CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
|
|
|
- Elwin Howard
- 5 years ago
- Views:
Transcription
1 a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas Supplementary Figure 1: Tissue-specific inflamamtion caused by T cells isolated from Ctla4 / mice. CD4 + T cells (1 1 5 cells) purified from spleen of Ctla4 +/+ mice,or spleen, lung, or pancreas of Ctla4 / mice were transferred into Rag2 / mice. Pancreas, lung, and heart from individual recipients were removed 3 weeks after transfer. (a) The numbers of CD4 + T cells recovered from pancreas, lung, and heart of each Rag2 / recipient mice is shown. Each bar shows the mean + s.d. from three individual mice. (b) H&E-stained sections of the pancreas, lung and heart from Rag2 / recipients of CD4 + T cells isolated from the spleen of Ctla4 +/+ mice, or from spleen, lung, or pancreas of Ctla4 / mice. The results shown are representative of two independent adoptive transfer experiments.
2 DO11.1 (Rag2 / ) Ctla4 +/+ or Ctla4 / T cells T cells from pancreas RNA DOβ TCRα cdna library DOα Thy1.1 DOβ DOα TCRα DOβ Rag2 / mice Supplementary Figure 2: Scheme of generation of DO11.1 T cells expressing TCRα cdna RV library.
3 Uninfected Empty TCRα library DO11.1 Rag2 / Ctla4 +/ DO11.1 Rag2 / Ctla4 / Thy1.1 Supplementary FIgure 3: Thy1.1 expression on T cells after retroviral infection. CD4 + T cells from DO11.1 Rag2 / Ctla4 +/+ or DO11.1 Rag2 / Ctla-4 / mice were infected with empty- or TCRα-library. Thy1.1 expression was determined by flow cytometry 5 days after infection. The numbers in each histogram represent the percentage of Thy1.1 + cells. The dotted histogram shows staining by isotype-control antibody.
4 a Thy1.1 CD4 Lung Pancreas b CD4 + Thy1.1 + cells (%) P<.5 P<.5 NS Time after transfer (d) Lung Pancreas c Ki-67 + cells (%) P<.5 P<.5 P<.5 Lung Pancreas d Ki-67 Ctla4 +/ Time after transfer (d) 38 isotype 1 Ki CD4 CD4 e Ctla4 / Lung Pancreas isotype 1 Ki CD4 CD4 Supplementary Figure 4:Tissue-specific proliferation of Ctla4 -/- T cells that express the TCRα library derived from pancreas-infiltrating T cells. (a-c) CD4 + T cells from DO11.1 Ctla4 -/- were infected with TCRα library and transferred to Rag2 -/- mice. (a) Lung and pancreas were removed 14 days after transfer and cells were stained for CD45.2, CD4, Thy1.1 and intracellular Ki-67. CD4 and Thy1.1 expression on CD cells (top) and Ki-67 expression in CD CD4 + Thy1.1 + cells (bottom) are shown. The data are representative of three individual mice. Shaded histogram shows staining by isotype-control antibody. The percentage of CD4 + Thy1.1 + cells (b) and Ki-67 + cells among CD4 + Thy1.1 + cells (c) at the indicated time points are also shown. Each bar shows mean+ s.d. from three individual mice. (d, e) CD4 + T cells were purified from spleen, lung, or pancreas of Ctla4 +/+ or Ctla4 -/- mice. Cells were stained for CD45.2, CD4 and intracellular Ki-67. Plots are gated on CD CD4 + cells.
5 a Blood glucose (mg/dl) P<.5 DOβCtla4 +/ DOβCtla4 / b Blood glucose (mg/dl) P< Time after transfer (d) Supplementary Figure 5: DOβCtla4 -/- mice do not develop diabetes. (a) Blood glucose concentrations in 7-wk-old DOβCtla-4 +/- ( ) or DOβCtla4 -/- ( ) mice. (b) Blood glucose concentrations in Rag2 -/- recipients of CD4 + T cells (1 1 5 cells) from the spleen of DOβCtla4 +/- mice (n=4; ) or from the pancreas of DOβCtla4 -/- mice (n=4; ). The results shown are representative of two independent adoptive transfer experiments.
6 a 8 6 IL-2 (pg/ml) <6.3 <6.3 <6.3 <6.3 <6.3 (-) Pdia2 Carbonic anhydrase II α-amylase Lactoferrin Carboxypeptidase B α-cd3 b Medium Pdia2 Carbonic anhydrase II α-amylase Lactoferrin Carboxy- -peptidaseb GFP Supplementary Figure 6: T cell responses against exocrine pancreas antigens. (a) CD4 + T cells (1 1 5 cells) purified from pancreatic lymph nodes of 2-day-old Ctla4 -/- mice were cultured with 1 μm of the indicated proteins in the presence of irradiated splenocytes (5 1 5 cells) or with anti-cd3 (positive control). The supernatants were harvested 24 h later and IL-2 concentrations were determined by ELISA. (b) T cell hybridomas ( cells) expressing DOβ and the TCRα library together with the NFAT-GFP reporter were cultured with 1 μm of the indicated proteins in the presence of irradiated splenocytes (5 1 5 cells). GFP expression was examined after 2 h.
7 T cells from pancreas 58α - β - RNA TCRα cdna RV library +hcd4-gfp-nfat-rv +DOβ-mCD4-RV NFAT -GFP DOβ TCRα Supplementary Figure 7: Scheme of generation of T cell hybridomas expressing TCRα library. TCRα cdna generated from pancreas-infiltrating CD4 + T cells as in Figure 3 was ligated with retrovirus vector lacking IRES-Thy1.1 to generate the TCRα cdna RV library. 58α - β - hybridomas were infected with NFAT-GFP-hCD4 RV reporter and DOβ-mCD4 RV. Sorted hcd4 + mcd4 + cells were infected with TCRα cdna library RV. CD3 + cells were sorted to obtain TCRαβ + cells.
8 Leader TRAV9D-1*1 TRAJ44*1 TRAC agaaagttcccagggccaggaccacttctgcagggtttttttttttctttagaatttta cgtacaacaggaaggtgtctagtaaaccttatgccaactgtctccaagaactgggaaca gcctctttcctgcacgagccaggtttttccagaaaggcaccagagctgtttccagtgtg cagccatgctcctggttctcatctcgttcctcgggatacatttcttcctggatgtccaa acacagacagtttcccagtctgatgcccatgtcactgtcttcgaaggagactcggtgga gctgagatgcaactattcctatggtggatccatttacctctcctggtacatccagcacc atggccgtggcctccagtttctcctcaagtactattcgggaaacccagtggttcaagga gtgaacggcttcgaggctgagttcagcaagagcgactcttccttccaccttcggaaagc ctccgtgcactggagcgactcggctgtgtacttctgtgctgcgagcagaggtggcagtg gtggaaaactcactttggggactggaacaagacttcaggtcaaccttgacatccagaac ccagaacctgctgtgtaccagttaaaagatcctcggtctcaggacagcaccctctgcct gttcaccgactttgactcccaaatcaatgtgccgaaaaccatggaatctggaacgttca tcactgacaaaactgtgctggacatgaaagctatggattccaagagcaatggggccatt gcctggagcaaccagacaagcttcacctgccaagatatcttcaaagagaccaacgccac ctaccccagttcagacgttccctgtgatgccacgttgaccgagaaaagctttgaaacag atatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaa gtagcgggatttaacctgctcatgacgctgaggctgtggtccagttga Supplementary Figure 8: cdna sequence of 29TCRα The sequence of TCRα cdna recovered from Pdia2-specific T cell clone #29. The sequences of leader, variable (TRAV9D-1*1), joint (TRAJ44*1), or constant region are shown in blue, red, green, or violet, respectively.
9 Medium alone OVA Pdia Empty DO11.1 Ctla4 +/ TCRα Empty DO11.1 Ctla4 / TCRα Thy1.1 4 CFSE Supplementary Figure 9: Antigen-specific proliferative response of T cells infected with Pdia2-specific TCRα. CD4 + T cells from DO11.1 Ctla4 +/+ or DO11.1 Ctla4 -/- mice were infected with empty or 29TCRα. T cells were recovered 5 days after infection, labeled with CFSE, and cultured with or without OVA (.3 μm) or Pdia2 (1 μm) in the presence of irradiated splenocytes. 3 days later, CFSE dilution was examined by flow cytometry.
10 a CD4 + gate with BALB/c BM DO11.1 Ctla4 +/+ BM infected with 29TCRα RV-GFP DO11.1 Ctla4 / BM infected with 29TCRα RV-GFP CD GFP b with BALB/c BM DO11.1 Ctla4 +/+ BM infected with 29TCRα RV-GFP DO11.1 Ctla4 / BM infected with 29TCRα RV-GFP Supplementary Figure 1: CTLA-4 controls the pathogenicity of Pdia2-specific T cells in cell-intrinsic and cell-extrinsic manners. BM from DO11.1 Ctla4 +/+ or DO11.1 Ctla4 -/- mice was infected with 29TCRα GFP RV and adoptively transferred into lethally irradiated Rag2 -/- mice with or without BM from BALB/c mice. CD25 and GFP expression in splenic CD4 + T cells (a) and H&E stained sections of pancreas (b) 6 weeks after BM transfer are shown.
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
Nature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Supplemental Figure 1. Protein L
Supplemental Figure 1 Protein L m19delta T m1928z T Suppl. Fig 1. Expression of CAR: B6-derived T cells were transduced with m19delta (left) and m1928z (right) to generate CAR T cells and transduction
Supplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and
Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry
Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c)
1 Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c) Serum IgG1 (a), IgM (b) and IgG2 (c) concentrations in response to papain immediately before primary immunization (day
NK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
D CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were
Supplemental Materials and Methods Mice Female C57BL/6 (B6, I-E null, H-2 b ), BALB/c (H-2 d ) + ), FVB/N (H-2 q, I-E null, CD45.1 + ), and B6D2F1 (H-2 b/d ) mice were purchased from the Animal Resources
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
Nature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
SUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood
Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were
Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
SUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
Supporting Information
Supporting Information Valkenburg et al. 10.1073/pnas.1403684111 SI Materials and Methods ELISA and Microneutralization. Sera were treated with Receptor Destroying Enzyme II (RDE II, Accurate) before ELISA
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Supplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells
Chien 1 Supplementary information Manuscript: SREP-16-42480A Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by Repeated Stimulation of Antigen-Presenting B Cells Chien-Hui Chien 1, Hui-Chieh
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
Supplementary Information
Supplementary Information Splenic red pulp macrophages are intrinsically superparamagnetic and contaminate magnetic cell isolates Lars Franken, arika Klein, arina Spasova, nna Elsukova, Ulf Wiedwald, eike
Peli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection
Supplementary Figure 1 Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection with influenza virus. (a) ST2-GFP reporter mice were generated as described in Methods.
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
Supplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.
Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal
Supplementary Figure 1. Example of gating strategy
Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte
Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
NC bp. b 1481 bp
Kcna3 NC 11 178 p 1481 p 346 p c *** *** d relative expression..4.3.2.1 CD4 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna Kcna6 Kcna7 Kcnn4 relative expression..4.3.2.1 CD8 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs.
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs. Predicted CD28H protein sequences from human, chimpanzee (pan
SUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
a surface permeabilized
a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.
Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. .. Supplementary Figure 1 % of initial
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
Dendritic cell subsets and CD4 T cell immunity in Melanoma. Ben Wylie 1 st year PhD Candidate
Dendritic cell subsets and CD4 T cell immunity in Melanoma Ben Wylie 1 st year PhD Candidate Melanoma Melanoma is the 4 th most common cancer in Australia. Current treatment options are ineffective resulting
Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.
C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
Supplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. SemaB / mice have normal immune cell populations. Cells were prepared from the spleens of WT and SemaB / mice, stained with various antibodies and then
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
Supplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells
Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,
islets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
Supporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
SUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
Fig. S1 A. week 4 week 6
Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
Supporting Information
Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or
Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki
a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)
Supplementary Materials for
www.sciencemag.org/content/348/6241/aaa825/suppl/dc1 Supplementary Materials for A mucosal vaccine against Chlamydia trachomatis generates two waves of protective memory T cells Georg Stary,* Andrew Olive,
Supplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
Mst1 regulates integrin-dependent thymocyte trafficking and antigen recognition in the thymus
Mst1 regulates integrin-dependent thymocyte trafficking and antigen recognition in the thymus Yoshihiro Ueda, Koko Katagiri, Takashi Tomiyama, Kaneki Yasuda, Katsuyoshi Habiro, Tomoya Katakai, Susumu Ikehara,
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure S1. CNTRL-FGFR1 fusion kinase induces both T-cell lymphoma and AML. A) Peripheral blood smears from a CNTRL-FGFR1 mouse, showing predominance of immature
CD80 and PD-L2 define functionally distinct memory B cell subsets that are. Griselda V Zuccarino-Catania, Saheli Sadanand, Florian J Weisel, Mary M
Supplementary Figures CD8 and PD-L define functionally distinct memory B cell subsets that are independent of antibody isotype Running title: Memory B Cell Subset Function Griselda V Zuccarino-Catania,
Supplementary Figure 1
Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition
L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity
Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
The Bcl-2 regulated apoptotic pathway is critical for the
The Journal of Immunology Defects in the Bcl-2 Regulated Apoptotic Pathway Lead to Preferential Increase of CD25 low Foxp3 + Anergic CD4 + T Cells Yifan Zhan,*, Yuxia Zhang,* Daniel Gray,* Emma M. Carrington,*
LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)
A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC