Conditional and reversible disruption of essential herpesvirus protein functions

Transcription

1 nature methods Conditional and reversible disruption of essential herpesvirus protein functions Mandy Glaß, Andreas Busche, Karen Wagner, Martin Messerle & Eva Maria Borst Supplementary figures and text: Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Table 1 Supplementary Note 1 Construction of genomes for CMV-FKBP mutants. Ligand-dependent expression of - fusion proteins following infection. -mediated disruption of PML nuclear bodies depending on shield-1. Analysis of brightly green fluorescent cells occasionally observed after infection with the HCMV-IE-FKBP mutant in the absence of shield-1. Validation of shield-1-dependent expression of CMV fusion proteins at the single cell level. Oligonucleotides used in this study. Analysis of genomes of HCMV-UL51-FKBP viruses that grew in the absence of shield-1. Nature Methods: doi: /nmeth.1346

2 Supplementary Figure 1. Construction of genomes for CMV-FKBP mutants a MIEP HCMV IE2 MCMV IE3 b /IE2 MIEP HCMV /IE2 /IE MIEP MIEP /IE3 MIEP HCMV-/IE2- MCMV MCMV-/IE3-5 ΔUL HCMV-ΔUL1-10 FRT kbp.. AseI HpaI P P P UL UL51 UL77 HCMV-UL51- ΔUL51 HCMV-UL77- ΔUL77 HCMV-UL77-C- ΔUL77 (a) Structure of the CMV major IE region. The CMV MIE gene loci consist of five exons, with the first exon being untranslated (open box). Exons encoding the and IE2 proteins are indicated as black rectangles at the top and IE transcripts are shown below. Exons 2, 3, and 4 encode the proteins, and exons 2, 3, and 5 give rise to the IE2 protein in HCMV and the IE3 homolog in MCMV. By fusing the DNA sequence in frame to the 5 -end of the respective second exons, both IE proteins became tagged in the MCMV as well as in the HCMV mutant. (b) Restriction analysis of the genomes of the CMV-FKBP mutants and of the parental CMVs. Relevant DNA fragments are marked with white dots, and size markers are indicated to the left. The lane numbers correspond to the schematic drawings of the genome structures shown to the right. The targeted genetic loci are shown enlarged and the sizes of DNA fragments (in kbp) characteristic of each virus genome are indicated. Deletions are marked as triangles (Δ). The grey boxes of the HCMV genomes represent the terminal and internal repeats and the numbers refer to nucleotide positions of the genomes. P: Nature Methods: doi: /nmeth and 500 base pairs of sequences upstream of the UL51 and UL77 start codon, respectively, served as promoter regions.

3 Supplementary Figure 2. Ligand-dependent expression of - fusion proteins following infection HCMV-/IE2- with shld-1 with shld-1 without shld-1 MCMV-/IE3- without shld-1 Cells infected with the mutants indicated (MOI 0.1) were kept with or without 1 µm shield-1, and stained 48 h (HCMV-/IE2-) or 24 h (MCMV-/IE3-) post infection with antibodies directed against the doi: HCMV or MCMV protein. Merge: overlay of images displaying non-infected Nature Methods: /nmeth.1346 cells (blue; DNA-staining) and infected cells (EGFP) with the images depicting the staining of the fusion proteins. Scale bars, 10 µm.

4 Supplementary Figure 3. -mediated disruption of promyelocytic leukemia protein-associated nuclear bodies depending on shield-1 SP100 with shld-1 Sp100 SP100 without shld-1 Sp100 egfp egfp egfp egfp Cells were infected with HCMV-/IE2- at an MOI of 0.1, kept in the presence Nature or absence Methods: of doi: shield-1, /nmeth.1346 and at 17 h p.i. were labelled with antibodies specific for the Sp100 protein or the protein. Nuclei of infected cells are marked with white arrows.

5 Supplementary Figure 4. Analysis of brightly green fluorescent cells occasionally observed after infection with the HCMV-/IE2- mutant in the absence of shield-1 a IE2 To-Pro3 To-Pro3 EGFP EGFP b HCMV-GFP d8 p.i. HCMV-/IE2- without shld-1 d8 p.i. (a) HFF were infected with HCMV-/IE2- and examined by immunofluorescence as described in Fig. 1. Shown are groups of infected cells with one cell displaying high-level EGFP expression (white arrows) among other cells with weak EGFP expression. IE2 and expression in these cells is depicted in the left and right panel, respectively. (b) HFF were infected with 500 PFU per Nature doi: /nmeth.1346 culture Methods: with HCMV-/IE2- or the parental HCMV. Cells were kept in the absence of shield-1 and analyzed on day 8 p.i. for plaque formation by fluorescence microscopy.

6 Supplementary Figure 5. Validation of shield-1-dependent expression of CMV fusion proteins at the single cell level pul51 HCMV- HCMV-IE2 pul77 MCMV-IE3 MCMV- Pictures of cells shown in Figure 1a and Supplementary Figure 2 were taken using epi-fluorescence and the intensity of the fluorescence signals in infected cells was quantified using the ImageJ 1.41 software 1,2. Approximately 100 cells were analyzed for each experimental setting. Representative pictures are shown below the diagrams. Please note that the strong fluorescence signals obtained from cells kept with shield-1 may have been underestimated Nature Methods: due doi: to saturation /nmeth.1346 of the signals, and cells which display low fluorescence in the presence of the ligand may be abortively infected. a. u., arbitrary units.

7 Supplementary Table 1: Oligonucleotides used in this study primer name HIEf HIEr MIEf MIEr UL51kof UL51kor UL51f UL51Pror FKBP-DDf FKBP-DDr UL77kof UL77-kor UL77-f UL77-r sequence 5 -CTTTCCATGGGTCTTTTCTGCAGTCACCGTCCTTGACACGCAGGAACACTTAACGGCTGA 3 5 -CAGGATTATCAGGGTCCATCTTTCTCTTGGCAGAGGACTCCAATTGGCGCGCGGATCCTT-3 5 -GACATCTGTTGATGATAAAAAATTATATTTTTTTAGAGAGCAGGAACACTTAACGGCTGA 3 5 -CGGCGATCATGATCATGTTGCAACTGGGTGCGGCGGGCTCCAATTGGCGCGCGGATCCTT-3 5 -CGCGCGTCCAGAGAGGGCAGCAACAGATCGTAGACGCGCGGAAAAGTGCCACCTGCAGAT-3 5 -GACGGACACGCGCTACCCGATCTTGACGACGATCTGCTATAGCAGGAACACTTAACGGCTGA-3 5 -CGCGGATCCCGCACCGACGCCACCGCCGAT-3 5 -GGCGATATCGCCATAGCAGCTCAGTTGTCAA-3 5 -CGCGGATCCGCCACCATGGGAGTGCAGGT-3 5 -CGCGGATCCTTCCGGTTTTAGAAGCTCCA-3 5 -ACGATGCCATCACGGGACCCGCCGCCGCCCCGTCTGACGTGGAAAAGTGCCACCTGCAGAT-3 5 -CCGAGGACGTTCGCCCTTTATGCAGCGAGCGACACGTGGTGCAGGAACACTTAACGGCTGA-3 5 -CGCGGTACCGCCTCACGTGCGTAAGCGGAT-3 5 -CCCGTTAACTTAAGCGTAGTCTGGGACGTCGTATGGGTACAACACCGCCACGCTCGGAAG-3 Nature Methods: doi: /nmeth.1346

8 Supplementary Note 1. Analysis of genomes of HCMV-UL51- viruses that grew in the absence of shield-1 HCMV-UL51- P FKBP-DD UL51 UL51 (21 nt) BAC GFP HCMV-UL51- rep P FKBP-DD UL51 UL51 repaired BAC GFP ( % of viruses) Circular replicative intermediates were isolated from infected cells and amplified in E. coli. The BAC genomes were then re-isolated from the bacteria and examined by restriction analysis and sequencing. The ectopic -UL51 sequences turned out to be unaltered, while the subtle 21 nt deletion introduced into the original UL51 ORF was repaired, probably by recombination between the original and the ectopic UL51 sequences during viral genome replication. We have generated several similar CMV mutants before, containing a deletion in an ORF at the authentic genomic locus, followed by re-insertion of the respective ORF at an ectopic position and never observed any revertants before 3,4. By titrating the virus preparation in the presence and absence of shield-1, we determined the portion of revertants to be %. Repair of the UL51 ORF is presumably due to the very small deletion introduced, and the presence Nature of Methods: large homologous doi: /nmeth.1346 regions between the authentic and ectopic sequences. Consequently, repair by recombination can be prevented by designing the deletion in the original ORF as large as possible, and/or changing the codon usage of the ORF inserted at the ectopic position.

9 References 1. Abramoff, M.D., Magelhaes, P.J. & Ram, S.J. Image Processing with ImageJ. Biophotonics International 11, (2004). 2. Rasband,W.S. ImageJ. (2008). 3. Borst, E.M. & Messerle, M. Analysis of human cytomegalovirus orilyt sequence requirements in the context of the viral genome. J. Virol. 79, (2005). 4. Borst, E.M. et al. The essential human cytomegalovirus gene UL52 is required for cleavage-packaging of the viral genome. J. Virol. 82, (2008). Nature Methods: doi: /nmeth.1346