Original Article L-3-n-butylphthalide improves cognitive impairment of APP/PS1 mice by BDNF/TrkB/PI3K/AKT pathway

Transcription

1 Int J Clin Exp Med 2014;7(7): /ISSN: /IJCEM Original Article L-3-n-butylphthalide improves cognitive impairment of APP/PS1 mice by BDNF/TrkB/PI3K/AKT pathway Jing Xiang 1*, Jie Pan 2*, Fujun Chen 1, Linlin Zheng 1, Yue Chen 1, Shutao Zhang 1, Wanyu Feng 1 1 Department of Pharmacology, First Hospital of China Medical University, Shenyang , China; 2 Department of Pharmacology, Xiangyang No. 1 People s Hospital, Hubei University of Medicine, Xiangyang , China. * Equal contributors. Received May 19, 2014; Accepted June 28, 2014; Epub July 15, 2014; Published July 30, 2014 Abstract: L-3-n-butylphthalide (L-NBP), an extract from seeds of Apium graveolens Linn (Chinese celery), has been shown to have neuroprotective effects on cerebral ischemic, vascular dementia and amyloid-beta (Abeta)-induced animal models by inhibiting oxidative injury, neuronal apoptosis and glial activation, regulating amyloid-beta protein precursor (AbetaPP) processing and reducing Abeta generation. The objective of this study was to investigate the effects of L-3-n-butylphthalide on memory impairment and the expression of brain neurotrophic derived factor (BNDF), kinaseb (TrkB), phosphatidylinositol 3 kinase (PI3K) and Akt in APP/PS1 double transgenic mouse models. APP/PS1 double transgenic mice were administered 30 mg/kg d L-NBP and 10 mg/kg d L-NBP for one month. The learning and memory ability were studied using the water maze test. Protein expression and transcript levels of genes in the mice hippocampus were evaluated using western blot and quantitative reverse transcription-polymerase chain reaction (qrt-pcr), respectively. The results demonstrated that both 30 mg/kg d L-NBP and 10 mg/ kg d L-NBP doses of L-NBP significantly increased memory capability and the expression of hippocampal BDNF/ TrkB/PI3K/AKT in mice The results suggested that L-NBP treatment may reverse memory impairment in APP/PS1 transgenic mice, and BDNF/TrkB/PI3K/AKT, may be involved in this process. Keywords: L-3-n-butylphthalide, APP/PS1, mice, BDNF/TrkB/PI3K/AKT Introduction Alzheimer s disease (AD) is a progressive neurodegenerative disorder that is characterized mainly by memory disorder, visuospatial impairment, attentional impairment, and executive dysfunction as its core symptoms [1]. The most prominent feature of AD is the clinical decline in cognitive function, with an early impairment of episodic memory that later manifest as mild cognitive impairment and then later as AD dementia [2]. Typical pathological features of AD include β-amyloid protein (Aβ) deposition in the brain that forms senile plaques (SPs), neurofibrillary tangles (NFTs) and neuronal apoptosis [3-5]. One feature is the selective loss of neurons, including basal forebrain cholinergic neurons and neurons in the cortex, hippocampus and certain subcortical regions. This neuronal loss contributes to progressive cognitive deficits [6, 7]. Another feature is synaptic loss, incticity [8], probably attributable to the aberrant increase of β-amyloid (Aβ) deposits in the brain [9, 10]. Brain-derived neurotrophic factor (BDNF) is a potent target-derived pro-survival protein that supports the viability of both peripheral and central neurons. Several studies reported BDNF deficiency begins in the early stage of AD and eventually causes neuronal degeneration, cell death and loss of cholinergic neurotransmission in the late stage of AD [11, 12]. And evidence has proven that expression of BDNF is impaired in AD patients and AD-like animal models [13]. Exogenous addition of BDNF can rescue neurons from death by preventing Aβ-induced neurodegeneration in vitro and in vivo [14]. BDNF exerts its pro-survival effects by binding tropomyosin receptor kinaseb (TrkB), TrkB-induced phosphatidylinositol 3 kinase (PI3K) activity leads to Akt activation [15], which, in turn, phosphorylates and deactivates pro-apoptotic targets, including bcl2 and Bad. In addition, evidence suggests a proapoptotic state in neurons of the AD brain [16]. Bcl-2 plays an important role in inhibiting both apoptosis and necrosis of central nervous system cells against several kinds of insults [17]. Bcl-2

2 Table 1. Primers used for qrt-pcr Gene inhibits cytochrome c release from mitochondria elicited by the proapoptotic molecule Bax, resulting in inhibition of caspase activation and apoptotic death [18, 19]. L-3-n-butylphthalide (L-NBP) was extracted as a pure component from seeds of Apium graveolens Linn, Chinese celery. Afterward, dl-nbp was synthesized, and it received approval by the State Food and Drug Administration of China for clinical use in stroke patients in Previous studies showed that L-NBP significantly improved microcirculation in pial arterioles [20], reduced the area of cerebral infarct, and inhibited platelet aggregation [21]. Moreover, L-NBP showed potent neuroprotective effects by improving mitochondrial function [22], decreasing oxidative damage [23], reducing neuronal apoptosis [24], reduces tau phosphorylation [25], inhibiting inflammatory responses [26] in middle cerebral artery occlusion rat models. In the present study, we investigated the effects of L-NBP on improving cognitive impairment in APP/PS1 transgenic mice. Furthermore, we examine the effect of L-NBP on BDNF/Trk pathway. Materials and methods Animals Primer sequence Amplicon length β-actin ATCATGTTTGAGACCTTCAACA 318 bp CATCTCTTGCTCGAAGTCCA BDNF AACCATAAGGACGCGGACTT 222 bp TGCAGTCTTTTTATCTGCCG TRKB CAGCACCAAGCAGCAAGAG 177 bp CAAGACCAGCAGGCATAAGC AKT GTTTGTTGCTGTGTCCCATG 245 bp AACGACATGGTGCAGCAAT PI3K TTCCTCACCTTCAAGCCACCCAAG 184 bp AGGTTAGAAACGTCTGGTCATCCAAC The APP/PS1 heterozygous mice were purchased from the Model Animal Research Center of Nanjing University. The mice had free access to food and water, under a 12/12 h light/dark cycle. Genotyping was performed at 1~2 weeks after birth. A total of 30 male mice (24 double mutant mice, 6 C57BL6 control mice) aged 9 months were randomly assigned into five groups: an Alzheimer s model group (model group), 6 APP/PS1 mice treated with nothing; a control group, 6 normal mice treated with nothing; an APP/PS1 vehicle control group (vehicle group), 6 APP/PS1 mice treated with vegetable oil for 1 month; an high level L-NBP treated APP/PS1 mice (HL-NBP group) 30 mg/kg d L-NBP treated APP/PS1 mice for 1 month; and low level L-NBP treated APP/PS1 mice (LL-NBP group) 10 mg/kg d L-NBP treated APP/PS1 mice for 1 month. After behavioral testing was completed, mice were killed by spine dislocation. The brain was removed. One hemi brain was snap frozen in liquid nitrogen and stored at -80 C until analysis, and the other hemi brain was fixed in 4% paraformaldehyde for 2 h, followed by incubation in graded sucrose at 4 C. The study was approved by the local ethics committee of animal research in China Medical University (Liaoning, China). Materials L-NBP (purity 98%) was synthesized by the Department of Medical Synthetic Chemistry, Institute of Material Medica and dissolved in vegetable oil at a concentration of 15 mg/ml. Primary antibodies used in this study were bought from Santa Cruz Biotechnology, including BDNF, TrkB, PI3K and AKT. Morris water maze The Morris water maze task was used to evaluate the drug-related changes in learning and memory in mice [27]. Briefly, the apparatus consisted of a circular metal pool (80 cm in diameter) filled with water made opaque by the addition of white beads. A translucent acrylic platform (9 cm in diameter), located in the center of the northwest or southeast quadrant, was placed 2 cm under the surface of the water. There were prominent visible cues around the room. The mouse was gently released with its nose against the wall into the water from one of the four preplanned starting positions (north, south, east, or west). The swimming path of each mouse was tracked. Spatial learning training Spatial training of the hidden platform in the water maze was performed for 5 consecutive days. On each day, training consisted of Int J Clin Exp Med 2014;7(7):

3 Table 2. Improved learning ability in APP/PS1 mice treated with L-NBP (time taken to find the hidden platform, sec) D3 D4 D5 D6 Control group ± ± ± ± LL-NBP group ± # ± #,* ± 6.89 #,* ± #,* HL-NBP group ± # 45.48±12.43 #,* 29.44±14.40 #,* 17.84±2.73 #,* Vehicle control group ± ± ± ± APP/PS1 group ± ± ± ± Footnotes: *P < 0.05, compared with Vehicle control group; # P < 0.05, compared with APP/PS1 group; P < 0.05, compared with Control group. blocks, with each interblock interval being 2 h. In each block, there were two consecutive training trials, and the intertrial interval was 15 s. The starting position for each trial was pseudo randomly chosen and counterbalanced across all the experimental groups. The mice were given a maximum of 60 s to find the hidden platform. If a mouse failed to find the platform within 120 s, the training was terminated, a maximum score of 120 s was assigned, and the mouse was manually guided to the hidden platform. The mouse was allowed to stay on the platform for 30 s before it was removed from the pool. Probe trial Two probe trials were performed at 48 h after the last training trial, to assess long-term memory consolidation, the platform was removed and the mice were placed into the pool from the quadrant opposite to the training quadrant. Starting positions were counterbalanced across mice. In each probe trial, mice were allowed to swim for 120 s. Western blotting At the end of the experiment, the mice were decapitated and the brains were rapidly removed on ice, the hippocampus was quickly dissected and stored at -70 C until required. The hippocampus was homogenized in RIPA buffer (Beyotime, China) supplemented with the protease inhibitor PMSF (100 µg/ml, Solarbio, China) on ice. The homogenate was centrifuged at 1500 g for 10 min, at 4 C and the supernatant was stored at -70 C. Total protein concentrations were determined with a modified BCA assay [28-30] (Beyotime, China). Equal amounts (20 µl) of protein from each sample (3 µg/µl) were mixed with 20 µl sample buffer and 100 µl RIPA buffer and then boiled for 5 min. Proteins were separated by electrophoresis on 8% or 15% polyacrylamide gels. Separated proteins were transferred onto PVDF membrane. The membrane was blocked for 2 h at room temperature with 5% BSA in TBS buffer (50 mm Tris-HCl, ph 7.5, 150 mm NaCl) containing 0.1% Tween-20 (TBST). Blots were probed with primary antibodies against rabbit monoclonal BDNF (1:400, Cell Signaling Technology, USA), rabbit monoclonal TrkB (1:400, Cell Signaling Technology, USA), rabbit monoclonal PI3K (1:400, Cell Signaling Technology, USA), rabbit monoclonal Akt (1:1000, Cell Signaling Technology, USA), rabbit monoclonal BAD (1:400, Cell Signaling Technology, USA), and rabbit monoclonal Bcl2 (1:1000, Cell Signaling Technology, USA) for 2 h at room temperature. After washing with TBST, the membranes were incubated for 2 h at room temperature with a secondary antirabbit antibody conjugated to horseradish peroxidase (KPL, USA) and developed using the enhanced chemiluminescence system (GE Healthcare, Canada). The relative optical densities of the specific bands visible on X-ray film were scanned and measured by image analysis software (BandScan 5.0). All relative intensities were normalized to β-actin expression. Real-time quantitative PCR (qpcr) Messenger RNA was extracted from frozen hippocampus tissue using TRIzol, and reverse transcribed with the High Capacity cdna Reverse Transcription kit (Applied Biosystems, Carlsbad, CA, USA). qpcr was performed using the ABI 7500 in the default thermal cycling mode with Power SYBR (Applied Biosystems, Foster City, CA, USA) using the primers shown in Table 1. Mouse β-actin was used as a normalization reference. To confirm the specificity of qpcr reactions, dissociation curves were 1708 Int J Clin Exp Med 2014;7(7):

4 Figure 1. The movement trajectory of the two groups of mice across quadrants. analyzed at the end of qpcr assay. Relative mrna levels were calculated using the comparative Ct method, and expressed as a percentage of control (APP/PS1 Gfap+/+ Vim+/+). Statistical analysis SPSS 14.0 for Windows was used to conduct the statistical analyses. Two-way analysis of variance (ANOVA) with repeated measures was used for analyzing data from the Morris water maze test. Other statistical tests were performed using one-way ANOVA and Student s t-test for comparisons. The P values of 0.05 were considered indicative of statistical significance. All date are expressed as meanstandard ± deviation (SD). Results Treatment with L-NBP improves learning ability in APP/PS1 mice control group, the movement trajectory of the model group was away from the platform (Figure 1), and the search latency and distance were longer, and both HL-NBP and LL-NBP groups were significantly reduced (Figure 2, P < 0.01). The study indicated no differences in locomotive behavior following L-NBP feeding for 30 mg/kg or 10 mg/kg, suggesting that the increased dose following drug treatment is not due to a decreased swimming time. Therefore, these results suggest that L-NBP improve the learning ability of APP/PS1 mice. Treatment with L-NBP enhances memory in APP/PS1 mice On day 6, the control mice demonstrated enhanced searching be- havior in the memorized region where the platform was (11.79 ± 13.81% of time). However the APP/PS1 untreated mice spent significantly more time in the memorized region (54.12 ± 25.08%, P < 0.05), suggesting a loss of memory ability at this age. However, the treated group demonstrated enhanced memory ability, HL-NBP (17.84 ± 2.73%, P < 0.05; Table 2), LL-NBP (13.18 ± 15.70%, P < 0.05; Table 2). But, there was no difference between those two groups. Effect of L-NBP on the BDNF/TrkB /PI3K/AKT protein levels in the brain Western blot analyses for the protein levels of BDNF/TrkB/PI3K/AKT in the brain were performed in order to provide relative levels of expressions of these proteins. In the present study, the protein levels of BDNF/TrkB/PI3K/ AKT were significantly increased L-NBL treatment group. However, these protein levels were increased in those two groups are similar. During the place navigation test that was conducted for 5 d, we identified that the APP/PS1 mutant mice demonstrated impaired ability in water maze learning, compared with the control group (P < 0.05), while the APP/PS1 mice pre-treated with L-NBP demonstrated improved learning ability on the days of learning (P < 0.05; Table 2). The search latency of all 5 groups of mice decreased, but compared to the Quantitative RT-PCR Figure 3 illustrates the effects of the treatment with L-NBP (10 and 30 mg/kg) on the BDNF/ TrkB/PI3K/AKT transcript levels in mouse hippocampi. Both dose of L-NBP could significantly increase the BDNF/TrkB/PI3K/AKT transcript levels in the hippocampus (*P < 0.05) as compared with APP/PS1 model group Int J Clin Exp Med 2014;7(7):

5 Figure 2. Protein expression in mouse brain and IDV values (n = 6). A: BDNF/TRKB; B: I3K/AKT. *P < 0.05 when compared with model group; #P < 0.05 when compared with vehicle group. Figure 3. Effects of the treatment with L-NBP on the BDNF/TrkB/PI3K/AKT transcript levels. (A) BDNF, (B) TrKB, (C) PI3K, (D) AKT. *P < 0.05 when compared with model group; #P < 0.05 when compared with vehicle group Int J Clin Exp Med 2014;7(7):

6 Discussion The existing treatments for AD are unsatisfactory, and searching for an effective treatment method for patients suffering from AD is a major challenge. In the present study, we confirmed the hypothesis that L-NBP treated improved cognitive functioning. Classic and well-known symptoms of AD include problems with spatial learning and presence of a memory deficit. Previous studies have shown that L-NBP reduced beta-amyloid-induced neuronal toxicity in cultured neuronal cells [31], prevent learning and memory impairment induced by chronic cerebral hypoperfusion in rats [32], prevent age-related neurodegenerative changes by modulation of cholinergic system, reduction of phosphorylated tau in aged rats [33]. Our study confirmed that L-NBP treatment significantly improved spatial learning and memory function of AD mice by Morris maze. But the mechanisms are unclear yet. To further explain the mechanisms underlying the beneficial effect of L-NBP in APP/PS1 mice, we investigated the potential implication of BDNF. BDNF is crucial in neuronal plasticity, learning and memory. BDNF enhances synaptic transmission and neuronal plasticity in the CNS [34], resulting in increase of learning ability and memory capabilities [35]. TrKB is a high-affinity of BDNF, abnormal TrKB expression impairs memory and learning tasks [36]. Recently studies also support the role of BDNF signaling through TrKB in protecting against memory impairment and regulate neurogenesis in the hippocampus of AD [37, 38]. In this study, there was a decrease in BDNF expression in the APP/ PS1 mouse hippocampus compared with WT group. We also observed that in the brain of APP/PS1 mice, TrkB was downregulated and its downstream enzymes including PI3K and Akt were inactivated, PI3K/AKT pathway is important for mediating neuronal survival under a wide variety of circumstances [38]. Some observations indicate that BDNF induces primary dendrite formation via activation of the PI3-kinase and MAP kinase pathways [39]. PI3K/Akt signaling pathway was involved in the neuroprotective effects of donepezil and galanthamine against AD [40]. Akt, plays a critical role in controlling survival and apoptosis, and is activated by growth factors to function in a pathway involving PI3K kinase [37]. The PI3K/ Akt pathway can deactivate pro-apoptotic mediators, and activate anti-apoptotic proteins [41]. Our study demonstrated that L-NBP stimulation may be effective in potentially ameliorating cognitive impairment caused by AD. Results of the present study have demonstrated that L-NBP intake significantly increased the expression of BDNF/TrkB/PI3K/AKT, in the brain, which is in agreement with our hypothesis. Acknowledgements Thanks for the help of Professors Minjie Wei and Qianglin Duan from College of Pharmacy, China Medical University. Disclosure of conflict of interest None. Address correspondence to: Dr. Wanyu Feng, Department of Pharmacology, The First Hospital of China Medical University, 155 North Nanjing Avenue, Heping District, Shenyang , China. fengwanyu00@163.com References [1] Perry RJ, Watson P and Hodges JR. The nature and staging of attention dysfunction in early (minimal and mild) Alzheimer s disease: relationship to episodic and semantic memory impairment. Neuropsychologia 2000; 38: [2] Sperling RA, Jack CR Jr, Black SE, Frosch MP, Greenberg SM, Hyman BT, Scheltens P, Carrillo MC, Thies W, Bednar MM, Black RS, Brashear HR, Grundman M, Siemers ER, Feldman HH and Schindler RJ. Amyloid-related imaging abnormalities in amyloid-modifying therapeutic trials: recommendations from the Alzheimer s Association Research Roundtable Workgroup. Alzheimers Dement 2011; 7: [3] Braak H and Braak E. Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol 1991; 82: [4] Braak H and Del Tredici K. Alzheimer s disease: intraneuronal alterations precede insoluble amyloid-beta formation. Neurobiol Aging 2004; 25: ; discussion [5] Braak H, Alafuzoff I, Arzberger T, Kretzschmar H and Del Tredici K. Staging of Alzheimer disease-associated neurofibrillary pathology using paraffin sections and immunocytochemistry. Acta Neuropathol 2006; 112: [6] Auld DS, Kornecook TJ, Bastianetto S and Quirion R. Alzheimer s disease and the basal 1711 Int J Clin Exp Med 2014;7(7):

7 forebrain cholinergic system: relations to betaamyloid peptides, cognition, and treatment strategies. Prog Neurobiol 2002; 68: [7] Schliebs R and Arendt T. The significance of the cholinergic system in the brain during aging and in Alzheimer s disease. J Neural Transm 2006; 113: [8] Coleman PD and Yao PJ. Synaptic slaughter in Alzheimer s disease. Neurobiol Aging 2003; 24: [9] Okamura N, Suemoto T, Shiomitsu T, Suzuki M, Shimadzu H, Akatsu H, Yamamoto T, Arai H, Sasaki H, Yanai K, Staufenbiel M, Kudo Y and Sawada T. A novel imaging probe for in vivo detection of neuritic and diffuse amyloid plaques in the brain. J Mol Neurosci 2004; 24: [10] Muresan Z and Muresan V. Neuritic deposits of amyloid-beta peptide in a subpopulation of central nervous system-derived neuronal cells. Mol Cell Biol 2006; 26: [11] Counts SE and Mufson EJ. The role of nerve growth factor receptors in cholinergic basal forebrain degeneration in prodromal Alzheimer disease. J Neuropathol Exp Neurol 2005; 64: [12] Tapia-Arancibia L, Aliaga E, Silhol M and Arancibia S. New insights into brain BDNF function in normal aging and Alzheimer disease. Brain Res Rev 2008; 59: [13] Fumagalli F, Racagni G and Riva MA. The expanding role of BDNF: a therapeutic target for Alzheimer s disease? Pharmacogenomics J 2006; 6: [14] Arancibia S, Silhol M, Mouliere F, Meffre J, Hollinger I, Maurice T and Tapia-Arancibia L. Protective effect of BDNF against beta-amyloid induced neurotoxicity in vitro and in vivo in rats. Neurobiol Dis 2008; 31: [15] Murer MG, Yan Q and Raisman-Vozari R. Brainderived neurotrophic factor in the control human brain, and in Alzheimer s disease and Parkinson s disease. Prog Neurobiol 2001; 63: [16] Anderson AJ, Pike CJ and Cotman CW. Differential induction of immediate early gene proteins in cultured neurons by beta-amyloid (A beta): association of c-jun with A beta-induced apoptosis. J Neurochem 1995; 65: [17] Kane DJ, Sarafian TA, Anton R, Hahn H, Gralla EB, Valentine JS, Ord T and Bredesen DE. Bcl-2 inhibition of neural death: decreased generation of reactive oxygen species. Science 1993; 262: [18] Shimizu S, Narita M and Tsujimoto Y. Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC. Nature 1999; 399: [19] Kluck RM, Bossy-Wetzel E, Green DR and Newmeyer DD. The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis. Science 1997; 275: [20] Xu HL and Feng YP. Effects of 3-n-butylphthalide on production of vasoactive substances by cerebral and aortic endothelial cells. Zhongguo Yao Li Xue Bao 1999; 20: [21] Peng Y, Zeng X, Feng Y and Wang X. Antiplatelet and antithrombotic activity of L-3-n-butylphthalide in rats. J Cardiovasc Pharmacol 2004; 43: [22] Huang JZ, Chen YZ, Su M, Zheng HF, Yang YP, Chen J and Liu CF. dl-3-n-butylphthalide prevents oxidative damage and reduces mitochondrial dysfunction in an MPP(+)-induced cellular model of Parkinson s disease. Neurosci Lett 2010; 475: [23] Xiong N, Huang J, Chen C, Zhao Y, Zhang Z, Jia M, Zhang Z, Hou L, Yang H, Cao X, Liang Z, Zhang Y, Sun S, Lin Z and Wang T. Dl-3-n-butylphthalide, a natural antioxidant, protects dopamine neurons in rotenone models for Parkinson s disease. Neurobiol Aging 2012; 33: [24] Chang Q and Wang XL. Effects of chiral 3-nbutylphthalide on apoptosis induced by transient focal cerebral ischemia in rats. Acta Pharmacol Sin 2003; 24: [25] Peng Y, Hu Y, Xu S, Li P, Li J, Lu L, Yang H, Feng N, Wang L and Wang X. L-3-n-butylphthalide reduces tau phosphorylation and improves cognitive deficits in AbetaPP/PS1-Alzheimer s transgenic mice. J Alzheimers Dis 2012; 29: [26] Xu HL and Feng YP. Inhibitory effects of chiral 3-n-butylphthalide on inflammation following focal ischemic brain injury in rats. Acta Pharmacol Sin 2000; 21: [27] Morris R. Developments of a water-maze procedure for studying spatial learning in the rat. J Neurosci Methods 1984; 11: [28] Sun H, Zhang J, Zhang L, Liu H, Zhu H and Yang Y. Environmental enrichment influences BDNF and NR1 levels in the hippocampus and restores cognitive impairment in chronic cerebral hypoperfused rats. Curr Neurovasc Res 2010; 7: [29] Yao ZH, Zhang JJ and Xie XF. Enriched environment prevents cognitive impairment and tau hyperphosphorylation after chronic cerebral hypoperfusion. Curr Neurovasc Res 2012; 9: [30] Zheng P, Zhang J, Liu H, Xu X and Zhang X. Angelica injection reduces cognitive impairment during chronic cerebral hypoperfusion through brain-derived neurotrophic factor and nerve growth factor. Curr Neurovasc Res 2008; 5: [31] Peng Y, Xing C, Lemere CA, Chen G, Wang L, Feng Y and Wang X. l-3-n-butylphthalide ame Int J Clin Exp Med 2014;7(7):

8 liorates beta-amyloid-induced neuronal toxicity in cultured neuronal cells. Neurosci Lett 2008; 434: [32] Peng Y, Xu S, Chen G, Wang L, Feng Y and Wang X. l-3-n-butylphthalide improves cognitive impairment induced by chronic cerebral hypoperfusion in rats. J Pharmacol Exp Ther 2007; 321: [33] Ma S, Xu S, Liu B, Li J, Feng N, Wang L and Wang X. Long-term treatment of l-3-n-butylphthalide attenuated neurodegenerative changes in aged rats. Naunyn Schmiedebergs Arch Pharmacol 2009; 379: [34] Schinder AF and Poo M. The neurotrophin hypothesis for synaptic plasticity. Trends Neurosci 2000; 23: [35] Mizuno M, Yamada K, Olariu A, Nawa H and Nabeshima T. Involvement of brain-derived neurotrophic factor in spatial memory formation and maintenance in a radial arm maze test in rats. J Neurosci 2000; 20: [36] Minichiello L, Korte M, Wolfer D, Kuhn R, Unsicker K, Cestari V, Rossi-Arnaud C, Lipp HP, Bonhoeffer T and Klein R. Essential role for TrkB receptors in hippocampus-mediated learning. Neuron 1999; 24: [37] Oda T, Kume T, Izumi Y, Takada-Takatori Y, Niidome T and Akaike A. Bromocriptine, a dopamine D(2) receptor agonist with the structure of the amino acid ergot alkaloids, induces neurite outgrowth in PC12 cells. Eur J Pharmacol 2008; 598: [38] Wakita S, Izumi Y, Nakai T, Adachi K, Takada- Takatori Y, Kume T and Akaike A. Staurosporine induces dopaminergic neurite outgrowth through AMP-activated protein kinase/mammalian target of rapamycin signaling pathway. Neuropharmacology 2014; 77: [39] Dijkhuizen PA and Ghosh A. BDNF regulates primary dendrite formation in cortical neurons via the PI3-kinase and MAP kinase signaling pathways. J Neurobiol 2005; 62: [40] Takada-Takatori Y, Kume T, Sugimoto M, Katsuki H, Sugimoto H and Akaike A. Acetylcholinesterase inhibitors used in treatment of Alzheimer s disease prevent glutamate neurotoxicity via nicotinic acetylcholine receptors and phosphatidylinositol 3-kinase cascade. Neuropharmacology 2006; 51: [41] Takada-Takatori Y, Kume T, Sugimoto M, Katsuki H, Niidome T, Sugimoto H, Fujii T, Okabe S and Akaike A. Neuroprotective effects of galanthamine and tacrine against glutamate neurotoxicity. Eur J Pharmacol 2006; 549: Int J Clin Exp Med 2014;7(7):