D CD8 T cell number (x10 6 )
|
|
- Karin Lloyd
- 5 years ago
- Views:
Transcription
1 IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) E CD CD8 T cells CD6L F Log(1)CFU/g Feces p<.1 6 -/ Days after inoculation G isotype CD+TCRβ+ LPL IL-17 Supplemental Figure 1: Characterization of Gnas CD CD and CD8 T cells Splenocytes from 8-week old and Gnas CD mice were labeled with CD Pacific blue, TCRβ percp-cy5.5, CD PE-cy7, CD6L PC and CD5 lexa 88 bs. () The number of CD T cell and () the percentage of effector and memory CD T cells (CD high CD6L low ) in Gnas CD spleens are comparable to those in spleens. The cells were gated on CD + TCRβ + T cells. (C) Comparable frequencies of CD5 + CD T cells in the two strains. Data is representative of two independent experiments. Splenocytes from 8-week old and Gnas CD mice were labeled with CD8a Pacific blue, TCRβ percp-cy5.5, CD PE-cy7, CD6L PC. (D) The CD8 T cell numbers and (E) the proportions of effector memory CD8 T cells (CD high CD6L low ) in Gnas CD spleens are comparable to those in spleens. The cells were gated on CD8 + TCRβ + T cells. (F) acterial counts in fecal homogenates from or Gnas ΔCD mice infected orally with C. rodentium (x1 8 CFU) were determined at various time points as described previously (Dann, S.M., et al. 8. J Immunol 18: ). Data are mean ± s.e.m, n=3, from a representative experiment out of three that were performed. * p value was calculated by two way NOV. (G) The reduced frequency of IL-17 + CD + LPL or IFNγ + CD + LPL in Gnas ΔCD mice in C. rodentium infection. LPLs were isolated from the colons of or Gnas ΔCD mice at day 8 post-infection as described elsewhere (Mucida, D, et al. 7. Science 317:56-6). riefly, the colonic tissues from the host mice that received either or Gnas ΔCD T cells (n=3) were pooled, cut and then digested by collagenase (type VIII; Sigma). To collect the LPL cells, the cell suspensions were carefully layered onto a % and 8% discontinuous Percoll solution and centrifuged for min at 1,g. LPL cells were recovered from the interface and were stimulated with PM/ionomycin for h. The intracellular cytokines in CD + TCRβ + -gated LPL were determined (FCS). Data of a representative mouse/group are displayed.
2 Supplemental Figure. C Relative mrn expression PDE1 PDE1 PDE1C PDE PDE3 PDE3 PDE PDE PDEC PDED PDE5 PDE7 PDE7 PDE8 PDE8 PDE9 PDE1 PDE11 fmol cmp /million cells basal ** Control PDE1 inhibitor PDE inhibitor PDE3 inhibitor PDE inhibitor PDE7 inhibitor fmol cmp /million cells forskolin ** ** Control PDE1 inhibitor PDE inhibitor PDE3 inhibitor PDE inhibitor PDE7 inhibitor Supplemental Figure : PDE inhibition increases cmp levels in CD T cells () CD T cells were enriched from splenocytes using CD-negative selection immunomagnetic beads. Total RN was extracted for qpcr analysis. Expression of mrn levels of PDE isoforms (mean ± s.e.m.) was normalized to 18S rrn housekeeping gene and expressed relative to PDE (the highest expressed PDE in CD T cells). () CD T splenocytes were treated for 3 min with PDE typespecific inhibitors as follows: PDE1 inhibitor 8-MM-IMX, 3 µm; PDE inhibitor, EHN, 1 µm; PDE3 inhibitor, milrinone, 1 µm; PDE inhibitor, rolipram, 1 µm and PDE7 inhibitor, RL-581, 3 µm, and the cmp levels determined. Data shown are from independent experiments (Mean ± s.e.m.), p<.6 vs. control treatment. (C) The enriched CD T cells were incubated with PDE inhibitors for 3 min and then with forskolin (1 µm) for 1 min. The cmp levels were measured as described in Experimental procedures.
3 Supplemental Figure 3. isotype efore fter CD CD8 IL-17 (pg/ml ) n.s. CD + depleted splenocytes from mice CD + depleted splenocytes from mice IFNγ (ng/ml ) n.s. +OV - OV +OV - OV C IL-17 (pg/ml ) 3 1 n.s. IFNγ (ng/ml ) n.s. MDC MDC +OV - OV +OV - OV Supplementary Figure 3: Deletion of Gαs in CD8 and MDCs do not affect OV-specific CD T cells responses. () Depletion of CD+ cells in splenocytes from and Gnas CD mice. The CD + cells were labeled by anti-cd biotin bs and depleted from splenocytes by biotin+ selection kit. The cells before and after CD depletion were stained with anti-cd PC and anti-cd8a PE antibodies. () Effect of CD + cell depleted splenocyte on differentiation of OT- CD T ells. The naïve OT- CD T cells ( cells) were enriched by magnetic beads (CD8 - - CD11c - CD11b - CD5 - ) and co-cultured for 5 days with or Gnas CD splenocytes ( cells) that were depleted of CD + cells in the presence or absence of class II-derived OV peptide (1 µg/ml). Cytokine concentration (IL-17 and IFNγ) in the supernatant was detected by ELIS (mean ± s.e.m, n=3). (C) Effect of Gnas CD MDCs cells on differentiation of OT- cells. The naïve OT- cells ( cell) were enriched and co-cultured for 5 days with or Gnas CD MDCs ( cell) in presence or absence of OV peptide (1 µg/ml). Cytokine concentrations (IL-17 and IFNγ) in the supernatant were detected (ELIS) (mean ± s.e.m, n=3).
4 Supplementary Figure : Sorted cells Sorted cells after 5 days culture % of Max 8.5% 9.5 % % of Max 3.8 %.5 % Foxp3 Foxp3 n.s. IL-1 (ng/ml) 3 1 C Teff only Teff: 16:1 8:1 :1 :1 % of Max 1.1%. % 3.9 % 5.1 % 5.6 % 6.% % 6 % 5.6% CFSE Supplementary Figure : Gnas CD CD T cells do not regulate cell differentiation. () Stability of Foxp3 in and Gnas CD T regulatory cells in vitro. Splenic cells (CD + CD5R low CD5 + ) were sorted from or Gnas CD mice and co-cultured for 5 days with effector CD T cells (CD + CD5R high CD5 - ) from congenic CD5.1 mice for 3 days at different ratios in the presence of anti- CD3 (1µg/ml) antibody and irradiated CD5.1+ splenocytes (3 rad). The cells (CD5. + ) before and after cultured in vitro were gated and intracellular Foxp3 expression were analyzed by FCS. () IL-1 production in and Gnas CD T reg cells. The sorted naïve and Gnas CD CDT cells were differentiated into cells in vitro (TGFβ 1 ng/ml+hil- 1 U/ml) for days. The cells were stimulated with anti-cd3/8 antibodies for h and IL-1 was measured in the supernatants (ELIS). Results are showed in mean ± s.e.m in triplicates. (C) Suppressive function of and Gnas CD cells in vitro. Splenic cells (CD + CD5R low CD5 + ) were sorted from or Gnas CD mice and co-cultured for 3 days with CFSE (5 µm) labeled effect T cells (CD + CD5R high CD5 - ) from congenic CD5.1 mice for 3 days at different ratios in the presence of anti-cd3 antibody (5 µg/ml) and irradiated splenocytes (3 rad). The effector CD T cells (CD5.1 + ) were gated and the CFSE dilution was analyzed (FCS).
5 Supplemental Figure 5. 8r ( μm) 8r (6.5 μm) 8r (1.5 μm) 8r (5 μm) 8r (5 μm) IFNγ IL-17 isotype +8r-cMP +8r-cMP IFNγ Th polarization IL- C isotype +8r-cMP +8r-cMP IFNγ polarization Foxp3 Supplementary Figure 5: cmp has divergent effects on Th subset differentiation () 8r-cMP increase Th17 differentiation in Gnas CD CD T cells in a dose-dependent manner. The sorted naïve CD T cells were cultured under Th17 differentiation condition (IL-6 and TGFβ, anti-cd3 and anti-cd8 bs and neutralized bs for IL- and IFNγ) with the indicated concentration of 8r-cMP for days. The cells were further stimulated by PM and inomycin for h in presence of GolgiStop. (-C) Cyclic MP does not affect Th and differentiation in vitro. FCS-sorted naive CD T cells from or Gnas CD spleens were cultured for days under Th () or (C) differentiation conditions as described in Experimental procedures with and without 8r-cMP (5 µm). CD T cells were then stimulated with PM/ionomycin for h and the intracellular cytokines IL-, IFNγ and Foxp3 were determined (FCS). Data is representative of independent experiments with similar results.
6 Supplemental Figure 6. 5 IL- IL-17F IL IL-3R Relative mrn expression RORγt IL-6+TGFβ IL-6+TGF β + 8r cmp RORα IL-6+TGFβ IL-6+TGF β + 8r cmp 8 6 hr IL-6+TGFβ IL-6+TGF β + 8r cmp IL-6+TGFβ IL-6+TGF β + 8r cmp 8 IL- IL-17F IL IL-3R Relative mrn expression RORγt RORα hr r cmp r cmp r cmp r cmp Supplementary Figure 6: Transcriptional regulation of Th17 differentiation in Gnas CD CD T cells FCS-sorted naive CD T cells were cultured for days under two Th17 differentiation conditions; IL-6/TGFβ () or IL-6/IL-3/IL-1β (). The CD T cells were stimulated by anti-cd3/8 bs for h. The mrn levels of cytokines and transcriptional factors were determined by qpcr. The expression levels were normalized to the expression of Rplp housekeeping gene. Data are presented as mean ± s.e.m of duplicates from one of two similar experiments.
7 Supplementary Figure 7. 3 RORγt Relative mrn expression RORγt hours after differentiation Relative mrn expression 1 6 IL-17 IL-6+TGFβ IL-6+TGF β + 8r-cMP Supplementary Figure 7: The RORγt mrn expression during Th17 differentiation in Gnas CD CD T cells () The RORγt mrn expression in and Gnas CD CD cells during Th17 differentiation. The sorted naïve CD T cells were treated by Th17 condition (IL-6 and TGFβ, anti CD3/8 bs and neutralized bs for IL- and IFNγ) for indicated the times (16,, 8, 7h after differentiation). () The mrn expression of RORγt and IL-17 at 8h after Th17 differentiation. The sorted naïve CD T cells were differentiated by Th17 condition (IL-6 and TGFβ) with or without 8r-cMP (5 µm) for 8h. The mrn expression was normalized to the housekeeping gene Rplp. The mrn expressions are shown as mean ± s.e.m of duplicated samples.
8 Supplemental Figure 8. Untreated IL-6+ TGFβ 5 min 15 min 3 min 6 min.7% 3.6 %. % 1.9 %.7 % Cell count % 5.6 % % 6. %. % pstat3 PE IL-6+ TGFβ % of Max % of Max pstat3 PE pstat3 PE Supplemental Figure 8: Stat3 phosphorylation in Gnas CD CD T cells () ctivation of Stat3 in and Gnas CD CD T cells. Enriched naive CD T cells were cultured in IMDM medium for indicated periods after treatment of IL-6 ( ng/nl)/ TGFβ ( ng/ml) and the levels of p-stat3 (py75) were determined (FCS). The numbers in the bottom of the histogram are the mean fluorescence intensity. The numbers displayed above the gate represents the percentage of positively stained cells. () CD T cells from and Gnas CD mice were stimulated by anti-cd3 (1 µg/ml) and CD8 (1 µg/ml) bs with the indicated cytokines (IL-6, ng/ml; IL-3,1 ng/ml; IL-1β, 1 ng/ml and TGFβ, ng/ml) for 15 min, and p-stat3 (py75) levels were determined (FCS). The data shown are representative of one out of two independent experiments.
9 Supplemental Figure 9. fmol cmp /million cells control αcd3 αcd3+cd8 control αcd3 αcd3+cd8 control Forskolin +Rolipram Supplemental Figure 9: TCR cross-linking enhances intracellular cmp production Splenic CD T cells were stained with anti-cd3 b (5 µg/ml), placed on ice for 1h, and then incubated with rolipram (1 µm) for 5 min at 37 C. Cells were further treated with forskolin (1 µm) and a combination of goat anti-hamster b (1 µg/ml) with or without anti-cd8 b (1 µg/ml) as indicated, for 1 min. Cyclic MP levels were determined (RI). The data are presented as mean ± s.e.m of duplicate samples.
10 Supplemental Figure 1. Relative expression Orai 1 Orai Orai 3 Stim1 Stim Relative expression CaV1. CaV1.3 CaV beta1 Supplemental Figure 1: Expression levels of ORI, STIM and L-type Ca + channels subunits in and Gnas CD CD T cells Total RN was extracted from splenic CD T cells sorted from and Gnas CD mice. The mrn expression levels for ORI, STIM and L-type Ca+ channels were normalized to the expression of the Rplp housekeeping gene. Data are presented as mean ± s.e.m from mice.
11 Supplemental Figure 11. IL-6+IL-3+IL-1! efore transfer IL-6+IL-3+IL-1!+8r-cMP 11 % of original W +8r-cMP IFNγ IL-17 p< Days after transfer C.5 IFNγ D fter transfer r-cMP Donor cells: Rag1 -/- Colon Rag1 -/MLN Rag1 -/Spleen +8r-cMP 1. IL-17 Supplemental Figure 11: Cyclic MP enhances the colitogenicity of in vitro differentiated Th17 cells (IL-6/IL-3/IL-1β) in an adoptive transfer model of colitis. FCS-sorted naive CD T cells from or GnasΔCD spleens were cultured for days under Th17 differentiation condition (IL-6/IL-3/IL-1β with/without 8r-cMP, 5 µm). The differentiated Th17 cells (1 15 cells per mouse) were adoptively transferred into Rag1-/- mice. () The intracellular expression of IFNγ and IL-17 in Th17 cells before transfer. () Percentage of initial body weight of Rag1-/- recipients transferred with Th17 cells. Data shown are mean ± s.e.m, n=5 in each group. The p value indicates two away NOV of the difference between recipients receiving either Th17 or 8r-cMP-treated Th17 cells. (C) Intracellular expression of IFNγ and IL-17 in Th17 cells 8 days post-transfer. CD+ cells harvested from the spleens or MLN of recipient mice were stimulated with PM/ionomycin for h. Intracellular cytokine levels were determined by flow cytometry. (D) Histological analysis in the colons of recipients receiving in vitro differentiated Th17 cells with or without 8r-cMP (original magnification, 5, scale bar: 1µM).
12 Supplementary Table 1: Primers sequence: Gene Forward primer (5-3 ) Reverse primers (5-3 ) Rplp GTGCGCGTCCGCT GTTCTTGCCCTCGCCC Gnas GCGGGCGCGGTCT CCCTCTCCGTTCCCTT hr CCGTCCTCCTGGTTCGCC CCTTCTTCTCCGTTGCGGTCTC Rorc CGCCCTGTGGGCT GGGGGCGGCTTGG Rora TGTGTCGCGCGTGG CGTTCTTCTGCGGGCGG Foxp3 TCGTCCCTTGCGCC CTGCGGTCCTGG Tbx1 GCCGCCCGGGC TGTGCCCCTTCCCCT Gata3 CTGTCTCCCTGGCCCTCT GGCTCTTCGCCCTTGGG Il17a GTGTTTCCTCTCC GCCGCCCCGCTTC IL CTGCGGGGTGGTCCTT CGCGCGCTTTCTCG IL1 TCGCCTCCTGTTGCTTCGTC GGGTTTGTGGCTTGGTTTGGC Il3r GCCGGCCTTCCCG TCGTGCTCTCTTCTTCGGGC Il17f TGCCTGCCCCTTCTGGGT GCGTCCTGGTCCTTCGG Stim1 GCTCTCTGCCTGCCTTCCT TCTGGCCTGGTTCCGCCT Stim GCGTGTTTTGCCGCTCTCGT GGGCCTTGCCGCG GT Cacna1c GGCCCGGTGTCGG GCGTCTCGGCTTCTTCCTC Cacna1d CCCTCGGGGTCCTCCT GCTCGTCTTGGCTGCTTTG Cacnb1 CGCCTGTGCCGTGTC GCCGGCTTCGTTGTTTG Orai1 CCGCTCGCTTCCGC GCCTGCGTGGCCC Orai TCCTCGCCCCGG CGCCCTCTGTTCTGC Orai3 GGTCCTGGGTTTGGG TTGGGCGTTGTGCGC 18s GTCCCGTTGCCCCTT CCTCCTCGGTGTGCG 6
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationSupplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationSupplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationfor six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
More informationAkt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells
Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,
More informationSupplemental Figure 1. Protein L
Supplemental Figure 1 Protein L m19delta T m1928z T Suppl. Fig 1. Expression of CAR: B6-derived T cells were transduced with m19delta (left) and m1928z (right) to generate CAR T cells and transduction
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationSupplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
More informationThe encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationSupplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
More informationSupplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationNK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
More informationB6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C
CD3-specific antibody-induced immune tolerance and suppression of autoimmune encephalomyelitis involves TGF-β production through phagocytes digesting apoptotic T cells Sylvain Perruche 1,3, Pin Zhang 1,
More informationSUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
More informationSupporting Information
Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More informationSupplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. .. Supplementary Figure 1 % of initial
More informationSupplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationSupplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
More informationCD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
More informationB220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
More informationNature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and
Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry
More informationSupplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.
Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More informationSUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
More informationSupplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
More information% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
More informationSupplementary Materials for
www.sciencemag.org/content/348/6241/aaa825/suppl/dc1 Supplementary Materials for A mucosal vaccine against Chlamydia trachomatis generates two waves of protective memory T cells Georg Stary,* Andrew Olive,
More informationSupplementary Information. A vital role for IL-2 trans-presentation in DC-mediated T cell activation in humans as revealed by daclizumab therapy
Supplementary Information A vital role for IL-2 trans-presentation in DC-mediated T cell activation in humans as revealed by daclizumab therapy Simone C. Wuest 1, Jehad Edwan 1, Jayne F. Martin 1, Sungpil
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationSupplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
More informationSupplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationControl GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationSupplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
More informationSupplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationT H 1, T H 2 and T H 17 polarization of naïve CD4 + mouse T cells
A complete workflow for cell preparation, isolation, polarization and analysis T H 1, T H 2 and T H 17 polarization of naïve CD4 + mouse T cells Introduction Workflow CD4 + T helper (T H) cells play a
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationof whole cell cultures in U-bottomed wells of a 96-well plate are shown. 2
Supplementary online material Supplementary figure legends Supplementary Figure 1 Exposure to T reg cells causes loss of T resp cells in co-cultures. T resp cells were stimulated with CD3+CD28 alone or
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationand follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationSupplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells
Chien 1 Supplementary information Manuscript: SREP-16-42480A Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by Repeated Stimulation of Antigen-Presenting B Cells Chien-Hui Chien 1, Hui-Chieh
More informationHua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik
SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder
More informationTherapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad
More informationCanberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were
Supplemental Materials and Methods Mice Female C57BL/6 (B6, I-E null, H-2 b ), BALB/c (H-2 d ) + ), FVB/N (H-2 q, I-E null, CD45.1 + ), and B6D2F1 (H-2 b/d ) mice were purchased from the Animal Resources
More informationHuman and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard
More informationSupplementary Figure 1. Ex vivo IFNγ production by Tregs. Nature Medicine doi: /nm % CD127. Empty SSC 98.79% CD25 CD45RA.
SSC CD25 1.8% CD127 Empty 98.79% FSC CD45RA CD45RA Foxp3 %IFNγ + cells 4 3 2 1 + IL-12 P =.3 IFNγ p=.9 %IL-4+ cells 3 2 1 IL-4 P =.4 c %IL-1 + cells IFNγ 4 3 2 1 Control Foxp3 IL-1 P =.41.64 4.76 MS 2.96
More informationInterferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease
Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSupplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c)
1 Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c) Serum IgG1 (a), IgM (b) and IgG2 (c) concentrations in response to papain immediately before primary immunization (day
More informationRelevant Disclosures
6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
More informationCD80 and PD-L2 define functionally distinct memory B cell subsets that are. Griselda V Zuccarino-Catania, Saheli Sadanand, Florian J Weisel, Mary M
Supplementary Figures CD8 and PD-L define functionally distinct memory B cell subsets that are independent of antibody isotype Running title: Memory B Cell Subset Function Griselda V Zuccarino-Catania,
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationHuman Immunodeficiency Virus Type-1 Myeloid Derived Suppressor Cells Inhibit Cytomegalovirus Inflammation through Interleukin-27 and B7-H4
Human Immunodeficiency Virus Type-1 Myeloid Derived Suppressor Cells Inhibit Cytomegalovirus Inflammation through Interleukin-27 and B7-H4 Ankita Garg, Rodney Trout and Stephen A. Spector,,* Department
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationOptimizing Intracellular Flow Cytometry
Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles
More informationNC bp. b 1481 bp
Kcna3 NC 11 178 p 1481 p 346 p c *** *** d relative expression..4.3.2.1 CD4 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna Kcna6 Kcna7 Kcnn4 relative expression..4.3.2.1 CD8 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSUPPORTING INFORMATIONS
SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor
More informationSupplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated
1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade
More informationSupplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More informationSipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the
Supplementary information, Data S1 Materials and Methods Mice, Ad vectors and reagents Female C57BL/6 mice, 8-10 weeks of age, were purchased from Joint Ventures Sipper BK Experimental Animal Co. (Shanghai,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationactivation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
More informationGene+c fate mapping. x loxp. Foxp3 3 UTR ROSA26 RFP IRES GFP CRE. STOP loxp. Stable Foxp3 expression. Foxp3 expression in new Treg.
1 Introduc+on (CD4 + CD25 + Foxp3 + )are indispensable for immune homeostasis. Muta+ons in Foxp3 gene leads to fatal autoimmune disorder. Condi+onal dele+on of Foxp3 reprograms cells into pathogenic Th
More informationCommercially available HLA Class II tetramers (Beckman Coulter) conjugated to
Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationSupplementary Figure 1
Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition
More informationL-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity
Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,
More informationSupporting Information
Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells
More informationSupplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. SemaB / mice have normal immune cell populations. Cells were prepared from the spleens of WT and SemaB / mice, stained with various antibodies and then
More informationSupplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15
Cell Host & Microbe, Volume 15 Supplemental Information Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection Arya Khosravi, Alberto Yáñez, Jeremy G. Price, Andrew Chow, Miriam Merad, Helen
More informationCover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/23854 holds various files of this Leiden University dissertation. Author: Marel, Sander van der Title: Gene and cell therapy based treatment strategies
More informationSupplementary Information
Supplementary Information Memory-type ST2 + CD + T cells participate in the steroid-resistant pathology of eosinophilic pneumonia Naoko Mato 1, 2, Kiyoshi Hirahara 2, Tomomi Ichikawa 2, Jin Kumagai 2,
More informationSupplemental Information. Lung gd T Cells Mediate Protective Responses. during Neonatal Influenza Infection. that Are Associated with Type 2 Immunity
Immunity, Volume 9 Supplemental Information Lung gd T Cells Mediate Protective Responses during Neonatal Influenza Infection that re ssociated with Type Immunity Xi-zhi J. Guo, Pradyot Dash, Jeremy Chase
More information