Supplementary Figure 1

Transcription

1 Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the capture panel. a, Histogram of ECCS coverage for all amplicons. b, Histogram of ECCS coverage in amplicons in which a variant was detected. a 2 Coverage Per Amplicon b Coverage per Amplicon Coverage per Amplicon with Called Variant Coverage per Amplicon

2 Tareget Space (bp) Target Space (bp) Supplementary Figure 2 Number of mutations detected per gene in exons (top panel) and introns (bottom panel) relative to the capture space (bp = base pairs) targeting that gene in the panel. 125 Detected Exonic SNVs Relative to Capture Space per Gene CUX KDM6A STAG2 BCOR BCORL1 TET2 ATRX DNMT3A 5 25 ASXL1 RAD21 NOTCH1 TP53 IKZF1 ETV6 SMC3 MYD88 CBL KRAS Detected SNVs 125 Detected Intronic SNVs Relative to Capture Space per Gene CUX1 1 TET2 STAG2 KDM6A 75 ATRX DNMT3A 5 EZH2 25 IKZF1 ETV6 FBXW7 MYD88 KRAS 2 4 Detected SNVs 6

3 probe fluorescence (A.U.) Supplementary Figure 3 Representative droplet digital PCR (ddpcr) results from NHS participant 12 for the detected DNMT3A G543A clonal variant. The wild-type probe intensity in arbitrary units (A.U.) was plotted relative to the DNMT3A G543A (mutant) probe intensity for each droplet. a-d, Variant quantification at the first time point for a, all cells; b, B lymphocytes; c, T lymphocytes; and d, myeloid cells. e-h, Variant quantification at the second time point for e, all cells; f, B lymphocytes; g, T lymphocytes; and h, myeloid cells. i, The DNMT3A G543A variant was not detected in the negative control sample from participant 2, time point 2. j, DNMT3A G543A positive (or empty) droplets were detected in the gblock positive control. a 11,79 e 92,45 i 96, , , , b 885 f 2,3 j , , ,75 c ,196 g , , ,864 d ,24 h , , , probe fluorescence (A.U.)

4 VAF by ddpcr Supplementary Figure 4. Several mutations identified by error-corrected sequencing (ECS) were verified using droplet digital PCR (ddpcr). The variant allele fractions (VAFs) identified ECS and ddpcr were highly correlated (R 2 =.98) VAF by ECS

5 Supplementary Figure 5 Heat map depicting the number of exonic single nucleotide variants (SNVs) detected in each gene per study participant. Gene DNMT3A TET2 STAG2 BCORL1 TP53 KRAS ASXL1 SMC3 RAD21 CBL BCOR NOTCH1 MYD88 KDM6A IKZF1 ETV6 CUX1 ATRX Detected Clonal Exonic SNVs per Individual SNVs Participant ID

6 K67E S129X Q231X Q249X E283X V296M R31W G32C W314X R32X S337X R379H E482X C494F G498V L58P C537F G543S G543A A572D R635W R635Q L637P L639F E667X T691I I75T S714C F731S F732S H739P A741E R749H S775_E2splice P799S H821R T834A T835A S839P W86R R882H R899G P94L Supplementary Figure 6 Detected exonic clonal single nucleotide variants (SNVs) in DNMT3A. The detected SNVs were predominantly nonsense mutations (blue) in the first half of the gene or missense mutations (red) in the three functional domains a proline-tryptophan-tryptophan-proline (PWWP) chromatin targeting domain, a zinc finger nuclease (ZFN) domain and a S-adenosylmethionine (SAM) dependent methyltransferase (MTase) domain. Exons AA Residue DNMT3A PWWP domain ZFN domain SAM-dependent MTase Missense Nonsense Splice

7 L446X W954X E1137_E3splice R1216G A1217A G1288S F139L Y1337X R1359H S1486X E1513_E1splice Y1589X T1793I Supplementary Figure 7 Detected exonic clonal single nucleotide variants in TET2. Exons AA Residue TET2 Oxygenase domain Silent Missense Nonsense Splice

8 DNMT3A KDM6A ATRX STAG2 CUX1 ETV6 EZH2 FBXW7 IKZF1 KRAS MYD88 TET2 Detected Clonal Intronic SNVs Supplementary Figure 8 Number of intronic clonal single nucleotide variants (SNVs) detected by gene. 6 Detected Intronic SNVs by Gene 4 2 Gene

9 Gene Supplementary Figure 9 Heat map depicting the number of intronic single nucleotide variants (SNVs) detected in each gene per individual. DNMT3A KDM6A STAG2 Detected Clonal Intronic SNVs per Individual ATRX TET2 MYD88 KRAS IKZF1 FBXW7 EZH2 ETV6 CUX1 Count Participant ID

10 CD19 SSC SSC SSC Supplementary Figure 1 Representative flow cytometry gating strategy from NHS participant 5, time point 1 to isolate B lymphocytes, T lymphocytes and myeloid cells. Myeloid Cells FSC CD45 CD33 B Cells T Cells CD3

11 Supplementary Table 1 Sequenced reads and error-corrected consensus sequences generated for each library. Collection 1 Replicate 1 Collection 1 Replicate 2 Collection 2 Replicate 1 Collection 2 Replicate 2 Participant ID Raw Reads ECCS Raw Reads ECCS Raw Reads ECCS Raw Reads ECCS 1 38,483,255 3,333,626 33,448,218 2,84,567 35,427,539 2,987,274 33,392,978 2,784, ,268,72 3,318,173 41,984,812 3,558,516 35,157,811 3,27,67 33,657,29 2,86, ,63,819 2,581,39 36,17,671 2,959,152 48,998,142 3,584,46 4,599,238 3,291, ,932,163 2,212,764 3,623,846 2,51,632 39,579,433 3,254,544 48,529,452 3,53, ,11,143 2,727,3 34,151,27 2,411,821 52,32,285 3,759,16 55,49,72 4,17, ,27,169 2,863,69 35,84,657 2,946,669 5,852,817 3,682,33 48,351,486 3,514, ,658,678 2,663,917 42,58,68 2,714,869 45,885,262 3,233,3 44,468,353 3,548, ,771,597 2,734,288 41,632,517 2,528,357 5,72,31 3,399,553 5,378,471 3,698, ,449,116 2,531,229 41,67,14 2,599,127 6,14,462 4,197,532 5,347,145 3,993,77 1 4,492,765 2,554,6 38,729,489 2,4,5 59,87,612 4,34,423 58,962,293 3,996, ,94,33 3,684,38 44,34,692 3,456,949 64,52,183 4,96,893 56,51,287 3,797, ,115,177 4,245,185 48,446,875 3,692,857 61,813,583 4,322,748 59,452,7 4,11, ,368,839 3,59,66 41,269,631 3,343,48 59,327,495 4,213,628 52,689,35 4,173, ,837,743 3,76,61 37,36,17 2,976,419 6,366,37 4,53,326 58,19,532 4,51, ,65,75 3,47,283 44,547,457 2,49,226 58,11,11 3,98,542 51,539,869 4,14, ,226,742 2,986,829 6,744,391 3,97,372 45,532,881 3,414,68 6,632,143 4,27, ,985,852 4,79,429 51,835,232 3,373,746 55,355,241 3,721,52 59,51,527 4,96, ,185,217 3,337,38 54,495,83 3,388,54 57,117,288 4,147,18 58,64,485 3,999, ,213,946 2,947,31 51,28,264 3,343,682 53,983,868 3,723,161 48,268,843 3,796, ,521,626 3,376,26 41,417,619 2,86,99 58,651,16 4,92,482 56,692,728 3,793,691

12 Supplementary Table 2 Clonal SNVs detected by error-corrected sequencing. Participant ID Chr Start End Ref Alt Gene Amino Acid COSMIC VAF1.1 VAF1.2 VAF2.1 VAF T C IKZF1 intronic X G T STAG2 V376L G T DNMT3A A741E T G DNMT3A H739P A G DNMT3A L637P A G DNMT3A L58P G A DNMT3A R31W C G TET2 R1216G T A TET2 A1217A G C ETV6 intronic G A DNMT3A R32X G A NOTCH1 Q2338X X G T STAG2 R35L C T DNMT3A R635Q C G DNMT3A intronic C T MYD88 I192I T G TET2 F139L T G CUX1 intronic A G CBL I383M G A DNMT3A P94L T C DNMT3A T834A G A DNMT3A P799S G A DNMT3A intronic G A DNMT3A intronic C G DNMT3A intronic C G DNMT3A intronic G A DNMT3A intronic G A DNMT3A T691I C A DNMT3A E667X G A DNMT3A L639F C T DNMT3A G543S G A TET2 splicing T C FBXW7 intronic C T IKZF1 S21S X A T ATRX intronic X G T STAG2 intronic C A DNMT3A E482X G A TET2 G1288S T C DNMT3A H821R T C DNMT3A splicing C T DNMT3A R749H G C DNMT3A S714C G A DNMT3A R635W G T DNMT3A A572D C T DNMT3A R379H C T DNMT3A V296M G A DNMT3A Q249X C G TET2 S1486X A G ASXL1 N859S X T G KDM6A intronic G C KRAS intronic X C G BCORL1 H1376Q A G DNMT3A W86R C A DNMT3A E283X G C DNMT3A S129X T A MYD88 intronic A G TP53 F27S A T ASXL1 K131X X G A BCOR A414V X G T KDM6A intronic X A T ATRX F2165Y X A G BCORL1 L47L C G DNMT3A G543A C G TET2 intronic C T SMC3 S243F G C DNMT3A R899G C T DNMT3A R882H A G DNMT3A S839P A G DNMT3A F732S C A DNMT3A C537F C A DNMT3A G498V C A DNMT3A C494F C T DNMT3A W314X C A DNMT3A G32C T C RAD21 Y598C G C DNMT3A S337X T G KRAS A66A A G KRAS S65S X C T KDM6A A239V T C DNMT3A T835A T C SMC3 L242P G T TP53 P278H G T ASXL1 R119S X T A STAG2 UTR A G DNMT3A I75T A G DNMT3A F731S T G TET2 L446X C T TET2 T1793I X G A BCOR P652P X A T STAG2 K113I X G A BCORL1 G1522S G A DNMT3A Q231X G A TET2 W954X T A TET2 Y1337X G A CUX1 R62H A G EZH2 intronic X A G KDM6A intronic X C T BCORL1 R784X T G TET2 Y1589X G A CBL C381Y T C TP53 H168R X A G ATRX intronic X C T STAG2 intronic T C DNMT3A K67E G A TET2 R1359H G A TET2 splicing C A RAD21 V32V C A ETV6 V32V C T KRAS G12D

13 Supplementary Table 3 Clonal insertion/deletion variants detected by error-corrected sequencing. Participant ID Chr Start End Ref Alt Gene AA_Change VAF1.1 VAF1.2 VAF2.1 VAF GTG DNMT3A intronic CAGT - TET2 N253fs A TET2 Y1255_G1256delinsX A - DNMT3A I75fs AGCAGCGGGAAGGGTCAGAA - DNMT3A intronic T DNMT3A T53fs TCTC - RAD21 E528fs X ATTAATTTT - STAG2 intronic C - TET2 A1381fs

14 Supplementary Table 4 Summary of droplet digital PCR validation experiments. Participant ID Gene AA_Change Cosmic Wells ECS VAF Replicate 1 Collection 1 Collection 2 ECS VAF ddpcr ECS VAF Replicate VAF Replicate 1 2 ECS VAF Replicate 2 ddpcr VAF ddpcr Control UPN.Collection 4 DNMT3A R32X STAG2 R35L DNMT3A R635Q DNMT3A P94L TET2 splice TET2 G1288S A DNMT3A S714C A DNMT3A R635W TET2 S1486X TP53 F27S A DNMT3A W86R DNMT3A G543A A DNMT3A R882H TP53 P278H DNMT3A I75T TET2 W954X TET2 Y1337X BCORL1 R784X CBL C381Y TP53 H168R KRAS G12D TET2 A1381fs Control VAF

15 Supplementary Table 5 Summary of variant VAFs detected by droplet digital PCR in sorted hematopoietic compartments. Participant ID Gene Amino Acid COSMIC Collection Bulk B T M 4 DNMT3A R32X DNMT3A R635Q DNMT3A P94L TET2 G1288S DNMT3A S714C DNMT3A W86R DNMT3A G543A DNMT3A R882H TP53 P278H DNMT3A I75T TET2 W954X TP53 H168R KRAS G12D

16 Supplementary Table 6 Primer sequences for library preparation. Primer Name Sequence i5 16N Random AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT P5 AATGATACGGCGACCACCGA P7 CAAGCAGAAGACGGCATACGA