Supplementary Information

Transcription

1 Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding to CD160, BTLA or HVEM transfectants. (b) Flow cytometry of CD4 + T cell activation and apoptosis after crosslinking with the indicated combination of anti-cd3, anti-cd28, anti-cd160 or isotype control mabs. Purified CD4 + T cells were stimulated with latex beads coated with migg1, or anti-cd3 and anti-cd28 (1 & 0.5 µg/ml, respectively) together with 10 µg/ml migg1 or anti-cd160, anti-btla or HVEM-Ig. Cells were harvested after 24h and stained with CD69, isotype control, or propidium iodide (PI) and immediately analyzed by FACS. The percent positive cells are indicated in the upper right. Data shown are representative of 3 (a, b) experiments. 1

2 Supplementary Figure 2. (a,b). Interactions of HVEM, CD160, BTLA, and LIGHT. Six fractions from protein A/G beads were collected and ran on SDS-PAGE and stained with Coomassie (a) or transferred onto PVDF membrane and blotted with anti-btla mab followed by goat anti-mouse IgG1-HRP (b). (c) Mean fluorescence intensity (MFI) of CD160-Ig, BTLA-Ig or LIGHT-decahis binding to 300-HVEM cells. 300-HVEM were stained with CD160-hIgG4, BTLA-mIgG2a, or LIGHT-decahis followed by detection with PE conjugated goat anti-human IgG, goat anti-mouse IgG2a, or mouse anti-light. Data shown are representative of 2 experiments. (d) Flow cytometry of CD160 and BTLA transfected cells stained with BTLA-Ig, CD160-Ig, or LIGHT-decahis (filled histograms) or isotype control protein (open histograms) followed by PE labeled goat anti mouse IgG2a, goat anti-human IgG or mouse anti-light. Data shown are representative of 3 (a, b), 2 (c), 3 (d) experiments. 2

3 Supplementary Figure 3. Time course of BTLA, LIGHT, and CD69 expression following CD4 + T cell activation.. (a,b) Purified CD4 + T cells were stimulated with isotype or anti-cd3 (1 µg/ml) or anti-cd3 and anti-cd28 (1 & 0.5 µg/ml respectively). (a) Flow cytometry of CD4 + T cells harvested on the indicated days, washed, and stained with BTLA, LIGHT, CD69 or isotype control mabs. The percent positive cells are indicated in the upper right. (b) mrna expression of BTLA and LIGHT relative to GADPH determined by qrt-pcr. Activated CD4 + T cells were harvested 16 hours post activation, RNA extracted, and qrt-pcr performed. Data shown are representative of 3 (a, b) experiments. 3

4 hcd160 extracellular domain, sense hcd160 extracellular domain, anti-sense hbtla extracellular domain, sense hbtla extracellular domain joined to migg2a, anti-sense hinge CH2, CH3 of mouse IgG2a, sense hinge CH2, CH3 of mouse IgG2a, antisense HVEMΔCRD1 in pcdm8, 5' sense HVEMΔCRD1 in pcdm8, 5' anti-sense HVEMΔCRD1 in pcdm8, 3' sense HVEMΔCRD1 in pcdm8, 3' anti-sense mhvem cdna, sense mhvem cdna, anti-sense mcd160 extracellular domain, sense mcd160 extracellular domain joined to migg2a, anti-sense migg2a Fc, sense migg2a Fc, anti-sense 5 GACACGAAGCTTCTCGAGGCCGCCAC CATGCTGTTGGAACCCGGCAGA 5 GACTCCAGATCTGAACTGAGAGTGCC TTCATTATGG 5 TTCAAA TCCACCATGAAGACATTGCC TGCCATGCTT 5 CTTGATTGTGGGCCCTCTGCTTGCCA TTTCGTCCTTG 5 GGGCCCACAATCAAGCCCTGTCCTCC ATGCAAAT 5 AGTAACGTTAGTCGACCTGAGAGTTT TGTGGGTGCTG 5 AGGGAGACC CAAGCTTCTAGAGAT 5 AGGGTTCGGACGGCAGAGCTGGGGC GTAGCA 5 TGCCGTCCGAACCCTGCCCTCCAGG CACCTAC 5 CGTGGTGAC GTCCGGAGGGGCCTGC AGGGCCTCAATGACTGTG 5' GCTCTTGGCCTGAAGTTTCTTGAT 5 - GTCACCCAGAATTTGTTCAGTTGGA 5 -TTCAAATCCACCATGCAAAGAATCCTG ATGGC 5 - GGGCCCTCTGGGCTCTCCGGAGAGA GTGCCGTTGATATG 5'- GAGCCCAGAGGGCCCACAATCAAGCC CTGTCCTC 5 -GAGGACAGTAACGTTAGTCGACCTGA GAGTTTTGTGGGTGCTGAGGGCTTGATT GTGGGCCC Supplementary Table 1. Primers used in DNA constructions. Supplementary Methods: Immunoblot assay. Purified CD4 + T cells (10 5 /ml) were stimulated with latex beads coated with 3 µg/ml anti-cd3 (UCHT1), 3 µg/ml anti-cd28 (MAB342), 10 µg/ml anti- CD160 (5D.10A11) or an equal amount of migg1 at a ratio of 1 bead: 1 CD4 + T cell on ice for 30 minutes, followed by 20 µg/ml goat anti-mouse IgG (Southern Biotech,) and immediately incubated at 37 o C for 4 minutes. Cells were chilled in 10 ml cold PBS on ice, then centifuged at 2000 rpm, 4 o C, solubilized in 1 ml lysis buffer (10 mm Tris-HCl (ph 8.2), 140 mm NaCl, 2 mm EDTA, 1 mm PMSF, 10 µg/ml aprotinin, 1% NP-40 and 3mM Na 3 VO 4 ) (Sigma) on ice for 15 minutes and centrifuged at 14,000g for 10 min. 4

5 Extracts (10 µg per lane) were boiled and separated on NuPage 4-12% Bis-Tris gradient gel (Invitrogen), transferred to PVDF membrane, and blotted with 4G10-HRP (1:10,000, Upstate), stripped, re-probed with anti-β Actin (Clone AC-15, Sigma) to monitor the total protein loaded into the gel. For immuno-precipitation with anti-cd3ζ (sc-1239, clone 6B10.2, Santa Cruz), 1 ml total cell lysate from 20 x10 6 CD4 + T cells was pre-cleared with 50 µl protein G/A-Sepharose (Pharmacia) at room temperature for 1 hour. After Protein G/A-Sepharose was removed by centrifugation through a column tube (Handee Spin Cups, Pierce), cell lysate was incubated with 1 µg/ml anti-cd3ζ and 50 µl protein G/A-Sepharose overnight at 4 o. CD3ζ immunoprecipitates were passed through a column tube, washed 4 times with lysis buffer, and eluted with 0.1M Glycine-HCl (ph 2.7) before SDS-PAGE and blotting with 4G10-HRP. The PVDF membrane was stripped and re-probed with anti-cd3ζ (clone 6B10.2, Santa Cruz) to monitor the amount of CD3ζ on the gel. qrt PCR and microarray analysis. Purified CD4 + T cells were stimulated with latex beads coated with 1 µg/ml anti-cd3, 0.5 µg/ml anti-cd28, 10 µg/ml anti-cd160, (5D.10A11), or migg1 as indicated. Supernatants were harvested for cytokine assay, and total RNA was isolated with Trizol (Invitrogen) for qrt PCR and microarray analysis (Affymetrix, HG-U133_Plus_2) at 0, 4, 16, and 48 hours. The relative expression of IL-2 mrna to GADPH was assayed in ABI 7500 real time PCR machine (Applied Biosystems, Inc). Primer and FAM-labeled Probes for IL2, GADPH, CD160, IL17, TGFB1, and FOXP3 were purchased from Applied Biosystems, Inc. Microarray analysis was performed at the Dana Farber Cancer Institute Microarray Core Facility. Data shown are derived from model based (dchip, by Cheng Li and Wen Wang at calculation of original fluorescence units from the Affymetrix gene chip by subtracting background and normalization. Confocal microscopy. Purified CD4 T cells were stimulated with antibody coated latex beads for 4 days (1 and 0.5 µg/ml anti-cd3 and anti-cd28, respectively). Cells were harvested and washed, followed by staining with anti-cd160, and goat anti-mouse IgG1- FITC and washed. Cells were then stained with anti-cd3-cy5, or anti-btla-biotin and 5

6 Streptavidin-Cy5. After the final wash, cells were allowed to settle on 35mm glass bottom culture dishes (MatTek Corporation) before confocal microscopy in Brigham and Women s Hospital Confocal microscopy Core Facility. Images were acquired on a Nikon TE2000-U inverted microscope equipped with a Nikon C1 Plus confocal system, a 60x Nikon Plan Apochromat objective, a 10 mw Spectra Physics 488 nm argon laser, a Melles Griot Red HeNe 633nm laser, and Chroma 515/30 and 650/LP emission filters. 6