Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Transcription

1 Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G lo ), monocytes (CD11b + Ly6C + ), B cells (CD19 + B220 hi or lo ), and T cells (CD3 + ) in the BM (a); and for progenitors including MPPs (Lin Sca-1 + c-kit + Flt3 + CD34 + ), CMPs (Lin Sca- 1 c-kit + Fc R int CD34 + ), GMPs (Lin Sca-1 c-kit + Fc R hi CD34 + ), and CLPs (Lin Sca-1 int c-kit int IL-7R + ) in the BM (b). (c) Total cell numbers in the BM and spleen from naive WT and Spp1 / mice. (d) Proportions of PMN, monocytes, B cells, T cells, and their progenitors in the BM of 7 weeks old naive WT and Spp1 / mice. (e) Proportions of Neutrophils, Ly6C + macrophages (M ), F4/80 hi M, cdc, T cell and B cells in the spleen of naive WT and Spp1 / mice. (f, g) Evaluating an impact of OPN in fetal liver progenitors. Spp1 +/ mice were bred to produce WT, heterozygous (HZ), and Spp1 / embryos to evaluate population sizes of MPPs, GMPs, CMPs, and CLPs at E13-15 (f). Percentages of embryonic progenitors are shown in (g). Data (c-e, g) are representative of two independent experiments. Data was analyzed by the Student s t-test (c-e) and ANOVA (g). N.S.; Not significant.

2 Supplementary Figure 2 Setting up experiments with irradiated mixed-bm chimeras. In all the experiments described here, donor cells were mixed at the 1:1 ratio and adoptively transferred to lethally irradiated (900 rad) recipients. (a-c) Strategy for the experiment shown in Fig. 1a, b and Supplementary Fig. 8d (a). The composition of donor LSK cells was confirmed to be ~1:1 before transfer (b). Serum OPN levels in the mix BM chimera 4 weeks after BM cell transfer were compared to those in WT and Spp1 / mice (c). Error bars denote mean ± SD. Data was analyzed by Student s t-test. (d, e) Generation of mix LSK chimera mice used in experiments shown in Fig. 1e. Flow-Sorted LSK cells from WT and Spp1 / mouse BM (10 4 cells each) were transferred with 10 7 of c-kit BM cells obtained from WT mice (with the same congenic marker with recipients) used as rescue cells (d). The composition of donor LSK cells was confirmed to be ~1:1 before transfer (e). (f, g) Generation of BM chimera mice for experiments shown in Fig. 8a-c (f). LSL-iOPN mice were described in Supplementary Fig. 7. The composition of donor LSK cells was confirmed to be ~1:1 before transfer (g).

3 Supplementary Figure 3 Cell analysis of mice going through emergency granulopoiesis induced by injection of thioglycollate or systemic infection with C. albicans. (a) Frequencies of neutrophils in the BM after thioglycollate injection in WT mice at the indicated time-points. (b, c) Population sizes of CMPs, GMPs, and CLPs in the BM at 24 hr after thioglycollate injection (b). Cell proliferation at the same time point was evaluated by Ki-67 staining (c). (d) Decreased neutrophil population sizes in the BM of WT and Spp1 / mice at 12 after thioglycollate injection. n=3 per group. (e) Numbers of neutrophils in the peritoneal cavity 12 hrs after thioglycollate injection. (f) Comparison of serum OPN levels in WT mice before and 24 hrs after thioglycollate injection. (g) Spp1 levels in BMMs after 16 hr culture with titrated cell densities on flatbottom plates without stimulation. (h) Relative mrna levels of Spp1, Tnfa, Il6, Il10 and Cxcl1 in BMMs cultured in flat-bottom wells to round-bottom wells (flat/round). (i) Spp1 mrna levels at 24-hr in BMMs cultured in supernatants (supe.) obtained from separate BMM culture using either flat- or round-bottom plates for 24 hr. (j) Reduction of Spp1 expression by inhibiting E-cadherin. BMMs were cultured on flat- or round-bottom plates (10 5 per well) with or without anti-e-cadherin antibody (10 g/ml) for 16 hr. (k, l) WT mice were treated with i.p.-injection of AMD3100 (CXCR4 antagonist; 5 mg/kg mouse weight). Total BM cell numbers and frequencies of neutrophils in BM (k) and Spp1 mrna levels in GMPs (l) are shown at indicated time-points. (m) Frequencies of CLPs, CMPs, and GMPs were examined 24 hr after Candida infection. (n) Candida CFU in the spleen 24 hrs after i.v.-injecting Candida spores (10 6 spores/mouse). Error bars (too short to be observed) denote RQ-Max/Min as described in the Method section (g). Error bars indicate mean ± SEM (a, c, d, f, h-l). Data were analyzed by the Student s t-test (b, d-f, i, j, l-m) and ANOVA (c). N.S.; Not significant.

4 Supplementary Figure 4 Gene-expression profiles of wild-type and Spp1 / MPPs at the level of single cells and bulk MPPs. (a-c) t-sne plots for the WT MPPs (3,312 cells)(a) and Spp1 / MPPs (4,575 cells)(b). Single-cell RNA-sequencing of MPPs obtained from WT and Spp1 / mice was performed 20 hrs after intraperitoneal injection of thioglycollate. Data from WT and Spp1 / MPPs were combined with sequencing depth normalization, shown with the color codes based on UMI (unique molecular identifier) count (c). (d) Heat map of differentially expressed genes in the 10 clusters was indicated. (e) mrna levels of hematopoiesis-related genes in MPPs determined by qpcr. MPPs were isolated from BM of WT, Spp1 / or LSL-iOPN-KI (LSL-iOPN) 18 hrs after thioglycollate i.p. injection. Error bars denote RQ-Max/Min as described in the Method section.

5 Supplementary Figure 5 Apoptosis and proliferation of hematopoietic progenitor cells and myeloid cells during emergency myelopoiesis. (a, b) 5-bromo-2'-deoxyuridine (BrdU: 30 mg/kg) and 5-fluoro-2'-deoxyuridine (FrdU: 3 mg/kg) were i.p.-injected to WT and Spp1 / mice at the same time as the thioglycollate i.p.-injection, and BrdU incorporation was assessed at 24 hrs after the injections. Representative histogram images (a) and frequencies of BrdU + cells in indicated progenitors (b) are shown. (c, d) Evaluating apoptosis in BM progenitors in naive WT and Spp1 / mice. Representative flow plots (c) and frequencies of apoptotic cells (d) are shown. (e) The strategy of BM transplant used in experiments shown in Fig. 4a, b, i and j. BM cells obtained from WT or Spp1 / mice (CD45.2) were transferred to lethally irradiated WT (CD45.1) recipients. Three weeks after BM cell transfer, apoptosis of cells in BM was evaluated by flow cytometry. (f, g) Evaluating apoptosis of neutrophils and Ly6C + monocytes in the BM 24 hrs after i.p. thioglycollate injection. Representative flow images (f) and frequencies of apoptotic cells (g) are shown. (h) Birc5 mrna levels in Gr-1 + cells and B cells in BM at 15 hr after systemic Candida infection (2x10 6 spores/mouse). (i) Annexin-V + cell percentages in splenic T and B cells obtained from naive WT and Spp1 / mice. (j, k) The proliferation of splenic T and B cells 3 weeks after BM cell (WT vs. Spp1 / ) transfer. BM cells were transferred to WT mice as shown in Supplementary Fig. 5e. Three weeks after BM transplantation, BrdU (30 mg/kg) and FrdU (3 mg/kg) were i.p. injected to the mice and BrdU incorporation was evaluated 24 hrs after BrdU injection. Representative histograms (j) and data with statistical analysis (k) are shown. Each dataset in (b, d, g, h, i, k) is a representative of two independent experiments. Error bars denote mean ± SD. Data was analyzed by the Student s t-test. N.S.; Not significant. *; p< 0.05.

6 Supplementary Figure 6 OPN enhances the survival of T cells during clip. (a-d) CD62L hi CD4 + T cells obtained from naive WT and Spp1 / mice were transferred to Rag1 / mice, then MLNs were evaluated on day 6. Representative flow cytometry patterns of CD4 + T cells (a). Enumeration of total cells and CD4 + T cells in the MLN (b). Proportions of proliferated CD4 + T cells determined by CFSE dilution (c) and Annexin-V + cells (d) are shown. Each dataset is a representative of two independent experiments. (e) Serum OPN levels in Rag1 / or Spp1 / Rag1 / recipients 4 weeks after transfer of CD62L hi CD4 + T cells. Error bars denote ± SEM. (f, g) T cell proliferation assay without adding extrinsic antigen. CD62L hi CD4 + T cells obtained from WT or Spp1 / mice were cultured with or without total MLN cells or splenocytes obtained from Spp1 / Rag1 / mice for 7 days (f). T cell proliferation and survival were evaluated by CFSE-dilution and staining with LIVE/DEAD, respectively (g). Each dataset is a representative of three independent experiments. (h, i) Proliferation and survival of T cells obtained from WT and Spp1 / mice upon TCR stimulation. CellTrace-labeled CD62L hi CD4 + T cells were cultured with CD3/CD28 antibody-coated microbeads for 4 days and proliferation, and the survival was evaluated by CellTrace-dilution and staining with 7-AAD, respectively. Representative flow plots (h), and frequencies of dead cells and live divided cells (i) are shown. (j, k) Numbers and frequencies of helper T cell subsets such as Th1, Th17 and Treg (j) and innate immune cells such as neutrophils, Ly6C + macrophages (M ), and cdcs (k) in MLNs at 4 weeks after WT or Spp1 / T cell transfer to Rag1 / or Spp1 / Rag1 / mice. (l, m) Cell surface expression of integrins and CCR9 (l) and frequencies of activated CD4 + T cells (CD62L lo CD44 hi ) in MLN at 4 weeks after WT or Spp1 / T cell transfer to Rag1 / or Spp1 / Rag1 / mice. Each dataset is a representative of two independent experiments. Data was analyzed by the Student s t-test. N.S.; Not significant. * p< 0.05.

7 Supplementary Figure 7 Generation of LSL-iOPN knock-in mice. (a) iopn knock-in construct. Boxes indicate Spp1 exons (only first 5 exons are shown). The iopn knock-in BAC vector has a lox-stoplox (LSL) cassette and a deletion of 45-nt in the exon 2 (gray box). The deletion allows to generate the OPN isoform that is not secreted by the lack of signal sequence. HSK-TK: herpes simplex virus-thymidine kinase. (b) Southern blot of targeted ES cells by using specific probe (blue line in (a)). Genomic DNA was digested with ScaI. The WT allele has the 10.6 kb band and the LSL-iOPN KI allele (before Flp recombination) has the 17 kb band. Clone 1B9 was used to generate the LSL fl/fl -Δ45Spp1 mouse line. (c) Confirmation of successful iopn expression sequence in LSL-iOPN (LSL fl/fl -Δ45Spp1;Vav1-Cre) mice. The 45-nt deletion in exon 2 was evaluated by PCR using specific primers (gray arrow heads in (a)), which amplify a 344-bp amplicon from the WT Spp1 allele a 299-bp amplicon from mutant Δ45Spp1 allele. (d) Quantitation of iopn was performed in ELISA in the cytoplasmic fraction obtained by iodixanol density gradient. Amounts of OPN per arbitrary volume of cytoplasmic fraction were shown. Successful separation of the cytoplasmic proteins was confirmed by Western blotting with GAPDH detection, but not with calnexin. (e) Total cell lysates (including ER/Golgi) were quantitatively evaluated for their OPN concentrations by ELISA. (f) sopn levels in BMM culture supernatants. n=3 mice per group. Error bars denote ± SEM.

8 Supplementary Figure 8 Irradiated mixed-bm chimeras with wild-type and LSL-iOPN donor cells. (a-d) BM cells obtained from WT (CD45.1) and LSL-iOPN (CD45.2) mice (a) were mixed at 1:1 ratio (b), and total of 10 7 mixed BM cells were transferred to lethally irradiated (900 rad) WT C57BL/6 mice (CD45.1/CD45.2). Three weeks after the transfer, cellularity of differentiated donor cells in the BM were analyzed by flow cytometry (c). As a positive control to show increased myeloid populations, Spp1 / donor-derived cells in mixed BM chimera mice are shown in (d). Data is a representative of two independent experiments. Error bars denote ± SEM.

9 WT Spp1 / Number of reads 37,270,633 28,982,601 Number of cells 3,294 4,574 Mean reads cells -1 11,314 6,336 Median genes cells Median UMI cells -1 1,902 1,939 Supplementary Table 1. Cell counts and sequencing totals, including unique molecular identifiers which allow for within cell, gene specific counts of RNA molecules for single cell sequencing.

10 Gene Primer Sequences Opn Forward GCCTGTTTGGCATTGCCTCCTC Reverse CACAGCATTCTGTGGCGCAAGG Tnfa Forward CATCTTCTCAAAATTCGAGTGACAA Reverse TGGGAGTAGACAAGGTACAACCC Ikaros Forward CACTACCTCTGGAGCACAGC Reverse ATAGGGCATGTCTGACAGGCA Spi1 Forward CGGATGTGCTTCCCTTATCAAAC Reverse TGACTTTCTTCACCTCGCCTGTC Pbx1 Forward AGGACATCGGGGACATTTTAC Reverse CATTAAACAAGGCAGGCTTCA Gata2 Forward CAAGAAAGGGGCTGAATGTTTCG Reverse GTGTCCCACAGGTGCCATG Notch1 Forward CCCTTGCTCTGCCTAACGC Reverse GGAGTCCTGGCATCGTTGG Notch2 Forward ATGTGGACGAGTGTCTGTTGC Reverse GGAAGCATAGGCACAGTCATC Scl Forward TCCCCATATGAGATGGAGATTTC Reverse ATTGATGTACTTCATGGCAAGG Hoxb3 Forward GCTCTTCGGAGGCTACTCCT Reverse GACTGCAGAGAACACGCTGA Hoxb4 Forward CCTGGATGCGCAAAGTTCA Reverse CTTGGGCTCCCCGCC Flt3 Forward CATCCAAGACAACATCTCCT Reverse CCCTGAAGTCAACGTAGAAG Birc5 Forward GAGGCTGGCTTCATCCACTG Reverse ATGCTCCTCTATCGGGTTGTC Actb Forward TGTTACCAACTGGGACGACA Reverse CTGGGTCATCTTTTCACGGT Hsp90ab1 Forward CCACCCTGCTCTGTACTACT Reverse CCTGAAAGGCAAAGGTCTCC SUPPLEMENTARY TABLE 2. List of primers for qpcr.

11 Cell lysate Cell lysate Supplementary Note 1 Raw images of Western blots and an agarose gel Fig. 2f Phosphorylated MST1/2 Osteopontin MST 2 MST 1 β-actin Supplementary Fig. 7d Fig. 4h Survivin β-actin 3 Fraction kD 75kD Calnexin Supplementary Fig. 7c Fraction kD GAPDH 37kD (bp)