Supplemental Figure 1
|
|
- Patience Hardy
- 5 years ago
- Views:
Transcription
1 Supplemental Figure 1 1a 1c PD-1 MFI fold change IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb IFN-γ TNF-α TGF-β1 NFATc1 -TTTTTCC-3 -TTTTTGG-3 +1 Gated on CD4+ T cells Gated on CD8+ T cells pdcd1 1d 1b PD1 MFI (x1 4 ) Relative Luciferase Unit DMSO CsA Concentrations (µg/ml) * NFATc1 Mut Medium + TGF-β1 Medium 1e Relative Luciferase Unit EV 4 8 Medium +TGF-β1 * * TGF-βRI/RII (µg) 1f SSC Isotype Empty Vector TGF-βRI/RII (4µg) % % TGF-βRII 1g Gapdh Pdcd-1 Fold Enrichment Relative to IgG Fold Enrichment Relative to IgG Medium +TGF-β1 +TGF-β1+SB IgG αnfatc1 IgG αnfatc1
2 Supplemental Figure 2 2a mrna expression relative to mock Scramble mrna expression relative to mock Scramble 2b IB: IB: β-actin IB: IB: β-actin Mock Mock 2c 2d Isotype Ova Ova+TGF-β1 IB: IB: β-actin IB: IB: β-actin #1 #2 #1 #2 #1 #2 OT-I OT-II MFI 67.2 MFI 112 MFI 21.1 MFI MFI 826 MFI 485 MFI 15 MFI PD-1 LAG3 2e 2f CD8+ TILs CD4+ TILs LAG3+[%] normalized to * PD1+[%] normalized to
3 Supplemental Figure 3 3a PD CD Foxp3 1 CD4+ Foxp3+ [%] Plot CD4+ 1 PD1+ 5 3b +TGF-β1 Count Foxp3- Foxp Foxp3-GFP Count Gated on Foxp3+ or Foxp3- Foxp3- Foxp PD-1 Isotype +TGF-β1 : Gated on Foxp3+ subset +TGF-β1 : Gated on Foxp3- subset 3c
4 Supplemental Figure 4 4a Isotype Representative Plots b Proliferation [%] N N CFSE PD-1 LAG LAG3 MFI PD-1 MFI c N Isotype Representative Plots CFSE PD-1 LAG3 4d Proliferation [%] PD-1 MFI LAG3 MFI N
5 Supplemental Figure 5 5a 5b TIL Tumor Volume (mm3) Days * PD-1 MFI (Gated on PD-1+) * 1 5 PD-1 MFI (Gated on PD-1+) c 25 TIL 2 LAG3+ [%] LAG3+ [%] d 1 1 +TGF-β % % % % SSC IL-2
6 Supplementary Information Supplemental Figure 1. (a) The effect of various cytokines on PD-1 expression is shown as fold changes in MFI relative to the CD3/ CD28 condition with no cytokines in both CD4+ (black bars) and CD8+ (white bars) T cells. CD3+ T cells were enriched using magnetic isolation kits from the peripheral blood of healthy donors. The cells were activated with CD3/ CD28-conjugated beads in the presence of an individual cytokine (data from 5ng/ml is shown) with a cell to bead ratio of 1:1. In some experiments, a 1:3 cell to bead ratio was used with no changes in the relative effect of cytokines observed. After 72 hr, the cells were harvested and CD3+ CD4+ or CD3+ CD8+ were gated in order to assess respective PD-1 surface expression via flow-cytometry. (b) TGF-β induced proportionate increases in intracellular and surface PD-1 in the presence of CD3/ CD28 stimulation as described in (a). (c) Human peripheral CD3+ T cells were isolated and activated with CD3/ CD28-conjugated beads in the absence or presence of TGF- 1 for 72 hr. Cyclosporine A (CsA) was added after 24 hr of activation at varying concentrations and PD-1 expression was assessed by flow-cytometry: medium alone (filled circles); CD3/ CD28 (open circles); CD3/ CD28+TGF- 1 (filled triangles). The result is representative of two independent trials. (d) A putative NFATc1 binding site relative to Smad-binding elements (SBE) on a human Pdcd-1 promoter region. (e) Jurkat T cells were transfected with a luciferase vector containing wild-type () or mutant (Mut) NFATc1 site of the human Pdcd-1 promoter as described in the Method section, and luciferase activity was measured after activation with CD3/ CD28. The result is shown as the mean +/- SEM of technical replicates and is representative of at least two independent trials. (f) Jurkat T cells were transfected with a 1.9 kb long human Pdcd-1 promoter-driven luciferase vector together with different amounts of TGF- RI and RII expression plasmids. Subsequently, the cells were activated with CD3/ CD28 with (white bars) or without TGF- 1 (grey bars) and luciferase activity was measured. The result is shown as mean +/- SEM of technical replicates and representative of at least two independent trials. (g) Transfection efficiency of TGF- RI and RII expression plasmids on Jurkat T 1
7 cells by flow-cytometry, as shown in SSC (Y-axis) and TGF- RII (X-axis) (right). EV: empty vector. The result is representative of two independent trials. (g) Chromatin immunoprecipitation analysis of NFATc1 on the human Pdcd-1 promoter. Human peripheral CD3+ T cells were isolated and activated with CD3/ CD28-conjugated beads in the absence (black bars) or presence (hatched bars) of TGF- 1 for 24 hr and the ChIP assay was performed as described in the Method section. The degree of enrichment is shown as fold-change (Y-axis) relative to non-specific binding by an isotype control in a human Gapdh or Pdcd-1 promoter region. The result is shown as the mean +/- SEM of technical replicates and representative of at least two independent trials Supplemental Figure 2. (a) qpcr analysis of and mrna levels in Jurkat T cells. Jurkat T cells were transfected with scramble, and as described in the Method section. After resting overnight, the cells were harvested and cellular RNA was isolated in order to assess and transcript levels. The result is shown as mean +/- SEM of technical replicates and representative of at least two independent trials. (b) transfected Jurkat T cells were harvested and lysed for western blot analysis of and. (c) Western blot analysis of Cre-mediated gene knock-out in and CD4+ T cells. Naïve CD4+ T cells (CD4+ CD25- CD62L+) were flow-sorted from, and mice and were activated with CD3/ CD28 for 72 hr. The cells were harvested and lysed for western blot analysis of and expression as described in the method section. Numbers represent biological replicates of each group. (d) Ovalbumin-specific CD8+ (OT-I) (top) and CD4+ (OT-II) (bottom) T cells were enriched by magnetic isolation from the spleen and activated for 72 hr with Type1 Ovalbumin (Ova) and Type II Ova (1 µg/ml) in the presence of irradiated splenocytes under different conditions. PD-1 (left) and LAG3 (right) expressions are shown in representative histograms: isotype (shaded histogram), peptide alone (thin histogram), peptide with TGF- 1 (5 ng/ml) (bold histogram). (e) Average CD8+ LAG3 + percentages in and TIL are shown as normalized 2
8 values to CD8+ LAG3+ percentages. (f) Average CD4+ PD-1+ percentages in and TIL are shown as normalized values to CD4+ PD-1+ percentages. The data were analyzed using Student s t-test and considered significant if *p<.5, **p<.1, ***p< Supplemental Figure 3. (a) Foxp3 expression in CD4+ PD-1+ T cells infiltrating the tumor microenvironment in, and mice. A representative Foxp3 expression histogram is shown (left) and percentage of Foxp3 among PD-1+ CD4+ T cells in each group is shown as mean +/- SEM. (b) CD4+ T cells were magnetically isolated from Foxp3-GFP transgenic mice, and were activated with CD3/ CD28 for 72 hr with or without TGF- 1. PD-1 expression was separately assessed on GFP+ and GFP- subsets as shown in representative histograms: isotype (light shade); CD3/ CD28 (dashed line); GFP+ subset from CD3/ CD28+TGF- 1 (dark shade); GFP- subset from CD3/ CD28+TGF- 1 (black line). (c) Average PD-1 MFI on CD4+ Foxp3+ (left) and CD4+ Foxp3- (right) are shown in, and TIL isolated from MC Supplemental Figure 4. (a) Representative histograms of CFSE (left), PD-1(middle) and LAG3 (right) expression on (thin grey histogram) and (thin black histogram) OT-I cells originating from the draining lymph nodes () (top) and non-draining lymph nodes (N) (bottom). (b) CFSE-, PD-1+ and LAG3+ OT-I subsets in s were gated based on OT-I cells from Ns. The percentage of CFSE- (top) and MFI of PD-1 (middle) and LAG3 (bottom) of each subset are shown as mean +/- SEM, and the data represent two independent trials. (c,d) The same analysis was performed on and OT-I cells and the data represent two independent trials Supplemental Figure 5. (a) and DNTGF RII Tg+ mice were injected with 1 5 B16 melanoma cells in foot-pads, and tumor volume (mm 3 ) is shown as mean +/- SEM on different days. (b) PD-1 MFI of PD-1+ CD8+ subset originating from the tumor microenvironment (left) and (right) is 3
9 assessed from each mouse on Day 27. (c) The percentage of the LAG3+ CD8+ subset originating from the tumor microenvironment (left) and (right) is assessed from each mouse on Day 27. (d) Isolated CD4+ T cells from and mice were activated with CD3/ CD28 for 72 hr with or without TGF- 1 and representative plots of IL-2 expression are shown. The data were analyzed using Student s t-test and considered significant if *P<.5. 4
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationSupplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationCD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
More informationSupplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationD CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationSupplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationand follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
More informationSupplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.
Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal
More informationSupplemental Information. Checkpoint Blockade Immunotherapy. Induces Dynamic Changes. in PD-1 CD8 + Tumor-Infiltrating T Cells
Immunity, Volume 50 Supplemental Information Checkpoint Blockade Immunotherapy Induces Dynamic Changes in PD-1 CD8 + Tumor-Infiltrating T Cells Sema Kurtulus, Asaf Madi, Giulia Escobar, Max Klapholz, Jackson
More informationSupplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationTransduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
More informationSpleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.
C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice
More informationSupplementary Figures
MiR-29 controls innate and adaptive immune responses against intracellular bacterial infection by targeting IFN-γ Feng Ma 1,2,5, Sheng Xu 1,5, Xingguang Liu 1, Qian Zhang 1, Xiongfei Xu 1, Mofang Liu 3,
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationSupplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More information% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplementary Figure 1
Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition
More informationL1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
More informationSupplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
More informationDual Targeting Nanoparticle Stimulates the Immune
Dual Targeting Nanoparticle Stimulates the Immune System to Inhibit Tumor Growth Alyssa K. Kosmides, John-William Sidhom, Andrew Fraser, Catherine A. Bessell, Jonathan P. Schneck * Supplemental Figure
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationSupplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
More informationNature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
More informationECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
More informationB220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationSupplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. SemaB / mice have normal immune cell populations. Cells were prepared from the spleens of WT and SemaB / mice, stained with various antibodies and then
More informationSUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
More informationNature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
More informationfor six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
More informationAkt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells
Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationSupplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
More informationRelevant Disclosures
6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationThe encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationHuman and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard
More informationTranscription factor Foxp3 and its protein partners form a complex regulatory network
Supplementary figures Resource Paper Transcription factor Foxp3 and its protein partners form a complex regulatory network Dipayan Rudra 1, Paul deroos 1, Ashutosh Chaudhry 1, Rachel Niec 1, Aaron Arvey
More informationSupplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
More informationB6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C
CD3-specific antibody-induced immune tolerance and suppression of autoimmune encephalomyelitis involves TGF-β production through phagocytes digesting apoptotic T cells Sylvain Perruche 1,3, Pin Zhang 1,
More informationUSP15 stabilizes MDM2 to mediate cancer cell survival and inhibit antitumor T cell responses
Supplementary Information USP15 stabilizes MDM2 to mediate cancer cell survival and inhibit antitumor T cell responses Qiang Zou 1, Jin Jin 1, Hongbo Hu 1, Haiyan S. Li 1, Simona Romano 1,4, Yichuan Xiao
More informationControl GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSupplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
More informationDendritic cell subsets and CD4 T cell immunity in Melanoma. Ben Wylie 1 st year PhD Candidate
Dendritic cell subsets and CD4 T cell immunity in Melanoma Ben Wylie 1 st year PhD Candidate Melanoma Melanoma is the 4 th most common cancer in Australia. Current treatment options are ineffective resulting
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationSupplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages
Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,
More informationNK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
More informationHua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik
SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder
More informationILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and
Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationSupplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
More informationNature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationSupplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells
Chien 1 Supplementary information Manuscript: SREP-16-42480A Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by Repeated Stimulation of Antigen-Presenting B Cells Chien-Hui Chien 1, Hui-Chieh
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationAppendix Figure S1 A B C D E F G H
ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationFIG S1 Examination of eif4b expression after virus infection. (A) A549 cells
Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More information