Supplementary Information
|
|
- Jewel Drusilla Robinson
- 5 years ago
- Views:
Transcription
1 Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara 1, Yuichi Hirata 3, Atsunori Ohta 1, Hiroshi Sakamoto 1, Natsuko Hada 1, Asao Katsume 1, Michinori Kohara 3, Kazumi Morikawa 2, Takuo Tsukuda 1, Nobuo Shimma 1, Graham R Foster 4, William Alazawi 4, Yuko Aoki 1, Mikio Arisawa 1, & Masayuki Sudoh 1,* 1 Kamakura Research Laboratories, Chugai Pharmaceutical Co. Ltd., 2 Kajiwara, Kamakura, Kanagawa , Japan, 2 Gotemba Research Laboratories, Chugai Pharmaceutical Co. Ltd., 135, 1, Komakado, Gotemba, Shizuoka , Japan, 3 Department of Microbiology and Cell Biology, The Tokyo Metropolitan Institute of Medical Science, Setagaya-ku, Tokyo , Japan, 4 Queen Mary University of London, Blizard Institute of Cellular and Molecular Science, 4 Newark Street, London E1 4AT, UK. *Corresponding and requests for materials should be addressed to M.S. (sudomsy@chugai-pharm.co.jp) Supplementary Figures 1-14 Supplementary Tables 1-7 (separate file)
2 % of control % of control Replicon Cells that survived IFN-a RO8191 (mm) Supplementary Figure 1. After treatment with various concentrations of RO8191 for 24 h (upper graph) or 7 d (lower graph), the replication levels of HCV RNA (genotype 1b) were analyzed using a luciferase assay, and cell viability was determined using a WST-8 assay. The data are mean values, and the bars indicate the standard deviations based on triplicated results.
3 IFN-a (4 IU/mL) Fold change of non-treated cells RO8191 (2 mm) Supplementary Figure 2. The fold change in RO8191-treated or IFN-a-treated HCV replicon cells is plotted in comparison to untreated cells. All 54,675 probes (black circles) and 318 ISG 23 probes (red circles) are shown. The red lines to the left and below the center black line indicate.5-fold change, and red lines to the right and above the black line indicate 2.-fold change.
4 Fold change of control % of control a b h 2h 4h 8h 24h CXCL1 IP-1 TNF TNF IL-6 IL6 IL-1 IL1 IL-12A IL12A IL-12B IL12B CCL2 CCL2 CCL3 CCL3 CCL4 CCL4 (CXCL1) Post treatment 4h 1 8h 2 24h 3 4h 4 8h 5 24h 6 TNF-a RO8191 Supplementary Figure 3. (a) Gene expression levels of cytokines and chemokines at indicated time points in the RO8191-treated HCV replicon cells by DNA microarray analysis. (b) NF-kB reporter gene was transiently transfected into the Huh-7 cells, and at 48 h after transfection, the cells were treated with.3 ng/ml TNF-α or 5 mm RO8191 and a further 4, 8 or 24 h later, the luciferase activity was measured. The values indicate the mean of fold change.
5 Fold change of control Fold change of control Fold change of control 12 OAS1 mrna 25 MxA mrna 6 PKR mrna IFN-a RO8191 (mm) IFN-a RO8191 (mm) IFN-a RO8191 (mm) Supplementary Figure 4. ISG expression levels were measured using real-time RT-PCR. The values are listed relative to the mrna level of human b-actin and represent the mean fold change induction compared to untreated cells. Total RNA was extracted from Hc cells treated with the indicated concentrations of RO8191 or 1 IU/mL IFN-a for 8 h, and the mrna levels of OAS1, MxA, and PKR (means and SDs) were measured using real-time RT-PCR.
6 Fold change of control Fold change of control % of control Supplementary Figure 5 c a Imiquimod (mm) Oas1b mrna Replicon Cells that survived b STAT1 py-stat1 Control medium RO mm Murine IFN-aA 1, IU/mL MEF WT Tlr3 TLR3 KO TLR4 Tlr4 KO TLR7 Tlr7 KO TLR9 Tlr9 KO RO mm d ISRE-reporter Imiquimod 1 mm JAK inhibitor (-) JAK inhibitor (+) Control RO8191 (mm) Imiquimod (mm) IFN-a (IU/mL) h
7 Supplementary Figure 5. (a) After treatment with various concentrations of imiquimod for 72 h, the replication levels of the HCV replicon were analyzed using a luciferase assay, and cell viabilities were determined using a WST-8 assay. (b) Western blot analyses of the phosphorylated and total protein levels of STAT1 in HCV replicon cells cultured in a medium containing 1 mm RO8191 or 1 mm imiquimod at.5, 1, 2, 4 and 8 h. (c) Total RNA was extracted from TLR KO MEFs cultured in the presence of 5 mm RO8191 or 1, IU/mL murine IFN-aA for 8 h, and the Oas1b mrna level was analyzed using real-time RT-PCR. The data shown are the mean fold change induction compared to untreated cells, and the bars indicate the standard deviations based on triplicated results. (d) ISRE reporter gene activation by RO8191, imiquimod or IFN-a treatment. ISRE reporter gene was transiently transfected into Vero cells, and 48 h later the cells were treated with RO8191, imiquimod or IFN-a with or without a JAK inhibitor I. After an additional 8 h, luciferase activity was measured.
8 % of no transfection % of no transfection % of no transfection % of no transfection % of no transfection % of no transfection % of no transfection % of no transfection STAT1 mrna STAT2 mrna IRF9 mrna JAK1 mrna Ctrl STAT1-1 STAT1-2 sirna (1 nm) Ctrl STAT2-1 STAT2-2 sirna (1 nm) Ctrl IRF9-1 IRF9-2 sirna (1 nm) Ctrl JAK1-1 JAK1-2 sirna (1 nm) Ctrl Tyk2 mrna Tyk2-1 Tyk2-2 sirna (1 nm) ctrl JAK2 mrna JAK2-1 JAK2-2 sirna (1 nm) IFNAR1 mrna Ctrl IFNAR1-1 IFNAR1-2 sirna (1 nm) Ctrl IFNAR2 mrna IFNAR2-1 IFNAR2-2 sirna (1 nm) Supplementary Figure 6. HCV replicon cells transfected with the indicated sirnas (1 nm). Forty-eight hours after transfection, total RNA was extracted, and the mrna levels were analyzed using real-time RT-PCR analysis. The data shown are mean values and SDs relative to the mrna level of human b-actin in non-transfected cells.
9 Inhibition (%) Inhibition (%) RO8191 a si-ifnar b si-ifnar Ctrl sirna sirna-1 sirna-2 IFN-a sirna (nm) sirna (nm) Supplementary Figure 7. The anti-hcv replicon activity of RO8191 was attenuated by a knockdown of IFNAR2 (b) but not IFNAR1 (a). Serial dilution includes the data shown in Fig. 3a and b (5 nm sirna). The inhibition of HCV replicon replication by each agent is shown (the mean and SD from 3 experiments). The HCV replicon cells were transfected with various concentrations of the indicated sirnas (blue, red, and yellow bars). Twenty-four hours after treatment with each agent, the replication levels of HCV RNA were analyzed using a luciferase assay. Forty-eight hours after transfection, the HCV replicon cells were treated with 1.5 mm RO8191 (upper graph) or 3 IU/mL IFN-a (lower graph) for 24 h.
10 Fold change of control Oas1b mrna WT IFNAR1 KO MEF WT Ifnar1 KO Control medium RO mm Murine IFN-aA 1, IU/mL Supplementary Figure 8. Total RNA was extracted from Ifnar1 KO MEFs cultured in the presence of 5 mm RO8191 or 1, IU/mL murine IFN-aA for 8 h, and the Oas1b mrna level was analyzed using real-time RT-PCR. The data shown are the mean fold change induction compared to untreated cells, and the bars indicate the standard deviations based on triplicated results.
11 Inhibition (%) Inhibition (%) Inhibition (%) Inhibition (%) Inhibition (%) Inhibition (%) Inhibition (%) Supplementary Figure 9 RO8191 IFN-a IFN-g RO8191 IFN-a a si-jak sirna (nm) sirna (nm) si-tyk sirna (nm) d e f b sirna (nm) RO8191 si-stat1 si-stat2 si-irf-9 IFN-g c sirna (nm) si-jak sirna (nm) Ctrl sirna sirna-1 sirna-2
12 Supplementary Figure 9. The inhibition of HCV replicon replications by each agent is shown (means and SDs). Serial dilution includes the data shown in Fig. 4a e (5 nm sirna). The HCV replicon cells were transfected with various concentrations of the indicated sirnas (blue, red, and yellow bars). The anti-hcv replicon activity of RO8191 was reduced by a knockdown of JAK1 (a), but not Tyk2 (b) or JAK2 (c). Forty-eight hours after transfection, the HCV replicon cells were treated with 1.5 mm RO8191 (upper graph), 3 IU/mL IFN-a or 5 ng/ml IFN-g (lower graph). Twenty-four hours after treatment with each agent, the replication levels of HCV RNA were analyzed using a luciferase assay. The anti-hcv replicon activity of RO8191 was reduced by knockdowns of STAT2 (e) and IRF9 (f), but not STAT1 (d). Forty-eight hours after transfection, the HCV replicon cells were treated with 1.5 mm RO8191 (top graph), 3 IU/mL IFN-a (middle graph) or 5 ng/ml IFN-g (bottom graph). Twenty-four hours after treatment, the replication levels of HCV RNA were analyzed using a luciferase assay.
13 a Control sirna si-jak1-1 si-jak1-2 b Control sirna si-tyk2-1 si-tyk2-2 STAT1 NT 8191 IFN NT 8191 IFN NT 8191 IFN STAT1 NT 8191 IFN NT 8191 IFN NT 8191 IFN py-stat1 py-stat1 JAK1 Tyk2 Supplementary Figure 1. The phosphorylation of STAT1 was attenuated by knockdown of JAK1 (a) but not Tyk2 (b). The HCV replicon cells were transfected with the indicated sirnas (1 nm). Forty-eight hours after transfection, the cells were treated for 15 min with 1 mm RO8191 or 2 IU/mL IFN-a. Total lysates were subjected to western blot analysis in order to analyze the phosphorylated and total protein levels of STAT1.
14 Fold change of control OAS1 mrna 4 35 Control medium RO mm IFN-a 1 IU/mL fTGH (Tyk2-WT) 2fTGH U1A (Tyk2-null) U1A Supplementary Figure 11. Total RNA was extracted from 2fTGH and U1A cells cultured in the presence of 5 mm RO8191 or 1 IU/mL IFN-a for 8 h, and the OAS1 mrna level was analyzed using real-time RT-PCR. The data shown are the mean fold change induction compared to untreated cells, and the bars indicate the standard deviations based on triplicated results.
15 Fold change of control OAS1 mrna Ctrl sirna sistat1-1 sistat1-2 Supplementary Figure 12. Sixty-four hours after indicated 1 nm sirna transfection, we treated the cells with 1 mm RO8191 for 8h. Then, RNA was extracted from the cells and OAS1 expression was determined by RT-PCR. The data are mean values, and the bars indicate the standard deviations.
16 Fold change of HCV titer at day-1 Non-treatment 1 RO8191 (3 mg/kg) PEG-IFN-a2a (3 mg/kg).5 * P=.18.1 ** P=.7 day - 1 day 1 day 3 day 7 day 1 day 14 Supplementary Figure 13. The mice were treated for 14 days with RO mg/kg/day orally or PEG-IFN-a2a 3 mg/kg subcutaneously twice weekly. Time course of serum HCV RNA levels in mice treated with RO8191 (red line, n=5), PEG-IFN-a2a (blue line, n=4) or no treatment (green line, n=8) is shown. The data are mean values, and the bars indicate the standard deviations.
17 Cell viability after infection with EMCV (%) Cell viability after infection with EMCV (%) Ctrl sirna sistat1 sistat EMCV (-) (+) No drug RO8191 IFN-a Control medium RO8191 IFN-a + EMCV Supplementary Figure 14. We transfected 5 nm STAT1- or STAT2-siRNA to A549 cells, and after 72 h we infected EMCV to the cells and treated them with 1 mm RO8191 or 2 IU/mL IFN-a. After additional 48 h incubation, we evaluated the cell viability by staining with crystal violet.
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationNature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationSupplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationPossible roles of adiponectin in inflammatory process of rheumatoid arthritis
193 Mini Review Possible roles of adiponectin in inflammatory process of rheumatoid arthritis Miho Suzuki and Masahiko Mihara Product Research Department, Fuji-Gotemba Research Laboratories, Chugai Pharmaceutical
More informationDynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in
Dynamic Interaction of Stress Granule, and Mediates Multiple Functions in Hepatitis C Virus Infection Véronique Pène, Qisheng Li#, Catherine Sodroski, Ching-Sheng Hsu, T. Jake Liang# Liver Diseases Branch,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More information4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.
List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph
More informationInvolvement of FKBP6 in hepatitis C virus replication
Supplementary Information Involvement of FKBP6 in hepatitis C virus replication Hirotake Kasai 1,*, Kunihiro Kawakami 2,*, Hiromasa Yokoe 3, Kentaro Yoshimura 4, Masanori Matsuda 5, Jun Yasumoto 1, Shinya
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationSupplementary information
Supplementary information Exosomes mediate the cell-to-cell transmission of interferon alpha-induced antiviral activity Jianhua Li, Kuancheng Liu, Yang Liu, Yan Xu, Fei Zhang, Huijuan Yang, Jiangxia Liu,
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationNature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More informationSupplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationL1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
More informationThe Chimpanzee Model Of HCV: Antiviral Therapy
The Chimpanzee Model Of HCV: Antiviral Therapy Antiviral Therapies in Chimpanzees PEG IFN + Ribavirin STAT C with DAA Protease Inhibitors Nucleoside analogues Polymerase Inhibitors NS5A Inhibitors Immunomodulators
More informationFIG S1 Examination of eif4b expression after virus infection. (A) A549 cells
Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationSUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
More informationAspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.
Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationIrf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20%
Irf7 Fold changes 3 1 Irf1 fold changes 3 1 8h h 8h 8h h 8h p-p6 p-p6 t-p6 p-irf3 β-actin p-irf3 t-irf3 β-actin TKO TKO STKO (E) (F) TKO TKO % of p6 nuclear translocation % % 1% 1% % % p6 TKO % of IRF3
More informationSupplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
More informationTrim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
More informationSupplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationAdditional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
More informationSupplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More informationSupplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
More informationSupplementary information
Supplementary information Supplementary Figure S1: Ex[Ca 2+ ]-induced IL-1ß production of monocytes primed with different TLR ligands IL-1ß release of CD14+ monocytes in response to stimulation for 16
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationGFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
More information% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationComparison of in vitro transfection efficiency of HBV plasmids between genotypes HBV expressing plasmids (5
Supplemental Materials Figures legend Supplemental Table 1, 2 and 3 Supplemental Figure 1, Figure 2 and Figure 3 Supplemental Figure 1 Comparison of in vitro transfection efficiency of HBV plasmids between
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationWest Nile Virus-Induced Interferon Production Is Mediated by the Double-Stranded RNA-Dependent Protein Kinase PKR
JOURNAL OF VIROLOGY, Oct. 2007, p. 11148 11158 Vol. 81, No. 20 0022-538X/07/$08.00 0 doi:10.1128/jvi.00446-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. West Nile Virus-Induced
More informationMicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
More informationSupplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationTransduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
More informationDeregulation of STING Signaling in Colorectal Carcinoma Constrains DNA Damage Responses and Correlates With Tumorigenesis
Cell Reports Supplemental Information Deregulation of STING Signaling in Colorectal Carcinoma Constrains DNA Damage Responses and Correlates With Tumorigenesis Tianli Xia, Hiroyasu Konno, Jeonghyun Ahn,
More informationSupporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationIntrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More information5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN
a ISG15 sirna Ctrl #1 #2 ISG15 conjugates IB: ISG15 Virus titer (Pfu/ml) b ISG15 sirna #2 10 7 Ctrl sirna+ifn+wt Ctrl sirna+ifn+67 10 6 ISG15 sirna+ifn+wt ISG15 sirna+ifn+67 10 5 10 4 10 3 Free ISG15 10
More informationHepatitis C Virus and Cytokine Responses
Hepatitis C Virus and Cytokine Responses Eui-Cheol Shin, M.D., Ph.D. Laboratory of Immunology & Infectious Diseases (LIID), Graduate School of Medical Science & Engineering (GSMSE), KAIST Daejeon, Korea
More informationSupporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
More informationmir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
More informationSupplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
More informationControl GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
More informationSupplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationNature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
More informationSupplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationSUPPLEMENTARY INFORMATION
sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing
More informationArticle Myxoma Virus dsrna Binding Protein M029 Inhibits the Type I IFN Induced Antiviral State in a Highly Species Specific Fashion
Article Myxoma Virus dsrna Binding Protein M029 Inhibits the Type I IFN Induced Antiviral State in a Highly Species Specific Fashion Masmudur M. Rahman and Grant McFadden * The Biodesign Institute, Center
More informationPro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,
More informationDownloaded from:
Goulet, ML; Olagnier, D; Xu, Z; Paz, S; Belgnaoui, SM; Lafferty, EI; Janelle, V; Arguello, M; Paquet, M; Ghneim, K; Richards, S; Smith, A; Wilkinson, P; Cameron, M; Kalinke, U; Qureshi, S; Lamarre, A;
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More information10th International Rotavirus Symposium Bangkok, Thailand
Rotavirus Host Range Restriction and Innate Immunity: Mechanisms of Vaccine Attenuation Harry Greenberg MD Stanford University 10th International Rotavirus Symposium Bangkok, Thailand 09/19/12 B dsrna
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationSupplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationDOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization
More informationSUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
More informationTitle: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1
1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More information