Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Size: px
Start display at page:

Download "Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells."

Transcription

1 Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta, and Robert P. Schleimer ONLINE DATA SUPPLEMENT

2 Supplemental Legends Supplemental Figure 1. extract suppressed -induced CXCL1, but not IL-13- induced CCL26. Submerged normal human bronchial epithelial (NHBE) cells were pretreated with 1:32 w/v Aspergillus fumigatus () or heat-treated extract (7 for 3 minutes) for 1 hour prior to treatment for 6 hours. Cell lysates were collected to assess expression of (A) CXCL1 mrna by RT-PCR. extract was incubated with (5 µg/ml), IL-13 (1 ng/ml), or IL-17A (1 ng/ml) to analyze the expression of (B) IFN-β mrna, (C) CCL26 mrna, or (D) CXCL8 mrna, respectively, by RT-PCR. Similarly, NHBE cells were pretreated with 1:32 w/v house dust mite (HDM) or 1:32 w/v cockroach (CR) extract for 1 hour prior to treatment for 6 hours. (E, F) Cell lysates were collected to assess expression of CXCL1 mrna by RT-PCR. Data represent mean + SEM of three independent experiments;, p <.1 by t-test when compared to medium only control;, p <.1 by t-test when compared to poly I:C or IL-17A stimulated cells;, not significant by t-test. Supplemental Figure 2. extract suppressed IFN-β-activated STAT1. Submerged NHBE cells were pretreated with or without 1:32 w/v extract or the PAR-2 activator AC (1 nm) 1 hour prior to stimulation with IFN-β (1 IU/ml) and cell lysates were collected at indicated time points. (A) Cellular protein was collected for Western blot. (B) Expressed bands of phospho-stat1 were quantified by using software Image J and normalized to internal control actin. Data represent mean + SEM of three independent experiments and images of Western blot are representative of three independent experiments;, p <.1 by t-test when compared to medium only control;, p <.1 by t-test when compared to stimulated cells at same E2

3 time point ;, not significant by t-test. Supplemental Figure 3. Inhibition of PTPN11 reversed mediated suppression of CXCL1 induced by or IFN-β. NHBE cells were pretreated with the PTPN11 inhibitor C (1 nm) for 3 hours prior to adding 1:32 w/v extract to the medium. After 1 hour of incubation, cells were stimulated with (A,B) (5 µg/ml) or (C,D) IFN-β (1 IU/ml) for 6 hours. Cell lysates were collected to assess expression of (A,C) CXCL1 mrna by RT- PCR and (B,D) CXLC1 protein by ELISA. Data represent mean + SEM of six independent experiments;, p <.1 by t-test when compared to medium only control;, p <.1 by t-test when compared to or IFN-β stimulated cells;, not significant by t-test. Supplemental Table 1. Primer and probe sequence for mrna detection by RT-PCR. E3

4 Supplemental Figure 1 A CXCL1 mrna B IFN-β mrna C CCL26 mrna Heated Heated HMW- D CXCL8 mrna IL-13 IL-17A Copyright 215 by the American Thoracic Society

5 Supplemental Figure 1 E CXCL1 mrna F CXCL1 mrna Media HDM HDM CR CR

6 Supplemental Figure 2 A Phospho-STAT1 Time after IFN-β stimulation min 3 min 18 min min 3 min 18 min min 3 min 18 min Total-STAT1 Actin B Normalized intensity Phospho-STAT Control 1.. min 3 min 18 min IFN-β and Extract IFN-β + IFN-β AC IFN-β IFN-β and AC-55541

7 Supplemental Figure 3 A CXCL1 mrna C CXCL1 mrna B CXCL1 protein 4 CXCL1 (ng/ml) CXCL1 (ng/ml) C D CXCL1 protein C IFN-β C IFN-β C-87877

8 Supplemental Table 1. β-actin-forward β-actin-reverse β-actin-probe CXCL8-forward CXCL8-reverse CXCL8-probe CXCL1-forward CXCL1-reverse CXCL1-probe CCL26-forward CCL26-reverse CCL26-probe CTGGCCGGGACCTGACT GCAGCCGTGGCCATCTC CACCACCACGGCCGA CTGGCCGTGGCTCTCTTG TTGGCAAAACTG TTTAGCACTCC CAGCCTTCCTGATTTCTGCAGCTCTGTGT TGAAATTATTCCTGCAAGCCAAT ATGGCCTTCGATTCTGGATTC TCCACGTGTTGAGATC CTGCTTCCAATACAGCCACAAG GAGCAGCTGTTACTGGTGAATTCA CTTCCCTGGACCTGGGTGCGAA β

Supplementary Information

Supplementary Information Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1

More information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Supplementary Information

Supplementary Information Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)

More information

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent

More information

Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author):

Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author): Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author): This study shows that the inducible camp early repressor (ICER) is involved in development of Th17 cells that are pathogenic

More information

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad

More information

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

Supplemental Figures: Supplemental Figure 1

Supplemental Figures: Supplemental Figure 1 Supplemental Figures: Supplemental Figure 1 Suppl. Figure 1. BM-DC infection with H. pylori does not induce cytotoxicity and treatment of BM-DCs with H. pylori sonicate, but not heat-inactivated bacteria,

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection. Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

BALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION

BALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION BALANCE BETWEEN ESTROGE AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION Nadine Dragin 1, 2, 3,, Patrice Nancy 4, José Villegas 2, 3, 5, Régine

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen

More information

Transduction of lentivirus to human primary CD4+ T cells

Transduction of lentivirus to human primary CD4+ T cells Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- 1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated

More information

COMPLEXITY OF MOLD ALLERGIES ACAAI Presentation # P175

COMPLEXITY OF MOLD ALLERGIES ACAAI Presentation # P175 2004 ACAAI Presentation # P175 MOLD EXTRACT COMPARABILITY, STABILITY AND COMPATIBILITY : COMPOSITIONAL AND IMMUNOCHEMICAL INVESTIGATIONS Thomas J. Grier, Ph.D. Dawn M. LeFevre, B.S. Elizabeth A. Duncan,

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson, Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David

More information

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2 Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

More information

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,

More information

a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!

a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin! a! b! c! Diamet (μm) 2 2 1 WT Nogo-A/B-deficient -9-8 -7 - -5-4 PE (LogM) Diamet (μm) 2 2 1-12-11-1 -9-8 -7 - -5 U-419 (LogM) Diamet (μm) 2 2 1-8 -7 - -5 S1P (LogM) d! WT! Nogo-A/B-deficient! MLE! enos!

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells

More information

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae

More information

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun

More information

Genotoxic and inflammatory responses of human bronchial epithelial cells to diesel and biodiesel exhaust.

Genotoxic and inflammatory responses of human bronchial epithelial cells to diesel and biodiesel exhaust. Genotoxic and inflammatory responses of human bronchial epithelial cells to diesel and biodiesel exhaust. Ian WH Jarvis Research Associate, King s College London Background There is an increasing application

More information

Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with

Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three

More information

Supplemental Methods Supplemental Table 1. Supplemental Figure 1. Supplemental Figure 2. Supplemental Figure 3. Supplemental Figure 4.

Supplemental Methods Supplemental Table 1. Supplemental Figure 1. Supplemental Figure 2. Supplemental Figure 3. Supplemental Figure 4. Supplemental Methods TGF-B1 ELISA Supernatants were collected from AT2 cells cultured for 1, 2, 3, or 4 days and frozen at -80 degrees C until use in the ELISA. A commercially available mouse TGF-B1 Duo

More information

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates

More information

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim

More information

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation. SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical

Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously

More information

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195. pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus

More information

Identifying Biologic Targets to Attenuate or Eliminate Asthma Exacerbations

Identifying Biologic Targets to Attenuate or Eliminate Asthma Exacerbations Identifying Biologic Targets to Attenuate or Eliminate Exacerbations exacerbations are a major cause of disease morbidity and costs. For both children and adults, viral respiratory infections are the major

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/381/ra59/dc1 Supplementary Materials for Analysis of single-cell cytokine secretion reveals a role for paracrine signaling in coordinating macrophage responses

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T

Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Supplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.

Supplementary Fig. 1 No relative growth advantage of Foxp3 negative cells. Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

ISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN

ISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN a ISG15 sirna Ctrl #1 #2 ISG15 conjugates IB: ISG15 Virus titer (Pfu/ml) b ISG15 sirna #2 10 7 Ctrl sirna+ifn+wt Ctrl sirna+ifn+67 10 6 ISG15 sirna+ifn+wt ISG15 sirna+ifn+67 10 5 10 4 10 3 Free ISG15 10

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Supplementary information

Supplementary information Supplementary information Supplementary Figure S1: Ex[Ca 2+ ]-induced IL-1ß production of monocytes primed with different TLR ligands IL-1ß release of CD14+ monocytes in response to stimulation for 16

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Supplementary Information

Supplementary Information Supplementary Information Intrinsic Photosensitivity Enhances Motility of T Lymphocytes by Phan X. Thieu, Barbara Jaruga, Sandeep C. Pingle, Bidhan C. Bandyopadhyay, & Gerard P. Ahern Supplementary Figure

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information