Study of Immunoglobulin G Avidity to Herpes simplex 2 in Pregnant Egyptian Women: One Center Report

Transcription

1 Research Article International Journal of advances in health sciences (IJHS) ISSN Vol2, Issue1, 2015, pp Study of Immunoglobulin G Avidity to Herpes simplex 2 in Pregnant Egyptian Women: One Center Report 1 Maysaa El Sayed Zaki, 1 Douaa Raafat El- Deeb, 1 Mona Fathy Foad Gorgy and 2 Ahmed Mahmoud Badawy 1 Clinical Pathology, 2 Obstetric and Gynecology Department, Mansoura Faculty of Medicine, Egypt Corresponding Author: may_s65@hotmail.com [Received-24/01/2015, Accepted-02/02/2015] Running title: HSV2, IgG, IgM, PCR, IgG avidity ABSTRACT Background: Herpes simplex virus is a DNA virus. It has two types herpes simplex 1 and herpes simplex 2. Affection of pregnant women by this virus carries adverse effect to the pregnancy outcomes. Aim: The aims of the current study were to determine the HSV-2 seroprevalence associated with infection among a sample of Egyptian pregnant women, and also IgG avidity index was evaluated to detect early HSV- 2 infections. Moreover, polymerase chain reaction was used to identify the presence of viremia among seropositive screened women. Material and Method: The study included 186 pregnant women in the third trimester. Blood samples were obtained for serological studies of herpes simplex 2 (HSV2) by immunoglobulin G (IgG) and immunoglobulin M (IgM) and IgG avidity test. Molecular study of HSV2 virus DNA in blood samples by polymerase chain reaction (PCR). Results: For virological markers for HSV2, the most common marker was positive IgG 26.9%, followed by PCR for HSV2 DNA15.6% and IgM 14%%.None of the patients had any other positive markers for Toxoplasma, rubella or CMV. Study of the avidity index for HSV2 IgG revealed that IgG index was <67% in 30 positive samples (60%) while 20 (40%) samples had an avidity index >67%. In women with bad obstetric history, the most common HSV2 marker was IgG (50%) followed by PCR (30.8%) and IgM. IgG validity index indicating recent infection, i.e. <67% were found in 21.8%. The virological markers for HSV2 were statistically significantly higher in women with BOH compared with women with a normal pregnancy history (P= ). There was statistically significant correlations between positive PCR results and IgM (65.5%, P= ), IgG (79.3%- P= ) and IgG index <67% (48.3%- P= ). Conclusion: The study highlights that of herpes simplex virus 2 is mundane among pregnant Egyptian women. Avidity test for IgG is valuable for laboratory diagnosis of primary herpes simplex virus in asymptomatic pregnant women. Elongated antenatal screening for herpes simplex 2 by serological markers and avidity IgG should be rigorously implanted in screening program to avert fetal complications. Keywords: HSV2, IgG, IgM, PCR INTRODUCTION Herpes simplex virus (HSV) is a double stranded enveloped DNA virus, belonging to the family of Herpesvirida. The virus is transmitted across mucosal membranes and

2 skin through abrasions, migrating to nerve tissues, where they persist in a latent state. The site of affection was speculated to be according to the virus type, mainly HSV-1 found in the facial lesions, and it is typically found in the trigeminal ganglia, whereas HSV-2 was predominately localized in the lumbosacral ganglia [18]. Primary genital HSV-1 or HSV-2 infection in pregnant women can lead to several unfavorable outcomes of pregnancy, including but not limited to abortion, premature labor and congenital and neonatal infection with herpes [8,9,24], HSV-2 infections in the newborn are especially severe and mainly affect the central nervous system of the newborn [36]. Infants born to mothers who have primary infections at the time of delivery are at the risk of acquiring HSV, with transmission rates of 50% or more [8,36]. For infants born to mothers who have new infections that are non primary, the transmission rates are in the order of 30%. The lowest risk of neonatal transmission occurs in the situation where the mother has an active infection that was acquired before pregnancy or in stages of gestation before the onset of labor with only less than 2% affection of those infants [36]. Recent changes in HSV-1 and HSV-2 infections sites affection have been studied, with type changes and sequential genital infections with HSV-1 and HSV-2 [1,31]. The complications associated with unfavorable foetal outcome have been called bad obstetric history. Bad obstetric history (BOH) implies previous unfavorable foetal outcome in terms of two or more consecutive occasions. The etiology of BOH can be attributed to various factors like genetic, hormonal, abnormal maternal immune response, and maternal infection [34]. It was long ago established that primary infections caused by TORCH Toxoplasma gondii, rubella virus, cytomegalovirus (CMV), and Herpes simplex virus (HSV) is the major cause of BOH [27]. Little is known about the risk factors associated with HSV2 seropositivity in pregnant Egyptian women and its association with BOH. Although there is improvement in the diagnosis and treatment of HSV2 infections, still it represents a problem in developing countries. Clinical diagnosis of HSV2 is troublesome, since most of the maternal infections with adverse outcomes are initially asymptomatic. There is serological diagnosis of HSV2 for detection of specific immunoglobulins G and M (IgG& IgM). HSV-2 serology is an important screening method among pregnant women during early pregnancy for follow up during pregnancy to seronegative women to detect new cases with primary infection during the second half of pregnancy that carries a higher risk to transmit the virus to neonate. However, it is not possible to classify the infection between primary or non primary HSV-2 infection by serology except by following up, because IgM antibodies can be present also during viral reactivation [5]. The IgG avidity test that measures the force of antigenantibody interaction can differentiate between early and late infections as lower avidity IgG is produced during the first month after infection and the high acidity, later on and on persistent infections [29,37]. This single measurement of IgG avidity in the last trimester of pregnancy can indicate whether the infection with HSV2 is primarily with high risk to the fetus or non primary. Polymerase chain reaction (PCR) is another laboratory method used to detect and quantify HSV DNA from clinical specimens with rapid and accurate results [35,19,26]. Little is known about the frequency and clinical correlates of HSV viremia during pregnancy. It is estimated that up to 25% of patients with primary genital Maysaa El Sayed Zaki, et al. 65

3 HSV infection have PCR-detectable virus in their peripheral blood (Johnston et al., 2008). The aims of the current study were to determine the HSV-2 seroprevalence associated with infection among a sample of Egyptian pregnant women, and also IgG avidity index was evaluated to detect early HSV-2 infections. Moreover, polymerase chain reaction was used to identify the presence of viremia among seropositive screened women. MATERIAL AND METHOD: A transversal study was carried out during among pregnant women attending outpatient clinics in Mansoura University hospital for antenatal care in the third trimester. The study was approved by Mansoura Medical ethical committee. The women signed an informed consent, answered a questionnaire about demographic characteristics, prenatal care, previous obstetric history and the presence of any gynecological complaints like discharge or local pain or vesicles. The blood sample was obtained from each female and sera were separated. Sera of the subjects were divided into two aliquots. One aliquot for the sociological study of herpes simplex virus type 2 by IgG and IgM enzyme linked immunosorbant assay (ELISA) beside serological markers for HIV, Toxoplasma IgG& IgM, Rubella IgG & IgM, and Cytomegalovirus (CMV) IgG& IgM. Positive serum for IgG for herpes simplex 2 was further studied by avidity test. The other aliquots of serum were subjected to molecular studies of Herpes simplex 2 by polymerase chain reaction (PCR) for samples positive for any serological markers for HSV2. HSV2 IgG & IgM Serum samples from each subject were analyzed for qualitative specific IgM for HSV- 2 (ELISA-Equipar Via G, Ferrari, Saronno, Italy), and quantitative determination of Herpes simplex IgG avidity was measured by using the same kit with the use of 8 M urea as a proteindenaturing agents. Microplates were washed with phosphate-buffered saline (PBS) and 8 M urea containing PBS solution following incubation of the serum specimens in antigencoated plates. After an 8-min exposure to the agent at room temperature, the plates were washed and processed as described above. HSV-specific IgG antibody activities in the walls washed with the elution agents or PBS only were used to calculate the avidity index (AI), where AI (HSV-specific IgG antibody activity of the wells washed with an illusion agent) / (that of the walls washed with PBS) 100. PCR for HSV-2 DNA was extracted with the commercially available Qiagen kit (GmbH, Hilden). Primers were designed to bracket a well-conserved region in the DNA polymerase gene. Primer pair HSV-P1 (5 - GTGGTGGACTTTGCCAGCCTGTACCC-3 ) and HSV-P2 (5 - TAAACATGGAGTCCGTGTCGCCGTAGAT GA-3 ) was used to amplify HSV-2 (Johnson et al., 200). Taq (0.25 µl) and extracted DNA (10 µl) were added to each premixed supplied tube. Negative control was analyzed by adding water instead of DNA and positive control was performed by 5.0 µl of HSV-1 positive control and 5.0 µl of positive control HSV-2 DNA. The following program was used for the thermal cycle: 1 cycle at 94 C for 2 minutes, 35 cycles (94 C for 30 seconds, 56 C for 30 seconds, 72 C for 30 seconds), and 1 cycle at 72 C for 5 minutes. From amplified product we added 1 µl DNA and 0.25 µl of Taq polymerase in premixed tubes supplied with the kit. The program used in the thermal cycles was 1 cycle at 94 C for 2 minutes, 30 cycles (of 94 C for 30 seconds, 58 C for 30 seconds, 72 C for 30 seconds), and 1 cycle at 72 C for 5 minutes. Following PCR, Maysaa El Sayed Zaki, et al. 66

4 the amplicon 100 bp for HSV-2 was resolved on a 1.5% agarose gel and visualized using ethidium bromide (0.5 µg/ml) under ultraviolet illumination. RESULTS: The study included one hundred eighty six pregnant women in the third trimester. Table 1 summarizes the clinical and laboratory findings among the studied women. The mean age SD was 26.8± 4.8 with mean SD duration of pregnancy 32.5± 8.3 weeks. The women were mainly from rural areas (64.5%). The reported previous fetal loss was present in 41.9%. For virological markers for HSV2, the most common marker was positive IgG 26.9%, followed by PCR for HSV2 DNA15.6% and IgM 14%%. None of the patients had any other positive markers for Toxoplasma, rubella or CMV. Study of the avidity index for HSV2 IgG revealed that IgG index was <67% in 30 positive samples (60%) while 20 (40%) samples had an avidity index >67%, table 2. In women with bad obstetric history, the most common HSV2 marker was IgG (50%) followed by PCR (30.8%) and IgM. IgG validity index indicating recent infection, i.e. <67% were found in 21.8%. The virological markers for HSV2 were statistically significantly higher in women with BOH compared with women with a normal pregnancy history (P= ), table 3. There was statistically significant correlations between positive PCR results and IgM (65.5%, P= ), IgG (79.3%- P= ) and IgG index <67% (48.3%- P= ), table 4. DISCUSSION To our erudition the present study is the first one to describe the prevalence of HSV2 in a series of Egyptian pregnant women. We have previously described the serological markers for HSV2 but in constrained number of pregnant women (50) mainly presented with abortions [38]. In the present study IgG for HSV2 was positive in 26.9% and IgM was positive in 14%. In BOH IgG was positive in 50% and IgM was positive in 26.9%. In Arab countries the prevalence of maternal HSV-2 was identified in several studies not including Egypt. The median IgG seroprevalence was 27.1% reported by previous study [2] and it was found in Saudi Arabia [16]. The seroprevalence of IgG range from 6.5% up to 60.6% [4]. In women with BOH IgG seroprevalence was reported to be 60.6%, which was found in Iraq [16]. For seroprevalence of IgM, the highest prevalence s were also reported in Iraq for both pregnant women (28.9%, 180 pregnant women) and those with BOH (73.9%, 62 BOH) [21,3]. International seroprevalence for HSV2 during pregnancy range from 4.4% in India up to 82% in Germany [6,13,12,2,25,33,32]. Regarding women with BOH, the highest prevalence (33.58%) was reported in India [19], while the lowest one (18.6%) was reported in other India also [30]. For IgM, the seroprevalence in pregnant women was ranging from 0% up to 13.8%) [28]. In women with BOH, the range for IgM prevalence range from 1.69%, (86 BOH) up to 16.8% [30,14]. Despite the promiscuous studies about the prevalence of serological markers for HSV2 in both developing and developed countries, we found scarce articles about the presence of HSV2 viremia among pregnant women. In the present study HSV2 viremia was detected in 15.4% in total studied pregnant women and in 30.8% in those with BOH. We have reported a percentage of HSV2 viremia in a limited number of pregnant women mainly with recurrent abortions in previous study, 32% in 50 women [2]. Another study reported 24% of patients with genital herpes 2 to have HSV2 viremia and patients were mainly women [23]. Maysaa El Sayed Zaki, et al. 67

5 In most studies, from 10 to 25% of patients with HSV-2 infection report a history of associated genital lesions [15,14]. However, HSV2 infection in the genital tract commonly passed asymptomatic with no local lesions. Albeit, viral shedding in seropositive subjects is frequently detected. In the presence of positive viral cultures either with or without symptoms at delivery, caesarean section is recommended. On the other hand, in case of negative viral cultures with no clinical lesions, a spontaneous delivery is indicated. Again, there were no data about the prevalence of HSV2 viremia in pregnant women and the effects of this finding upon pregnancy outcomes. There are underestimates of actual rates of infection as not all pregnant women in developing countries have the facilities of antenatal care. This could be due to financial shortage, difficulties in the presence of these facilities everywhere and personal or cultural beliefs. Even in the presence antenatal care clinics, the diagnostic capacity to screen for maternal infections are not available. These problems are mandatory contributors factors that lead to the persistence of high maternal morbidity and mortality in developing countries and need to be overcome in order to accurately characterize the burden of maternal infections in these countries [2]. For differentiation between primary infection with HSV2 and reactivation of latent reactivation IgG avidity test for HSV2 has been speculated to add a value for such differentiation. The primary infection with HSV2 is supposed to be more hazardous during pregnancy to the fetal outcomes than reactivation as discussed previously. It is not possible to classify the infection as primary or non primary by HSV-2 serology [Ashley]. The IgG avidity test can differentiate between two situations as the low avidity IgG is produced during the first month after infection [29,37]. The chosen cutoff value for low avidity in the present study was 66.1% based upon previous study [20]. In the present study, IgG avidity below 66.1% was found in 60% of the pregnant women and in 21.8% of pregnant women with BOH. This means that 60% of the studied pregnant women experience primary infection with HSV2 within the younger age group as the mean age SD of the study group was and they are present in the third trimester of pregnancy. In Mexican population, Seventeen women from 333 were detected with low avidity antibodies as a primary infection with a cutoff point of 66.1% in the third trimester [20]. Age is important risk factors associated with the infection with of genital HSV2. The prevalence of HSV2 infection rises with age, reaching the maximum around 40 years. Ethnicity, poverty and earlier onset of sexual activity, bacterial vaginosis and bad personal hygienic conditions can be the risk factors predisposing of infection [11,10,17],. These facts are associated with the finding that most of our studied pregnant women were from rural areas. Unfortunately, we could not find any data about the prevalence of primary HSV2 infection in Egypt as confirmed by avidity test. We consider this is the first article to describe such finding. A striking finding in this study is the presence of HSV2 viremia associated with primary infection diagnosed by a low avidity test in 14 patients and the presence of viremia for HSV2 in 24 patients (30.8%) in pregnant women with BOH. These findings may give the assumption that though primary infection with HSV2 is important in BOH, the persistent viremia for this virus can play a role in such situation. This indicates that HSV viremia can occur both with primary and non primary disease, as suggested by serologic testing that was performed in a subset of these patients. Maysaa El Sayed Zaki, et al. 68

6 Future large scale studies will be needed for determination of the true incidence and prevalence and clinical significance of HSV2 viremia detected and low avidity IgG in Egyptian pregnant women and the effects of this firearm in pregnancy outcomes. Previous researches in other groups of population suggested that the majority of immunocompetent adults with HSV DNA detected in the blood will do well [719,23]. It is recommended in case of primary genital HSV-2-infection of a pregnant woman to consider systemic therapy of the mother with acyclovir as maternal-fetal transmission may occur due to the risk of maternal viraemia Hoppen et a., The study highlights that of herpes simplex virus 2 is mundane among pregnant Egyptian women. Avidity test for IgG is valuable for laboratory diagnosis of primary herpes simplex virus in asymptomatic pregnant women. Elongated antenatal screening for herpes simplex 2 by serological markers and avidity IgG should be rigorously implanted in screening program to avert fetal complications. REFERENCES 1. Al-Hasani AM, Barton IG, AL-Omer LS, Kinghorn GR & Potter CW. Susceptibility of HSV strains from patients with genital herpes treated with various formulations of ACV. J Antimicrob Chemother ; 1986 ; 18 : S. 2. Aljumaili ZKM, Alsamarai AM3, Risk factors for bad obstetric history of Kirkuk women, Iraq. Int J Infect Microbiol 2013;2 (3): Al-Marzoqi AHM, Kadhim RA, Aljanabi DKF, Hussein HJ, Al Tae ZM: Seroprevalence study of IgG and IgM Antibodies totoxoplasma, Rubella, Cytomegalovirus, Chlamydia trachomatis and Herpes simplex II in Pregnancy women in Babylon Province. J Biol, Agri Healthcare. 2012; 2: Alzahrani1 AJ, Obeid OE, Almulhim AA, Awari B, Taha A, et al: Analysis of Herpes Simplex 1 and 2 IgG and IgM Antibodies in Pregnant Women and their Neonates. Saudi J Obstet Gynaecol. 2005;5: Ashley R. L. Type specific antibodies to HSV-1 and -2: review of methodology. Herpes, , (2), 33 38,. 6. Bodeus M, Laffineur K, Kabamba-Mukadi B, et al. Seroepidemiology of herpes simplex type 2 in pregnant women in Belgium. Sex Transm Dis 2004;31: Brice SL, Stockert SS, Jester JD, Huff JC, Bunker JD, Weston WL. Detection of herpes simplex virus DNA in the peripheral blood during acute recurrent herpes labialis. J Am Acad Dermatol 1992;26: Brown ZA, Selke S, Zeh J, et al. The acquisition of herpes simplex virus during pregnancy, N Engl J Med 1997; 337: ; 9. Brown, Z. Preventing herpes simplex virus transmission to the neonate. Herpes 2004; 3:175A-186A. 10. Cherpes TL, Meyn LA, Krohn MA, Lurie JG, Hillier SL: Association between acquisition of herpes simplex virus type 2 in women and bacterial vaginosis. Clin Infect Dis. 2003;37: Cusini M, Ghislanzoni M: The importance of diagnosing genital herpes. J Antimicrob Chemother. 2001;47: Dolar N, Serdaroglu S, Yilmaz G, Ergin S: Seroprevalence of herpes simplex virus type 1 and type 2 in Turkey. J Eur Acad Dermatol Venereol. 2006;20: Duran N, Fugen Y, Cuneyt E, Fatih K: Asymptomatic herpes simplex virus type 2 (HSV-2) infection among pregnant women in Turkey. Indian J Med Res. 2004;120: Fleming DT, McQuillan GM, Johnson RE, et al. Herpes simplex virus type 2 in the United States, 1976 to N Engl J Med 1997;337: Cowan FM, Johnson AM, Ashley R, Corey L, Mindel A. Antibody to herpes simplex virus type 2 as serological marker of sexual lifestyle in populations. BMJ 1994;309: Maysaa El Sayed Zaki, et al. 69

7 16. Ghazi, HO, Telmesani, AM, Mahomed, MF: Torch agents in pregnant Saudi women. Med Princ Pract. 2002;11: Gottlieb SL, Douglas JM Jr, Schmid DS, Bolan G, Iatesta M, Malotte CK, et al: Seroprevalence and correlates of herpes simplex virus type 2 infection in five sexually transmitted-disease clinics. J Infect Dis. 2002;186: Gupta R, Warren T, Wald A. Genital herpes. The Lancet.2007; 370 (9605): Harel L, Smetana Z, Prais D, et al. Presence of viremia in patients with primary herpetic gingivostomatitis. Clin Infect Dis 2004;39: Herrera-Ortiz A, Jesús C, GlezC, Vergara- Ortega D N, García-Cisneros S, -Portugal M L O, and SAlemán M A. Avidity of Antibodies against HSV-2 and Risk to Neonatal Transmission among Mexican Pregnant Women. Infectious Diseases in Obstetrics and Gynecology 2013 (2013), 6 pages 21. Jasim M, Majeed HA, Ali AI: Performance of SerologicalDiagnosis of TORCH Agents in Aborted versus non aborted Women of Waset province in Iraq. Tikrit Med J. 2011;17: Johnson G, Nelson S, Petric M, Tellier R. Comprehensive PCR-based assay for detection and species identification of human herpes viruses. J Clin Microbiol 2000; 38: Johnston C, Magaret A, Selke S, Remingt on M, Corey L, Wald A. Herpes simplex virus viremia during primary genital infection. J Infect Dis 2008;198: Kimberlin DW, Whitley RJ. Neonatal herpes: what have we learned. Semin Pediatr Infect Dis 2005; 16:7-16. ; 25. Kurewa NE, Mapingure MP, Munjoma MW, Chirenje MZ, Rusakaniko S, Stray- Pedersen B: The burden and risk factors of sexually transmitted infections and reproductive tract infections among pregnant women in Zimbabwe. BMC Infect Dis. 2010;10: e Magaret AS, Wald A, Huang ML, Selke S, Corey L. Optimizing PCR positivity criterion for detection of herpes simplex virus DNA on skin and mucosa. J Clin Microbiol 2007;45: McCabe, R, Remington JS. Toxoplasmosis: the time has come. N Engl J Med. 1988;318: Obeid OE: Prevalence of herpes simplex virus types 1 and 2 and associated sociodemographic variables in pregnant women attending King Fahd Hospital of the university. J Fam Commun Med. 2007;14: Revello M. G. and Gerna G., Diagnosis and management of human cytomegalovirus infection in the mother, fetus, and newborn infant, Clinical Microbiology Reviews, vol. 15, no. 4, pp , Sadik MS, Fatima H, Jamil K, Patil C: Study of TORCH profile in patients with bad obstetric history. Biol Med. 2012;4: Samarai AM, Shareef AA, Kinghorn GR, Potter CW. Sequential genital infections with HSV type 1 & 2.Genito- Urinary Med [England]; 1989 ; 65 : Sauerbrei A, Schmitt, S, Scheper T, Brandst dtن A, Saschenbrecker S, Motz M, et al: Seroprevalence of herpes simplex virus type 1 and type 2 in Thuringia, Germany, 1999 to Euro Surveill. 2011;16: pii= Shahraki AD, Moghim S, Akbari P: A survey on herpes simplex type 2 antibody among pregnant women in Isfahan, Iran. J Res Med Sci. 2010;15: Turbadkar D, Mathur M, Rele M. Seroprevalence of torch infection in bad obstetric history. Indian J Med Microbiol.2003;21: Wald A, Huang ML, Carrell D, Selke S, Corey L. Polymerase chain reaction for detection of herpes simplex virus (HSV) DNA on mucosal surfaces: comparison with HSV isolation in cell culture. J Infect Dis 2003;188: Whitley RJ. Herpes Simplex Viruses. In: Knipe DM, Howley PM, Griffin DE, et al Eds. Fields Virology. 4th Ed. Vol 2. New York: Lippincott, 2001; Yáñez-Alvarez, M. F. Martínez-Salazar, C. J. Conde-González, A. B. García-Serrato, Maysaa El Sayed Zaki, et al. 70

8 and M. A. Sánchez-Alemán, Seroprevalencia y seroincidencia del virus del herpes simple tipo 2 en personas que viven con VIH, Enfermedades Infecciosas y Microbiología, vol. 31, pp , Zaki M E and Goda H. Relevance of Parvovirus B19, Herpes Simplex Virus 2, and Cytomegalovirus Virologic Markers in Maternal Serum for Diagnosis of Unexplained Recurrent Abortions. Archives of Pathology & Laboratory Medicine: 2007, Vol. 131, No. 6, Table (1): Clinical and Laboratory Findings among the studied women Age (mean± SD) Years 26.8± 4.8 Duration of pregnancy-weeks 32.5± 8.3 Residence Rural % Urban % Abortions Yes No. IgG Positive Table (2) Avidity index for IgG to HSV % % % IgM 26 14%% PCR HSV2 DNA % Avidity Index No. % Table (3): Distribution of HSV2 markers among pregnant women with Bad obstetric history and Markers of HSV2 Pregnant with BOH Pregnant with normal clinical history (n=78) (n=108) P PCR % 5 4.6% P= IgM % 5 4.6% P= IgG 39 50% % P= IgG< % 13 12% P= Table (4): Correlations of serological markers for HSV2 in relation to DNA of HSV2 detected by PCR. Serological markers < > Total PCR Positive (n= 29) IgM Positive 19 (65.5%) P= IgG Positive % P= IgG<67% % P= P Maysaa El Sayed Zaki, et al. 71