse β-actin was used as a normalization reference. To confirm the specificity of qpcr reactions, dissociation curves were 1708 Int J Clin Exp Med 2014;7(7):
4 Figure 1. The movement trajectory of the two groups of mice across quadrants. analyzed at the end of qpcr assay. Relative mrna levels were calculated using the comparative Ct method, and expressed as a percentage of control (APP/PS1 Gfap+/+ Vim+/+). Statistical analysis SPSS 14.0 for Windows was used to conduct the statistical analyses. Two-way analysis of variance (ANOVA) with repeated measures was used for analyzing data from the Morris water maze test. Other statistical tests were performed using one-way ANOVA and Student s t-test for comparisons. The P values of 0.05 were considered indicative of statistical significance. All date are expressed as meanstandard ± deviation (SD). Results Treatment with L-NBP improves learning ability in APP/PS1 mice control group, the movement trajectory of the model group was away from the platform (Figure 1), and the search latency and distance were longer, and both HL-NBP and LL-NBP groups were significantly reduced (Figure 2, P < 0.01). The study indicated no differences in locomotive behavior following L-NBP feeding for 30 mg/kg or 10 mg/kg, suggesting that the increased dose following drug treatment is not due to a decreased swimming time. Therefore, these results suggest that L-NBP improve the learning ability of APP/PS1 mice. Treatment with L-NBP enhances memory in APP/PS1 mice On day 6, the control mice demonstrated enhanced searching be- havior in the memorized region where the platform was (11.79 ± 13.81% of time). However the APP/PS1 untreated mice spent significantly more time in the memorized region (54.12 ± 25.08%, P < 0.05), suggesting a loss of memory ability at this age. However, the treated group demonstrated enhanced memory ability, HL-NBP (17.84 ± 2.73%, P < 0.05; Table 2), LL-NBP (13.18 ± 15.70%, P < 0.05; Table 2). But, there was no difference between those two groups. Effect of L-NBP on the BDNF/TrkB /PI3K/AKT protein levels in the brain Western blot analyses for the protein levels of BDNF/TrkB/PI3K/AKT in the brain were performed in order to provide relative levels of expressions of these proteins. In the present study, the protein levels of BDNF/TrkB/PI3K/ AKT were significantly increased L-NBL treatment group. However, these protein levels were increased in those two groups are similar. During the place navigation test that was conducted for 5 d, we identified that the APP/PS1 mutant mice demonstrated impaired ability in water maze learning, compared with the control group (P < 0.05), while the APP/PS1 mice pre-treated with L-NBP demonstrated improved learning ability on the days of learning (P < 0.05; Table 2). The search latency of all 5 groups of mice decreased, but compared to the Quantitative RT-PCR Figure 3 illustrates the effects of the treatment with L-NBP (10 and 30 mg/kg) on the BDNF/ TrkB/PI3K/AKT transcript levels in mouse hippocampi. Both dose of L-NBP could significantly increase the BDNF/TrkB/PI3K/AKT transcript levels in the hippocampus (*P < 0.05) as compared with APP/PS1 model group Int J Clin Exp Med 2014;7(7):
5 Figure 2. Protein expression in mouse brain and IDV values (n = 6). A: BDNF/TRKB; B: I3K/AKT. *P < 0.05 when compared with model group; #P < 0.05 when compared with vehicle group. Figure 3. Effects of the treatment with L-NBP on the BDNF/TrkB/PI3K/AKT transcript levels. (A) BDNF, (B) TrKB, (C) PI3K, (D) AKT. *P < 0.05 when compared with model group; #P < 0.05 when compared with vehicle group Int J Clin Exp Med 2014;7(7):
6 Discussion The existing treatments for AD are unsatisfactory, and searching for an effective treatment method for patients suffering from AD is a major challenge. In the present study, we confirmed the hypothesis that L-NBP treated improved cognitive functioning. Classic and well-known symptoms of AD include problems with spatial learning and presence of a memory deficit. Previous studies have shown that L-NBP reduced beta-amyloid-induced neuronal toxicity in cultured neuronal cells [31], prevent learning and memory impairment induced by chronic cerebral hypoperfusion in rats [32], prevent age-related neurodegenerative changes by modulation of cholinergic system, reduction of phosphorylated tau in aged rats [33]. Our study confirmed that L-NBP treatment significantly improved spatial learning and memory function of AD mice by Morris maze. But the mechanisms are unclear yet. To further explain the mechanisms underlying the beneficial effect of L-NBP in APP/PS1 mice, we investigated the potential implication of BDNF. BDNF is crucial in neuronal plasticity, learning and memory. BDNF enhances synaptic transmission and neuronal plasticity in the CNS [34], resulting in increase of learning ability and memory capabilities [35]. TrKB is a high-affinity of BDNF, abnormal TrKB expression impairs memory and learning tasks [36]. Recently studies also support the role of BDNF signaling through TrKB in protecting against memory impairment and regulate neurogenesis in the hippocampus of AD [37, 38]. In this study, there was a decrease in BDNF expression in the APP/ PS1 mouse hippocampus compared with WT group. We also observed that in the brain of APP/PS1 mice, TrkB was downregulated and its downstream enzymes including PI3K and Akt were inactivated, PI3K/AKT pathway is important for mediating neuronal survival under a wide variety of circumstances [38]. Some observations indicate that BDNF induces primary dendrite formation via activation of the PI3-kinase and MAP kinase pathways [39]. PI3K/Akt signaling pathway was involved in the neuroprotective effects of donepezil and galanthamine against AD [40]. Akt, plays a critical role in controlling survival and apoptosis, and is activated by growth factors to function in a pathway involving PI3K kinase [37]. The PI3K/ Akt pathway can deactivate pro-apoptotic mediators, and activate anti-apoptotic proteins [41]. Our study demonstrated that L-NBP stimulation may be effective in potentially ameliorating cognitive impairment caused by AD. Results of the present study have demonstrated that L-NBP intake significantly increased the expression of BDNF/TrkB/PI3K/AKT, in the brain, which is in agreement with our hypothesis. Acknowledgements Thanks for the help of Professors Minjie Wei and Qianglin Duan from College of Pharmacy, China Medical University. Disclosure of conflict of interest None. Address correspondence to: Dr. Wanyu Feng, Department of Pharmacology, The First Hospital of China Medical University, 155 North Nanjing Avenue, Heping District, Shenyang , China. fengwanyu00@163.com References [1] Perry RJ, Watson P and Hodges JR. The nature and staging of attention dysfunction in early (minimal and mild) Alzheimer s disease: relationship to episodic and semantic memory impairment. Neuropsychologia 2000; 38: [2] Sperling RA, Jack CR Jr, Black SE, Frosch MP, Greenberg SM, Hyman BT, Scheltens P, Carrillo MC, Thies W, Bednar MM, Black RS, Brashear HR, Grundman M, Siemers ER, Feldman HH and Schindler RJ. Amyloid-related imaging abnormalities in amyloid-modifying therapeutic trials: recommendations from the Alzheimer s Association Research Roundtable Workgroup. Alzheimers Dement 2011; 7: [3] Braak H and Braak E. Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol 1991; 82: [4] Braak H and Del Tredici K. Alzheimer s disease: intraneuronal alterations precede insoluble amyloid-beta formation. Neurobiol Aging 2004; 25: ; discussion [5] Braak H, Alafuzoff I, Arzberger T, Kretzschmar H and Del Tredici K. Staging of Alzheimer disease-associated neurofibrillary pathology using paraffin sections and immunocytochemistry. Acta Neuropathol 2006; 112: [6] Auld DS, Kornecook TJ, Bastianetto S and Quirion R. Alzheimer s disease and the basal 1711 Int J Clin Exp Med 2014;7(7):
7 forebrain cholinergic system: relations to betaamyloid peptides, cognition, and treatment strategies. Prog Neurobiol 2002; 68: [7] Schliebs R and Arendt T. The significance of the cholinergic system in the brain during aging and in Alzheimer s disease. J Neural Transm 2006; 113: [8] Coleman PD and Yao PJ. Synaptic slaughter in Alzheimer s disease. Neurobiol Aging 2003; 24: [9] Okamura N, Suemoto T, Shiomitsu T, Suzuki M, Shimadzu H, Akatsu H, Yamamoto T, Arai H, Sasaki H, Yanai K, Staufenbiel M, Kudo Y and Sawada T. A novel imaging probe for in vivo detection of neuritic and diffuse amyloid plaques in the brain. J Mol Neurosci 2004; 24: [10] Muresan Z and Muresan V. Neuritic deposits of amyloid-beta peptide in a subpopulation of central nervous system-derived neuronal cells. Mol Cell Biol 2006; 26: [11] Counts SE and Mufson EJ. The role of nerve growth factor receptors in cholinergic basal forebrain degeneration in prodromal Alzheimer disease. J Neuropathol Exp Neurol 2005; 64: [12] Tapia-Arancibia L, Aliaga E, Silhol M and Arancibia S. New insights into brain BDNF function in normal aging and Alzheimer disease. Brain Res Rev 2008; 59: [13] Fumagalli F, Racagni G and Riva MA. The expanding role of BDNF: a therapeutic target for Alzheimer s disease? Pharmacogenomics J 2006; 6: [14] Arancibia S, Silhol M, Mouliere F, Meffre J, Hollinger I, Maurice T and Tapia-Arancibia L. Protective effect of BDNF against beta-amyloid induced neurotoxicity in vitro and in vivo in rats. Neurobiol Dis 2008; 31: [15] Murer MG, Yan Q and Raisman-Vozari R. Brainderived neurotrophic factor in the control human brain, and in Alzheimer s disease and Parkinson s disease. Prog Neurobiol 2001; 63: [16] Anderson AJ, Pike CJ and Cotman CW. Differential induction of immediate early gene proteins in cultured neurons by beta-amyloid (A beta): association of c-jun with A beta-induced apoptosis. J Neurochem 1995; 65: [17] Kane DJ, Sarafian TA, Anton R, Hahn H, Gralla EB, Valentine JS, Ord T and Bredesen DE. Bcl-2 inhibition of neural death: decreased generation of reactive oxygen species. Science 1993; 262: [18] Shimizu S, Narita M and Tsujimoto Y. Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC. Nature 1999; 399: [19] Kluck RM, Bossy-Wetzel E, Green DR and Newmeyer DD. The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis. Science 1997; 275: [20] Xu HL and Feng YP. Effects of 3-n-butylphthalide on production of vasoactive substances by cerebral and aortic endothelial cells. Zhongguo Yao Li Xue Bao 1999; 20: [21] Peng Y, Zeng X, Feng Y and Wang X. Antiplatelet and antithrombotic activity of L-3-n-butylphthalide in rats. J Cardiovasc Pharmacol 2004; 43: [22] Huang JZ, Chen YZ, Su M, Zheng HF, Yang YP, Chen J and Liu CF. dl-3-n-butylphthalide prevents oxidative damage and reduces mitochondrial dysfunction in an MPP(+)-induced cellular model of Parkinson s disease. Neurosci Lett 2010; 475: [23] Xiong N, Huang J, Chen C, Zhao Y, Zhang Z, Jia M, Zhang Z, Hou L, Yang H, Cao X, Liang Z, Zhang Y, Sun S, Lin Z and Wang T. Dl-3-n-butylphthalide, a natural antioxidant, protects dopamine neurons in rotenone models for Parkinson s disease. Neurobiol Aging 2012; 33: [24] Chang Q and Wang XL. Effects of chiral 3-nbutylphthalide on apoptosis induced by transient focal cerebral ischemia in rats. Acta Pharmacol Sin 2003; 24: [25] Peng Y, Hu Y, Xu S, Li P, Li J, Lu L, Yang H, Feng N, Wang L and Wang X. L-3-n-butylphthalide reduces tau phosphorylation and improves cognitive deficits in AbetaPP/PS1-Alzheimer s transgenic mice. J Alzheimers Dis 2012; 29: [26] Xu HL and Feng YP. Inhibitory effects of chiral 3-n-butylphthalide on inflammation following focal ischemic brain injury in rats. Acta Pharmacol Sin 2000; 21: [27] Morris R. Developments of a water-maze procedure for studying spatial learning in the rat. J Neurosci Methods 1984; 11: [28] Sun H, Zhang J, Zhang L, Liu H, Zhu H and Yang Y. Environmental enrichment influences BDNF and NR1 levels in the hippocampus and restores cognitive impairment in chronic cerebral hypoperfused rats. Curr Neurovasc Res 2010; 7: [29] Yao ZH, Zhang JJ and Xie XF. Enriched environment prevents cognitive impairment and tau hyperphosphorylation after chronic cerebral hypoperfusion. Curr Neurovasc Res 2012; 9: [30] Zheng P, Zhang J, Liu H, Xu X and Zhang X. Angelica injection reduces cognitive impairment during chronic cerebral hypoperfusion through brain-derived neurotrophic factor and nerve growth factor. Curr Neurovasc Res 2008; 5: [31] Peng Y, Xing C, Lemere CA, Chen G, Wang L, Feng Y and Wang X. l-3-n-butylphthalide ame Int J Clin Exp Med 2014;7(7):
8 liorates beta-amyloid-induced neuronal toxicity in cultured neuronal cells. Neurosci Lett 2008; 434: [32] Peng Y, Xu S, Chen G, Wang L, Feng Y and Wang X. l-3-n-butylphthalide improves cognitive impairment induced by chronic cerebral hypoperfusion in rats. J Pharmacol Exp Ther 2007; 321: [33] Ma S, Xu S, Liu B, Li J, Feng N, Wang L and Wang X. Long-term treatment of l-3-n-butylphthalide attenuated neurodegenerative changes in aged rats. Naunyn Schmiedebergs Arch Pharmacol 2009; 379: [34] Schinder AF and Poo M. The neurotrophin hypothesis for synaptic plasticity. Trends Neurosci 2000; 23: [35] Mizuno M, Yamada K, Olariu A, Nawa H and Nabeshima T. Involvement of brain-derived neurotrophic factor in spatial memory formation and maintenance in a radial arm maze test in rats. J Neurosci 2000; 20: [36] Minichiello L, Korte M, Wolfer D, Kuhn R, Unsicker K, Cestari V, Rossi-Arnaud C, Lipp HP, Bonhoeffer T and Klein R. Essential role for TrkB receptors in hippocampus-mediated learning. Neuron 1999; 24: [37] Oda T, Kume T, Izumi Y, Takada-Takatori Y, Niidome T and Akaike A. Bromocriptine, a dopamine D(2) receptor agonist with the structure of the amino acid ergot alkaloids, induces neurite outgrowth in PC12 cells. Eur J Pharmacol 2008; 598: [38] Wakita S, Izumi Y, Nakai T, Adachi K, Takada- Takatori Y, Kume T and Akaike A. Staurosporine induces dopaminergic neurite outgrowth through AMP-activated protein kinase/mammalian target of rapamycin signaling pathway. Neuropharmacology 2014; 77: [39] Dijkhuizen PA and Ghosh A. BDNF regulates primary dendrite formation in cortical neurons via the PI3-kinase and MAP kinase signaling pathways. J Neurobiol 2005; 62: [40] Takada-Takatori Y, Kume T, Sugimoto M, Katsuki H, Sugimoto H and Akaike A. Acetylcholinesterase inhibitors used in treatment of Alzheimer s disease prevent glutamate neurotoxicity via nicotinic acetylcholine receptors and phosphatidylinositol 3-kinase cascade. Neuropharmacology 2006; 51: [41] Takada-Takatori Y, Kume T, Sugimoto M, Katsuki H, Niidome T, Sugimoto H, Fujii T, Okabe S and Akaike A. Neuroprotective effects of galanthamine and tacrine against glutamate neurotoxicity. Eur J Pharmacol 2006; 549: Int J Clin Exp Med 2014;7(7):
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed
More informationNeuroprotective properties of GLP-1 - a brief overview. Michael Gejl Jensen, MD Dept. Of Pharmacology, AU
Neuroprotective properties of GLP-1 - a brief overview Michael Gejl Jensen, MD Dept. Of Pharmacology, AU mg@farm.au.dk Agenda Glucagon-like peptide (GLP-1) GLP-1 and neuronal activity GLP-1 in disease-specific
More informationTGF-ß1 pathway as a new pharmacological target for neuroprotection in AD. Filippo Caraci
Department of Clinical and Molecular Biomedicine Section of Pharmacology and Biochemistry Department of Educational Sciences University of Catania TGF-ß1 pathway as a new pharmacological target for neuroprotection
More informationThe Opportunity: Parkinson s disease, RLS, ADHD, and disease modification YKP10461
The Opportunity: Parkinson s disease, RLS, ADHD, and disease modification YKP10461 1 TABLE OF CONTENTS Profile Summary Mechanism of Action Clinical Study Results Pharmacologic Profile Safety and Toxicity
More informationScience & Technologies COMPARISON THE EFFECTS OF TACRINE AND GALANTAMINE ON ACTIVE AVOIDANCE TEST IN RATS WITH DIAZEPAM-AMNESIA MODEL
COMPARISON THE EFFECTS OF TACRINE AND GALANTAMINE ON ACTIVE AVOIDANCE TEST IN RATS WITH DIAZEPAM-AMNESIA MODEL Darinka Dimitrova, Damianka Getova Medical University Plovdiv, Medical Faculty, 4002 Plovdiv,
More informationNeuroprotection in preclinical models of Parkinson disease by the NAPVSIPQ peptide
Neuroprotection in preclinical models of Parkinson disease by the NAPVSIPQ peptide Bruce H. Morimoto, Ph.D. Executive Director, Applied Translational Medicine Microtubules Microtubules essential for neuronal
More informationResearch progress on the use of estrogen receptor agonist for treatment of spinal cord injury
Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,
More informationCASE 49. What type of memory is available for conscious retrieval? Which part of the brain stores semantic (factual) memories?
CASE 49 A 43-year-old woman is brought to her primary care physician by her family because of concerns about her forgetfulness. The patient has a history of Down syndrome but no other medical problems.
More informationMecanismo de acción de Souvenaid: nuevos datos preclínicos
Mecanismo de acción de Souvenaid: nuevos datos preclínicos Dra. Sagrario Manzano Coordinadora del Grupo de Neurología de la Conducta y Demencias de la SEN. Hospital Universitario Infanta Cristina. Parla.
More informationStrategies for Neurorestoration: Growth Factors
Strategies for Neurorestoration: Growth Factors Elena Posse de Chaves, PhD 928-MSB Phone: 492-5966 Email: elena.chaves@ualberta.ca Treatment of Neurodegenerative Diseases Most neurodegenerative diseases
More informationSupplementary Fig. 1
PDK1-dependent quenching of TACE shedding activity in prion and Alzheimer s diseases Mathéa Pietri, Caroline Dakowski, Samia Hannaoui, Aurélie Alleaume-Butaux, Julia Hernandez-Rapp, Audrey Ragagnin, Sophie
More informationThe Potential Effect of Caffeine and Nicotine Co-administration on the Induction of Alzheimer s disease
The Potential Effect of Caffeine and Nicotine Co-administration on the Induction of Alzheimer s disease Azza A Ali *, Hebatalla I Ahmed * Hanan A Abd El-Samea ** Ebtehal El-Demerdash *** * Pharmacology
More informationPersistent improvement in synaptic and cognitive functions in an Alzheimer mouse model after rolipram treatment
Persistent improvement in synaptic and cognitive functions in an Alzheimer mouse model after rolipram treatment Bing Gong,, Michael Shelanski, Ottavio Arancio J Clin Invest. 2004;114(11):1624-1634. https://doi.org/10.1172/jci22831.
More informationBiomed Environ Sci, 2015; 28(9):
Biomed Environ Sci, 2015; 28(9): 691-695 691 Letter to the Editor Protective Effects of Tetramethylpyrazine on Cerebrovascular Regulations in Rats with Chronic Alcoholic Encephalopathy LI Hui 1,, YANG
More informationDementia. Stephen S. Flitman, MD Medical Director 21st Century Neurology
Dementia Stephen S. Flitman, MD Medical Director 21st Century Neurology www.neurozone.org Dementia is a syndrome Progressive memory loss, plus Progressive loss of one or more cognitive functions: Language
More informationMary ET Boyle, Ph. D. Department of Cognitive Science UCSD
? Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Christian S Lobsiger & Don W Cleveland (2007) Nature Neuroscience 10, 1355-1360 Astrocytes: interlinked gatekeepers of glutamate astrocytes
More informationSCIRF Award #2016 I-03 PI: Azizul Haque, PhD Grant Title: Neuron-specific Enolase and SCI
SCIRF Award #2016 I-03 PI: Azizul Haque, PhD Grant Title: Neuron-specific Enolase and SCI 10-month Technical Progress Report Enolase is a multifunctional glycolytic enzyme involved in growth control, hypoxia,
More informationChronic Cerebral Ischemia-Induced Memory Impairment After Inhibition of BDNF by Interleukin-1 Signaling Pathway
American Journal of Internal Medicine 2017; 5(4): 52-56 http://www.sciencepublishinggroup.com/j/ajim doi: 10.11648/j.ajim.20170504.11 ISSN: 2330-4316 (Print); ISSN: 2330-4324 (Online) Chronic Cerebral
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationThe Calpain / Calpastatin System in TBI and Chronic Neurodegeneration
The Calpain / Calpastatin System in TBI and Chronic Neurodegeneration Kathryn E. Saatman, Ph.D. Departments of Physiology and Neurosurgery Spinal Cord and Brain Injury Research Center Saatman lab: Dr.
More informationMolecular Mechanisms of Environmental Enrichment: Impairments in Akt/GSK3b, Neurotrophin-3 and CREB Signaling
Molecular Mechanisms of Environmental Enrichment: Impairments in Akt/GSK3b, Neurotrophin-3 and CREB Signaling Yuan-Shih Hu, Nancy Long, Gustavo Pigino, Scott T. Brady, Orly Lazarov* Department of Anatomy
More informationTau Mechanism in Dementia
ADC Directors Meeting Saturday, April 12, 2008 Sheraton V Tau Mechanism in Dementia Lennart Mucke, M.D. Director, Gladstone Institute of Neurological Disease Joseph B. Martin Distinguished Professor Department
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationOriginal Article Clinical application of butylphthalide in massive cerebral infarction treatment
Int J Clin Exp Med 2017;10(2):3757-3761 www.ijcem.com /ISSN:1940-5901/IJCEM0026624 Original Article Clinical application of butylphthalide in massive cerebral infarction treatment Haiyan Yan, Hongyan Xi,
More informationEffect of Chronic Aluminum Exposure on PKC, CaMK and Neurogranin in Hippocampus of Rat
ISSN 100727626 CN 1123870ΠQ 2007 5 Chinese Journal of Biochemistry and Molecular Biology 23 (5) :410 414 PKC CaMK Ng 3,,,,,, (, 110001) (long2term potentiation, LTP) C (protein kinase c, PKC) Ca 2 + 2
More informationORIGINAL RESEARCH ARTICLE
Journal of Chitwan Medical College 2015; 5(14): 70-74 Available online at: www.jcmc.cmc.edu.np ISSN 2091-2889 (Online) ISSN 2091-2412 (Print) JOURNAL OF CHITWAN MEDICAL COLLEGE JCMC ESTD 2010 ORIGINAL
More informationHOW NUTRITION CHANGES THE AGING BRAIN. Nafisa Jadavji, PhD
HOW NUTRITION CHANGES THE AGING BRAIN Nafisa Jadavji, PhD NafisaJadavji@carleton.ca Lecture Outline Introduction Brain Nutrition Peer Review Questions BREAK Dementia and Alzheimer's disease Parkinson s
More informationSelective filtering defect at the axon initial segment in Alzheimer s disease mouse models. Yu Wu
Selective filtering defect at the axon initial segment in Alzheimer s disease mouse models Yu Wu Alzheimer s Disease (AD) Mouse models: APP/PS1, PS1δE9, APPswe, hps1 Wirths, O. et al, Acta neuropathologica
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationAlzheimer's Disease A mind in darkness awaiting the drink of a gentle color.
Alzheimer's Disease A mind in darkness awaiting the drink of a gentle color. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Gabriel García Márquez One Hundred Years of Solitude Alois Alzheimer
More informationPhospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
More informationSupplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
More informationALZHEIMER S DISEASE FACTOIDS & STATISTICS
ALZHEIMER S DISEASE FACTOIDS & STATISTICS ~ 4 million affected in US alone 6-8% if 65+ years old, 30-50% if 80+ By 2030, in US >65 million people >65+ (---> ~14 million with AD) AD is one of the top 10
More informationVASILE HEFCO 1*, LUCIAN HRITCU 1, ADRIAN TIRON 1, ANDREEA-IOANA HEFCO 1
THE EFFECTS OF NICOTINIC TREATMENT ON MEMORY AND LEARNING IMPAIRMENT INDUCED BY BLOCKADE OF MUSCARINIC ACETYLCHOLINE RECEPTORS ON PERFORMANCE IN RADIAL ARM-MAZE TASK IN RATS VASILE HEFCO, LUCIAN HRITCU,
More informationMarine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by
Marine Streptomyces sp. derived antimycin analogues suppress HeLa cells via depletion HPV E6/E7 mediated by ROS-dependent ubiquitin proteasome system Weiyi Zhang 1, +, Qian Che 1, 2, +, Hongsheng Tan 1,
More informationDietary Flavonoids: Modulators of Brain Ageing?
MLECULAR NUTRITIN GRUP Established 2004 Dietary Flavonoids: Modulators of Brain Ageing? Jeremy P E Spencer School of Food Biosciences University of Reading, UK The Sensitivity of the Brain to xidative
More informationDementia. Jeanette Norden, Ph.D. Professor Emerita Vanderbilt University School of Medicine
Dementia Jeanette Norden, Ph.D. Professor Emerita Vanderbilt University School of Medicine What is Dementia? Dementia is a general term referring to a decline in cognitive/mental functioning; this decline
More informationThe effect of diets on neurodegenerative diseases
The effect of diets on neurodegenerative diseases Results from the FP7 project LIPIDIDIET A Kiliaan Donders Institute for Brain, Cognition and Behaviour, Centre for Neuroscience Dept Anatomy and dept Cognitive
More informationAbstracts and affiliations
Dopamine Discovery Day August 30, 2012 Rikshospitalet Store auditorium, Oslo, Norway Organized by Linda H. Bergersen & Vidar Gundersen Institute of Basic Medical Sciences & Centre for Molecular Biology
More informationRui Feng 1, Feng Zhang 2,3*
THE NEUROPROTECTIVE EFFECT OF ELECTRO-ACUPUNCTURE AGAINST ISCHEMIC STROKE IN ANIMAL MODEL: A REVIEW 25 Rui Feng 1, Feng Zhang 2,3* 1 Department of Neurology, the Third Hospital of Hebei Medical University,
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationAlzheimer s Disease without Dementia
Alzheimer s Disease without Dementia Dr Emer MacSweeney CEO & Consultant Neuroradiologist Re:Cognition Health London Osteopathic Society 13 September 2016 Early diagnosis of Alzheimer s Disease How and
More informationCHAPTER 2 LITERATURE REVIEW. Glaucoma is a devastating, worldwide disease. In just the United States there are over 2
CHAPTER 2 LITERATURE REVIEW Introduction Glaucoma is a devastating, worldwide disease. In just the United States there are over 2 million estimated cases with 120,000 of those responsible for blindness.
More informationBis(9)-( )-Meptazinol, a novel dual-binding AChE inhibitor, rescues cognitive deficits and pathological changes in APP/PS1 transgenic mice
Shi et al. Translational Neurodegeneration (2018) 7:21 https://doi.org/10.1186/s40035-018-0126-8 RESEARCH Open Access Bis(9)-( )-Meptazinol, a novel dual-binding AChE inhibitor, rescues cognitive deficits
More informationMOLECULAR MEDICINE REPORTS 13: , 2016
MOLECULAR MEDICINE REPORTS 13: 1611-1617, 2016 Electroacupuncture at the Baihui acupoint alleviates cognitive impairment and exerts neuroprotective effects by modulating the expression and processing of
More informationSupporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine
More informationShift 1, 8 July 2018, 09:30-13:00
Shift 1, 8 July 2018, 09:30-13:00 CNS patterning A001-A014 Stem cells: basic biology and postnatal neurogenesis - part I Development of neural systems: Molecular and genetic characterisationa Epigenetic
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationTargeting the p75 Receptor to Inhibit Degenerative Signaling and Tau Phosphorylation/Misfolding/ Missorting: Preclinical through Phase 1
Targeting the p75 Receptor to Inhibit Degenerative Signaling and Tau Phosphorylation/Misfolding/ Missorting: Preclinical through Phase 1 ADC Directors Meeting, April 18 th 2015 Frank M. Longo, Stanford
More informationEnvironmental influences on brain and behaviour
Environmental influences on brain and behaviour Abdul H. Mohammed Dept. of Neurotec Karolinska Institutet Stockholm, Sweden IBRO African Neuroscience School, Nairobi, 2005 Environmental interventions affecting
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationAssessing mouse behaviors: Modeling pediatric traumatic brain injury
Assessing mouse behaviors: Modeling pediatric traumatic brain injury Bridgette Semple Ph.D. Postdoctoral Fellow, Noble Laboratory Department of Neurological Surgery, UCSF Pediatric Traumatic Brain Injury
More informationAdvances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)
7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
More informationPRODUCT INFORMATION & MANUAL
PRODUCT INFORMATION & MANUAL 0.4 micron for Overall Exosome Isolation (Cell Media) NBP2-49826 For research use only. Not for diagnostic or therapeutic procedures. www.novusbio.com - P: 303.730.1950 - P:
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More information9.01 Introduction to Neuroscience Fall 2007
MIT OpenCourseWare http://ocw.mit.edu 9.01 Introduction to Neuroscience Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. 9.01 Recitation (R02)
More informationTUESDAY, MARCH 28, 2017 WEDNESDAY, MARCH 29, 2017 WELCOME RECEPTION (VIENNA CITY HALL)
KEY: PRE CONFERENCE SYMPOSIUM SPONSORED SYMPOSIUM SYMPOSIUM PLENARY LECTURE FORUM OTHER EVENT *PRE-REGISTRATION IS REQUIRED FOR THE INFORMAL NETWORKING WITH PROFESSOR LUNCH SESSION TUESDAY, MARCH 28, 2017
More informationSTROKE & DIETARY INFLUENCES ON COGNITION IN AGING
How Nutrition Changes the Aging Brain STROKE & DIETARY INFLUENCES ON COGNITION IN AGING Nafisa Jadavji, PhD nafisa.jadavji@carleton.ca REMINDER! Purpose of Course To present information about how nutrition
More informationBone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
More informationSupplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
More informationWnt Signaling Pathway and AD
Center for Cell Regulation and Pathology Joaquín V. Luco (CRCP), Millennium Institute (MIFAB) Center for Aging and Regeneration (CARE). Wnt Signaling Pathway and AD Nibaldo C. Inestrosa European Union
More informationSharon Shacham, Ph.D. ICAD, July 29th, 2008 NASDAQ: EPIX
Stimulation of Serotonin Type 4 Receptors Leads to Increases in Alpha-Secreatase Activity and sappalpha: Potential for Disease Modification in Alzheimer's Disease Sharon Shacham, Ph.D. ICAD, July 29th,
More informationSleep and Circadian Rhythms in Neurodegenerative Disorders
Sleep and Circadian Rhythms in Neurodegenerative Disorders Erik S. Musiek, MD, PhD Department of Neurology Washington University in St. Louis U13 Bench to Bedside Sleep Conference 2015 Disclosures Funding:
More informationGinkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury
Ginkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury K. Ran 1, D.-L. Yang 1, Y.-T. Chang 1, K.-M. Duan 2, Y.-W. Ou 2, H.-P. Wang 3 and Z.-J. Li 1 1 Department of Anesthesiology,
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationOriginal Article Baicalein alters PI3K/Akt/GSK3β signaling pathway in rats with diabetes-associated cognitive deficits
Int J Clin Exp Med 2015;8(2):1993-2000 www.ijcem.com /ISSN:1940-5901/IJCEM0004406 Original Article Baicalein alters PI3K/Akt/GSK3β signaling pathway in rats with diabetes-associated cognitive deficits
More informationCognitive Enhancement Strategies. Florian Plattner, James A. Bibb
Cognitive Enhancement Strategies Florian Plattner, James A. Bibb A decline in memory and cognitive function is a natural aspect of aging. In addition, cognitive deficits are comorbid with many mental disorders
More informationElectrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB
Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB Kenji Kawamura, Yoshio Kano. Kibi International University, Takahashi-city, Japan. Disclosures: K.
More informationTAU PATHOLOGY REDUCTION WITH SM07883, A NOVEL, POTENT, AND SELECTIVE ORAL DYRK1A INHIBITOR - A POTENTIAL THERAPEUTIC FOR ALZHEIMER S DISEASE
TAU PATHOLOGY REDUCTION WITH SM07883, A NOVEL, POTENT, AND SELECTIVE ORAL DYRK1A INHIBITOR - A POTENTIAL THERAPEUTIC FOR ALZHEIMER S DISEASE Benoît Melchior, C. Lai, K. Duong-Polk, A. Tjitro, D.C. Ince,
More informationSupplemental Table.1 Published preclinical research studies of progesterone use in adult traumatic brain injury Author Model Dose i Outcome
Supplemental Table.1 Published preclinical research studies of progesterone use in adult traumatic brain injury Author Model Dose i Outcome Roof et al, 1992 (96) Roof et al, 1993 (15) Roof et al, 1996
More informationImaging of Alzheimer s Disease: State of the Art
July 2015 Imaging of Alzheimer s Disease: State of the Art Neir Eshel, Harvard Medical School Year IV Outline Our patient Definition of dementia Alzheimer s disease Epidemiology Diagnosis Stages of progression
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupporting Information
Supporting Information Chen et al. 10.1073/pnas.0807991106 SI Methods Sucrose Gradient Fractionation. Fractionation by sucrose gradient was performed as described by Gasparini et al. [(2001) J Neurosci
More informationScutellaria barbata flavonoids alleviate memory deficits and neuronal injuries induced by composited Aβ in rats
DOI 10.1186/s12993-016-0118-8 Behavioral and Brain Functions RESEARCH Open Access Scutellaria barbata flavonoids alleviate memory deficits and neuronal injuries induced by composited Aβ in rats Xiao G.
More informationTerminology. Terminology. Terminology. Terminology. Terminology. Bromodeoxyuridine
Kateřina Náměstková, Zuzana Šimonová, Eva Syková Behavioural Brain Research Bromodeoxyuridine : Doublecortin : DCX Glial Fibrillary Acidic Protein : GFAP Trace eye blink conditioning 1 Volume 163 : pp.
More informationRNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
More informationRole of TDP-43 in Non-Alzheimer s and Alzheimer s Neurodegenerative Diseases
Role of TDP-43 in Non-Alzheimer s and Alzheimer s Neurodegenerative Diseases Keith A. Josephs, MD, MST, MSc Professor of Neurology 13th Annual Mild Cognitive Impairment (MCI) Symposium: Alzheimer and Non-Alzheimer
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationNeuropathology of Neurodegenerative Disorders Prof. Jillian Kril
Neurodegenerative disorders to be discussed Alzheimer s disease Lewy body diseases Frontotemporal dementia and other tauopathies Huntington s disease Motor Neuron Disease 2 Neuropathology of neurodegeneration
More informationKA Toulis, K. Dovas, M. Tsolaki. The endocrine facets of Alzheimer s disease and dementia-related disorders
KA Toulis, K. Dovas, M. Tsolaki The endocrine facets of Alzheimer s disease and dementia-related disorders Sex hormones Calcium metabolism GH/IGF-I Thyroid axis Metabolic hormones + dementia Sex hormones
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationCocaine Exposure Results in Formation of Dendritic Varicosity in Rat Primary Hippocampal Neurons
American Journal of Infectious Diseases 5 (1): 26-30, 2009 ISSN 1553-6203 2009 Science Publications Cocaine Exposure Results in Formation of Dendritic Varicosity in Rat Primary Hippocampal Neurons 1 Honghong
More informationFlavonoids from Herba epimedii Protect against MPP+-induced Toxicity in MES23.5 Cells
Flavonoids from Herba epimedii Protect against MPP+-induced Toxicity in MES23.5 Cells Na Li 1, Ming-Chun Jiang 2, Wen-fang Chen 1 1 Department of Physiology, State Key Disciplines and Shandong Provincial
More informationReferenser Souvenaid Nutricia Nordica AB
Referenser Souvenaid Nutricia Nordica AB Minnesförlust 1. Feldman H och Gracon S. I: Gauthier S, ed. Clinical Diagnosis and Management of Alzheimer s Disease. Martin Dunitz: London; 1996:239-259. 2. Welsh
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More information1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;
More informationPlasma Phospholipids Identify Antecedent Memory Impairment in Older Adults. Madeline Haff, Bikem Sonmezler, & Rosie Chu
Plasma Phospholipids Identify Antecedent Memory Impairment in Older Adults Madeline Haff, Bikem Sonmezler, & Rosie Chu So what exactly is Alzheimer s Disease? A progressive form of dementia that causes
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More information7. NOOTROPIC AND ANTIOXIDANT ACTIVITY. 7.1 Introduction
268 7. NOOTROPIC AND ANTIOXIDANT ACTIVITY 7.1 Introduction Alzheimer s disease is a neurodegenerative disorder, which according to World Health Organization (WHO) affects 22 million people world wide,
More informationDRUG TREATMENT OF PARKINSON S DISEASE. Mr. D.Raju, M.pharm, Lecturer
DRUG TREATMENT OF PARKINSON S DISEASE Mr. D.Raju, M.pharm, Lecturer PARKINSON S DISEASE (parkinsonism) is a neurodegenerative disorder which affects t h e b a s a l g a n g l i a - and is associated with
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationAnnals of Oncology Advance Access published January 10, 2005
Annals of Oncology Advance Access published January 10, 2005 Original article Annals of Oncology doi:10.1093/annonc/mdi077 Expression of survivin and bax/bcl-2 in peroxisome proliferator activated receptor-g
More informationThe Primary Care Guide To Understanding The Role Of Diabetes As A Risk Factor For Cognitive Loss Or Dementia In Adults
The Primary Care Guide To Understanding The Role Of Diabetes As A Risk Factor For Cognitive Loss Or Dementia In Adults. Introduction Glucose intolerance is common in older individuals and this metabolic
More informationNeuropharmacology NOTES
Neuropharmacology NOTES Contents Topic Page # Lecture 1- Intro to Neurochemical Transmission & Neuromodulation 2 Lecture 2- Serotonin & Noradrenaline 7 Lecture 3- Acetylcholine & Dopamine 14 Lecture 4-
More informationDementia and Healthy Ageing : is the pathology any different?
Dementia and Healthy Ageing : is the pathology any different? Professor David Mann, Professor of Neuropathology, University of Manchester, Hope Hospital, Salford DEMENTIA Loss of connectivity within association
More informationProtective effect of ginsenoside Rg1 against MPTP-induced apoptosis in mouse substantia nigra neurons 1
Chen XC et al / Acta Pharmacol Sin 2002 Sep; 23 (9): 829-834 829 2002, Acta Pharmacologica Sinica ISSN 1671-4083 Shanghai Institute of Materia Medica Chinese Academy of Sciences http://www.chinaphar.com
More information