Supplementary information. Early development of broad neutralizing antibodies in HIV-1 infected infants
|
|
- Claribel Roberts
- 5 years ago
- Views:
Transcription
1 Supplementary information Early development of broad neutralizing antibodies in HIV-1 infected infants Leslie Goo, Vrasha Chohan, Ruth Nduati, Julie Overbaugh
2 Supplementary Figure 1. Neutralization profile of maternal and longitudinal infant plasma against 8 viruses, including 2 Tier 1 and 6 Tier 2 viruses representing clades A-D. Maternal plasma samples are shown in the first row of each panel, above longitudinal samples from corresponding infants. The first column shows maternal and infant IDs, followed by the plasma timepoint tested in months post-delivery, and months post HIV-1 infection (Time PI). N/A, not available;, timepoint prior to detectable HIV-1 infection; +, first HIV-1 positive timepoint based on HIV-1 DNA or RNA detection; *, timepoint immediately after first HIV-1 positive test for BH217; nd, not determined. IC 50 values are color-coded with darker color indicating increasing neutralization potency, as shown in the key.
3 Supplementary Figure 2. Neutralization profile of 2 infants with greatest NAb breadth (BB391, BG505) and 2 adult samples (QB850, QA255). The adult samples were identified as having bnabs in previous screens. 5,13 The 6 viruses tested were used in prior studies to determine elite neutralizing activity 4. Plasma timepoint tested is shown in years post-infection (PI). The subject s age at the plasma timepoint tested is also shown. IC 50 values are color coded as in Figure 1. Average IC 50 values from 2 independent experiments were used to calculate neutralization scores 4.
4 Supplementary Figure 3. Association between maternal, passive and de novo NAbs for 7 infants with bnabs that neutralize Tier 2 virus from clades A-D. (a) Correlation between passive and de novo average log 2 (IC 50 ) values against 8 viruses shown in Supplementary Fig. 1. Only 5/7 infants who had samples within the first week of life were included in the analysis. (b) Correlation between maternal and infant de novo average log 2 (IC 50 ) values against 8 viruses shown in Supplementary Fig. 1. For (a) and (b), red dot represents data point for BG505. Pearson s r, 95% confidence intervals, and p-values shown in black and gray indicate analyses excluding and including BG505, respectively.
5 Supplementary Figure 4. Epitope mapping of bnabs in infants. (a) The presence of PG9- and PGT128-like antibodies was determined by comparing neutralization of a clade A wildtype virus, Q23.17 relative to N160K and N332A mutants, respectively. Two samples (BN469 and BG376) that could not neutralize Q23.17 at the lowest dilution tested (1:100) were tested against JRCSF (clade B) and corresponding mutants. PG9 and PGT128 were included as positive controls, while VRC01 served as a control for non-specific effects for both mutants. For each sample, the percentage reduction in area under the curve (AUC) comparing mutant to wildtype virus was normalized to that seen for VRC01 (% sample AUC reduction / % VRC01 AUC reduction), and is expressed as fold AUC reduction, as shown in boxes. A sample was considered positive for PG- or PGT-like antibodies if the AUC reduction comparing mutant to wildtype viruses was 3- fold higher than that observed for the VRC01 control against Q23.17 wildtype and mutant viruses. (b) Infant antibodies against CD4bs were assessed by binding to RSC3 or RSC3d371I in ELISAs. End-point titers are shown. An end-point titer > 100 for RSC3, and a corresponding reduction of > 3-fold for RSC3Δ371I was considered positive for CD4bs binding antibodies. VRC01 and 2G12 were included as positive and negative controls, respectively. (c) Samples were screened against the 7312A HIV-2 full-length construct, or the 7312A-C1 HIV-2/HIV-1 MPER chimera to detect the presence of MPER-specific NAbs. An IC 50 > 3-fold higher for C1 versus 7312-A was considered positive. Monoclonal antibody 4E10 was included as a positive control.
6 BB391 IC 50 BG505 IC 50 Subtype Virus Plasma (dilution) Purified IgG (mg ml -1 ) Plasma (dilution) Purified IgG (mg ml -1 ) A Q461.D > A Q842.d nd B TRO C QC406.F D QD435.A SIV <100 >1 114 >2 Supplementary Table 1. Neutralization profile of purified IgG from BB391 and BG505. nd = not determined due to limited sample availability.
7 Univariate linear regression Covariate n Estimate 95% CI P-value Set-point viral load Duration of infection Total IgG Env-specific IgG Passive NAbs Multivariate linear regression Covariate n Estimate 95% CI P-value Set-point viral load Env-specific IgG Supplementary Table 2. Univariate and multivariate linear regression analyses of factors associated with NAb breadth.
Bispecific Fusion Antibodies. Exhibit 100% Breadth and Picomolar Potency. Craig Pace, PhD
The Aaron Diamond AIDS Research Center Affiliate of The Rockefeller University Bispecific Fusion Antibodies PG9 Ibalizumab & VRC Ibalizumab Exhibit % Breadth and Picomolar Potency Craig Pace, PhD AIDS
More informationIsolation of a Broadly Neutralizing Antibody with Low Somatic Mutation from a Chronically Infected HIV-1 Patient
Isolation of a Broadly Neutralizing Antibody with Low Somatic Mutation from a Chronically Infected HIV-1 Patient Amanda Fabra García, Carolina Beltrán Pavez, Alberto Merino Mansilla, Cristina Xufré, Isabel
More informationCrystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s)
Ligand Type Name 6 Crystallization-grade After 447-52D After V3 cocktail Receptor CD4 Resonance Units 5 1 5 1 5 1 Broadly neutralizing antibodies 2G12 VRC26.9 Resonance Units Resonance Units 3 1 15 1 5
More informationSupplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood
Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial
More informationVirus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies
Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies Michael Seaman, Ph.D. Center for Virology and Vaccine Research Beth Israel Deaconess Medical Center Harvard Medical School J. Virol.
More informationLynn Morris. "Plan B"- bnabs for HIV prevention
"Plan B"- bnabs for HIV prevention Lynn Morris National Institute for Communicable Diseases, a division of the National Health Laboratory Service (NHLS) of South Africa, University of the Witwatersrand,
More informationLong-acting Antivirals Where Are We Headed? Are We Ready? Carl W. Dieffenbach, Ph.D. Director Division of AIDS, NIAID May 3, 2018
Long-acting Antivirals Where Are We Headed? Are We Ready? Carl W. Dieffenbach, Ph.D. Director Division of AIDS, NIAID May 3, 2018 Global HIV Statistics 2017 People living with HIV in 2016 New HIV infections
More informationSupporting Information
Supporting Information Horwitz et al. 73/pnas.35295 A Copies ml - C 3NC7 7 697 698 7 7 73 76-2 2 Days Gp2 residue G458D G459D T278A 7/36 N28 K D 28 459 A28T ID# 697 ID# 698 ID# 7 ID# 7 ID# 73 ID# 76 ID#
More informationResearch Online. Edith Cowan University. Constantinos K. Wibmer. Jinal N. Bhiman. Elin S. Gray Edith Cowan University,
Edith Cowan University Research Online ECU Publications 2013 2013 Viral Escape From HIV-1 Neutralizing Antibodies Drives Increased Plasma Neutralization Breadth through Sequential Recognition Of Multiple
More informationIdentification of Mutation(s) in. Associated with Neutralization Resistance. Miah Blomquist
Identification of Mutation(s) in the HIV 1 gp41 Subunit Associated with Neutralization Resistance Miah Blomquist What is HIV 1? HIV-1 is an epidemic that affects over 34 million people worldwide. HIV-1
More informationOverview of the Joint HVTN/HPTN Research Portfolio. Theresa Gamble, PhD HPTN LOC May 15, 2018
Overview of the Joint HVTN/HPTN Research Portfolio Theresa Gamble, PhD HPTN LOC May 15, 2018 1 Joint HVTN/HPTN mab Portfolio HVTN 130/HPTN 089 HVTN 703/HPTN 081 HVTN 704/HPTN 084 AMP (VRC01) HVTN 127/HPTN
More informationWhat is the place of the monoclonal antibodies in the clinic?
What is the place of the monoclonal antibodies in the clinic? Dr Julià Blanco 2018/04/26 DISCLOSURE AlbaJuna Therapeutics, S.L. ANTIBODIES IN HIV INFECTION. ANTIVIRAL (NEUTRALIZING) ACTIVITY env THE BROADLY
More informationRecombinant Baculovirus Derived HIV-1 Virus-Like Particles Elicit Potent Neutralizing Antibody Responses
Recombinant Baculovirus Derived HIV-1 Virus-Like Particles Elicit Potent Neutralizing Antibody Responses Weimin Liu University of Alabama at Birmingham Introduction and Rationale Virus-like particles (VLPs)
More informationChronic HIV-1 Infection Frequently Fails to Protect against Superinfection
Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection Anne Piantadosi 1,2[, Bhavna Chohan 1,2[, Vrasha Chohan 3, R. Scott McClelland 3,4,5, Julie Overbaugh 1,2* 1 Division of Human
More informationDissecting the Neutralizing Antibody Specificities of Broadly Neutralizing Sera from Human Immunodeficiency Virus Type 1-Infected Donors
JOURNAL OF VIROLOGY, June 2007, p. 6548 6562 Vol. 81, No. 12 0022-538X/07/$08.00 0 doi:10.1128/jvi.02749-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Dissecting the Neutralizing
More informationAIDSVaccine2010 Atlanta, Georgia Willy Bogers. NIH HIVRad Grant nr 5P01AI066287
HIV-1 envelope-cd4 receptor complexes elicit broad T- and B- cell immune responses as well as cross-reactive neutralizing antibodies in Rhesus macaques NIH HIVRad Grant nr 5P01AI066287 AIDSVaccine2010
More informationGlobal Panel of HIV-1 Env Reference Strains for Standardized Assessments of Vaccine- Elicited Neutralizing Antibodies
JVI Accepts, published online ahead of print on 18 December 2013 J. Virol. doi:10.1128/jvi.02853-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 Global Panel of HIV-1 Env
More informationSupporting Information
Supporting Information Walker et al. 1.173/pnas.111753118 - JR-CSF 1 3 1 4 1 5 1 6 1 7 1 8 blank beads protein A beads JR-FL - 1 3 1 4 1 5 1 6 1 7 1 8 - MGRM-C26 1 3 1 4 1 5 1 6 1 7 1 8 reciprocal serum
More informationA Quarterly Update on HIV Prevention Research. Vol. 8 No. 2
What is it? What could it do? Key Facts Antibodies Passive immunization is the transfer of pre-made antibodies to a person. Passive immunization using today's pre-made antibodies can involve infusion delivered
More informationReceived 28 January 2011/Accepted 24 February 2011
JOURNAL OF VIROLOGY, May 2011, p. 4828 4840 Vol. 85, No. 10 0022-538X/11/$12.00 doi:10.1128/jvi.00198-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. The Neutralization Breadth
More informationSpike Trimer RNA. dsdna
Spike Trimer RNA dsdna Spike Trimer RNA Spike trimer subunits xxx gp120: receptor and coreceptor binding xxxxxxx gp41: membrane anchoring and target cell fusion dsdna Spike Trimer HIV gp120 binds to host
More informationNovel Vaccine Products for Planned Phase I Immunogenicity Studies in Infants
Office of AIDS Research Novel Vaccine Products for Planned Phase I Immunogenicity Studies in Infants L. Jean Patterson, PhD Office of AIDS Research, NIH February 7, 2017 Office of AIDS Research OAR Responsibilities
More informationHHS Public Access Author manuscript Science. Author manuscript; available in PMC 2016 December 12.
HHS Public Access Author manuscript Published in final edited form as: Science. 2016 May 20; 352(6288): 997 1001. doi:10.1126/science.aaf0972. HIV-1 Therapy with Monoclonal Antibody 3BNC117 Elicits Host
More informationCROI 2016 Review: Immunology and Vaccines
Frontier AIDS Education and Training Center CROI 2016 Review: Immunology and Vaccines Meena Ramchandani MD MPH Acting Instructor, University of Washington March 2016 This presentation is intended for educational
More informationA Path to an HIV Vaccine: GSID Consortium Activities. Faruk Sinangil, PhD 4th Annual CAVD Meeting Miami, FL December 1-4, 2009
A Path to an HIV Vaccine: GSID Consortium Activities Faruk Sinangil, PhD 4th Annual CAVD Meeting Miami, FL December 1-4, 2009 Project Goals Acquire and disseminate information that will contribute to the
More informationMutations in HIV-1 envelope that enhance entry with the macaque CD4 receptor alter
JVI Accepts, published online ahead of print on 5 November 2014 J. Virol. doi:10.1128/jvi.02680-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 Mutations in HIV-1 envelope
More informationAlternate Antibody-Based Therapeutic Strategies To Purge the HIV Cell Reservoir
Alternate Antibody-Based Therapeutic Strategies To Purge the HIV Cell Reservoir Giuseppe Pantaleo, M.D. Professor of Medicine Head, Division of Immunology and Allergy Executive Director, Swiss Vaccine
More informationHIV-1 envelope glycoprotein signatures that correlate with the development of cross-reactive neutralizing activity
van den Kerkhof et al. Retrovirology 2013, 10:102 RESEARCH Open Access HIV-1 envelope glycoprotein signatures that correlate with the development of cross-reactive neutralizing activity Tom L G M van den
More informationHIV cure: current status and implications for the future
HIV cure: current status and implications for the future Carolyn Williamson, PhD Head of Medical Virology, Faculty Health Sciences, University of Cape Town CAPRISA Research Associate, Centre of Excellence
More informationLong-Acting Antibodies and Drugs as HIV Prevention Agents. David D. Ho, M.D.
Long-Acting Antibodies and Drugs as HIV Prevention Agents David D. Ho, M.D. the The HIV/AIDS pandemic rages on Key statistics from UNAIDS: 35M dead; 35M living with HIV 2.3M new infections a year or 6,300
More informationHIV-1 glycan density drives the persistence of the mannose patch within an infected. Running title: Longitudinal persistence of the HIV mannose patch
JVI Accepted Manuscript Posted Online 5 October 2016 J. Virol. doi:10.1128/jvi.01542-16 Copyright 2016 Coss et al. This is an open-access article distributed under the terms of the Creative Commons Attribution
More informationBroadly Neutralizing Antibodies for HIV Eradication
DOI 10.1007/s11904-016-0299-7 HIV PATHOGENESIS AND TREATMENT (AL LANDAY, SECTION EDITOR) Broadly Neutralizing Antibodies for HIV Eradication Kathryn E. Stephenson 1,2 & Dan H. Barouch 1,2 # The Author(s)
More informationHIV and Challenges of Vaccine Development
Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health HIV and Challenges of Vaccine Development Richard A. Koup, MD INTEREST
More informationHIV Vaccines: Basic Science
Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health HIV Vaccines: Basic Science Richard A. Koup, MD 6 th INTEREST Workshop
More informationDEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED
DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED Viv Peut Kent Laboratory, University of Melbourne, Australia WHY ENVELOPE? Env subject to both humoral and cellular immune responses Perhaps
More informationProgress in HIV Vaccine Development Magdalena Sobieszczyk, MD, MPH. Division of Infectious Diseases Columbia University Medical Center
Progress in HIV Vaccine Development Magdalena Sobieszczyk, MD, MPH Division of Infectious Diseases Columbia University Medical Center 1 Outline A short history of HIV vaccine design and development Describe
More informationSupplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Barouch DH, Tomaka FL Wegmann F, et al. Evaluation
More informationBoosts Following Priming with gp120 DNA
Neutralizing Antibody Responses Induced with V3-scaffold Protein Boosts Following Priming with gp120 DNA Susan Zolla-Pazner NYU School of Medicine Problems with Whole Env Immunogens Poor induction of Abs
More informationTable S1. Malaria-positive Malaria-negative Placental viral load Peripheral viral load CD4+ T-cell count
Table S1. Unadjusted and adjusted effect of placental viral load, peripheral viral load, and CD4+ T- cell count on prevalence of low birthweight and excluding observations with PTD, stratified by maternal
More informationAntibody Dependent Cellular Cytotxic activity: Past and Future. Guido Ferrari, M.D. Duke University Medical Center
Antibody Dependent Cellular Cytotxic activity: Past and Future Guido Ferrari, M.D. Duke University Medical Center Mechanism of Antibody Dependent Cellular Cytotoxicity (ADCC) ADCC Effector Cells (NK, monocytes/macrophages,
More informationHIV vaccines, neutralising antibodies, ADCC and beyond. Stephen Kent University of Melbourne Peter Doherty Institute
HIV vaccines, neutralising antibodies, ADCC and beyond Stephen Kent University of Melbourne Peter Doherty Institute Viro-Immunobabble bingo Virology/Immunology/vaccinology full of jargon! Shout Immunobabble
More informationRetrovirology. Open Access RESEARCH
DOI 10.1186/s12977-016-0312-7 Retrovirology RESEARCH Open Access Membrane bound modified form of clade B Env, JRCSF is suitable for immunogen design as it is efficiently cleaved and displays all the broadly
More informationShould There be Further Efficacy Testing of T-T cell Based Vaccines that do not Induce Broadly Neutralizing Antibodies?
Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Department of Health and Human Services Should There be Further Efficacy
More informationNovel Heterologous Prime-Boost Vaccine Strategies for HIV. Dan Barouch April 18, 2012
Novel Heterologous Prime-Boost Vaccine Strategies for HIV Dan Barouch April 18, 2012 Desired Features of a Next Generation HIV-1 Vaccine Candidate The RV1 study suggests that an HIV-1 vaccine is possible
More informationThe Harvard community has made this article openly available. Please share how this access benefits you. Your story matters
Antibody Responses After Analytic Treatment Interruption in Human Immunodeficiency Virus-1- Infected Individuals on Early Initiated Antiretroviral Therapy The Harvard community has made this article openly
More informationUniversity of Cape Town
Neutralizing Antibody Responses in HIV-1 Dual Infection: Lessons for Vaccine Design Daniel James Sheward Supervisor: Carolyn Williamson Co- supervisor: Zenda Woodman Dissertation submitted to the Faculty
More informationWhy are validated immunogenicity assays important for HIV vaccine development?
Why are validated immunogenicity assays important for HIV vaccine development? There is a need to compare immunogenicity of products in the pipeline, when similar or different in class when developed by
More informationTiered Categorization of a Diverse Panel of HIV-1 Env Pseudoviruses for Assessment of Neutralizing Antibodies
JOURNAL OF VIROLOGY, Feb. 2010, p. 1439 1452 Vol. 84, No. 3 0022-538X/10/$12.00 doi:10.1128/jvi.02108-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Tiered Categorization of
More informationIncreased Functional Stability and Homogeneity of Viral Envelope Spikes through Directed Evolution
Increased Functional Stability and Homogeneity of Viral Envelope Spikes through Directed Evolution Daniel P. Leaman, Michael B. Zwick* Department of Immunology and Microbial Science, The Scripps Research
More informationPassive neutralizing antibody controls SHIV viremia and enhances B cell responses in infant macaques
correction notice Nat. Med. 16, 1117 1119 (2010) Passive neutralizing antibody controls SHIV viremia and enhances B cell responses in infant macaques Cherie T Ng, J Pablo Jaworski, Pushpa Jayaraman, William
More informationIdentification and Characterization of CD4 T cells actively transcribing HIV RNA in Peripheral Blood
Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Identification and Characterization of CD4 T cells actively transcribing
More informationBroad and Potent Neutralizing Antibodies from an African Donor Reveal a New HIV-1 Vaccine Target
Broad and Potent Neutralizing Antibodies from an African Donor Reveal a New HIV-1 Vaccine Target Laura M. Walker, 1 * Sanjay K. Phogat, 2 * Po-Ying Chan-Hui, 3 Denise Wagner, 2 Pham Phung, 4 Julie L. Goss,
More informationFactors Associated with the Development of Cross-Reactive Neutralizing Antibodies during Human Immunodeficiency Virus Type 1 Infection
JOURNAL OF VIROLOGY, Jan. 2009, p. 757 769 Vol. 83, No. 2 0022-538X/09/$08.00 0 doi:10.1128/jvi.02036-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. Factors Associated with
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity
Supplementary Figure 1 Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity (a, b) Fluorescent-based determination of the binding capacity of DNA-barcoded MHC multimers (+barcode)
More informationSupporting Information
Supporting Information Guan et al. 10.1073/pnas.1217609110 Fig. S1. Three patterns of reactivity for CD4-induced (CD4i) mabs. The following representative ELISAs show three patterns of reactivity for CD4i
More informationHigher priming doses enhance HIV-specific humoral but not cellular. responses in a randomized, double-blind phase Ib clinical trial of
Higher priming doses enhance HIV-specific humoral but not cellular responses in a randomized, double-blind phase Ib clinical trial of preventive HIV-1 vaccines Pierre-Alexandre Bart a,b, Yunda Huang c,
More informationIdentification of broadly neutralizing antibody epitopes in the HIV-1 envelope glycoprotein using evolutionary models
Lacerda et al. Virology Journal 2013, 10:347 RESEARCH Open Access Identification of broadly neutralizing antibody epitopes in the HIV-1 envelope glycoprotein using evolutionary models Miguel Lacerda 1,2,
More informationIdentification of a CD4-Binding-Site Antibody to HIV that Evolved Near-Pan Neutralization Breadth
Article Identification of a CD4-Binding-Site Antibody to HIV that Evolved Near-Pan Neutralization Breadth Highlights d CD4bs antibody N6 potently neutralizes 98% of HIV isolates d d N6 potently neutralizes
More informationPress conference abstracts Vaccine and Antibody Research Monday, 22 October 2018
Press conference abstracts Vaccine and Antibody Research Monday, 22 October 2018 OA02.05LB Vaccine-induced Gene Signature Correlates with Protection against Acquisition in Three Independent Vaccine Efficacy
More informationYasmeen et al. Retrovirology 2014, 11:41
Yasmeen et al. Retrovirology 214, 11:41 RESEARCH Open Access Differential binding of neutralizing and non-neutralizing antibodies to native-like soluble HIV-1 Env trimers, uncleaved Env proteins, and monomeric
More informationAntibody gene transfer for HIV immunoprophylaxis
Antibody gene transfer for HIV immunoprophylaxis Alejandro B Balazs & Anthony P West Jr Antibody gene transfer, which involves the delivery of genes that encode potent, broadly neutralizing antibodies
More informationA Human Antibody to the CD4 Binding Site of gp120 Capable of Highly Potent but Sporadic Cross Clade Neutralization of Primary HIV-1
A Human Antibody to the CD4 Binding Site of gp120 Capable of Highly Potent but Sporadic Cross Clade Neutralization of Primary HIV-1 Johannes S. Gach 1,2 *., Heribert Quendler 1., Tommy Tong 3, Kristin
More informationUniversity of Massachusetts Medical School Matthew R. Costa University of Massachusetts Medical School
University of Massachusetts Medical School escholarship@umms GSBS Dissertations and Theses Graduate School of Biomedical Sciences 10-12-2016 FC Receptor-Mediated Activities of Env-Specific Monoclonal Antibodies
More informationHHS Public Access Author manuscript Trends Immunol. Author manuscript; available in PMC 2017 June 02.
HIV-1 envelope trimer design and immunization strategies to induce broadly neutralizing antibodies Steven W. de Taeye 1, John P. Moore 2, and Rogier W. Sanders 1,2 1 Department of Medical Microbiology,
More informationFUNDERS UPDATE- BMGF. Third HIV Env Manufacturing Workshop Sponsored by DAIDS-NIAID-NIH and the HIV Global Vaccine Enterprise July 20-21, 2017
FUNDERS UPDATE- BMGF Third HIV Env Manufacturing Workshop Sponsored by DAIDS-NIAID-NIH and the HIV Global Vaccine Enterprise July 20-21, 2017 Susan Barnett Senior Program Officer, Product and Clinical
More informationOverview of role of immunologic markers in HIV diagnosis
Overview of role of immunologic markers in HIV diagnosis Savita Pahwa, M.D. Departments of Microbiology & Immunology and Pediatrics University of Miami, Miller School of Medicine, Miami, Florida Background:
More informationInfluences on the design and purification of soluble, recombinant native-like HIV-1 envelope glycoprotein trimers
JVI Accepted Manuscript Posted Online 26 August 2015 J. Virol. doi:10.1128/jvi.01768-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
More informationSalivary mucinmuc5b inhibits HIV-1 subtype C in an in vitro pseudoviral assay
Salivary mucinmuc5b inhibits HIV-1 subtype C in an in vitro pseudoviral assay Julia Peacocke, Zoe Lotz, Jeffrey R Dorfman 1, Delawir Kahn, Paul Roux 2 and Anwar S Mall* Division of General Surgery and
More informationNK mediated Antibody Dependent Cellular Cytotoxicity in HIV infections
NK mediated Antibody Dependent Cellular Cytotoxicity in HIV infections Amy Chung Dr. Ivan Stratov Prof. Stephen Kent ADCC process consists of Target cell QuickTime and a TIFF (Uncompressed) FcγR decompressor
More informationGOVX-B11: A Clade B HIV Vaccine for the Developed World
GeoVax Labs, Inc. 19 Lake Park Drive Suite 3 Atlanta, GA 3 (678) 384-72 GOVX-B11: A Clade B HIV Vaccine for the Developed World Executive summary: GOVX-B11 is a Clade B HIV vaccine targeted for use in
More informationThe Kitchen Sink. Glenda Gray AIDS vaccine at the cross roads: how to adapt to a new preven9on age? Monday 7 th October, 2013, Barcelona
The Kitchen Sink Glenda Gray AIDS vaccine at the cross roads: how to adapt to a new preven9on age? Monday 7 th October, 2013, Barcelona The only important slide of my presentation. All efficacy trial in
More informationEstablishment and Targeting of the Viral Reservoir in Rhesus Monkeys
Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys Dan H. Barouch, M.D., Ph.D. Center for Virology and Vaccine Research Beth Israel Deaconess Medical Center Ragon Institute of MGH, MIT,
More informationSYSTEMS BIOLOGY APPROACHES TO IDENTIFY MECHANISMS OF IMMUNE MEDIATED PROTECTION TRANSLATING RESEARCH INTO HEALTH
SYSTEMS BIOLOGY APPROACHES TO IDENTIFY MECHANISMS OF IMMUNE MEDIATED PROTECTION TRANSLATING RESEARCH INTO HEALTH Novel assays to decipher protective immune responses Decoding the immune response to infectious
More informationInfluenza or flu is a
Clinical and Research Area Infectious Diseases Influenza Virus Types A and B Influenza or flu is a respiratory illness that is caused by influenza viruses. Influenza viruses type A and type B cause seasonal
More informationChallenges in Designing HIV Env Immunogens for Developing a Vaccine
b514_chapter-13.qxd 12/4/2007 3:39 PM Page 327 Chapter 13 Challenges in Designing HIV Env Immunogens for Developing a Vaccine Indresh K. Srivastava* and R. Holland Cheng Summary HIV continues to be a major
More informationP G K R P E W M G W L K P R G G A V N Y A R P L Q G R V T M T R D V Y S D T A F
Supplementary Figure 1 VRC01 45-08-110497H 45-08-212510H 45-08-511533H 45-08-541880H Q V Q L V Q S G G Q M K K P G E S M R I S C R A S G Y E F I D C T L N W I R L A CAGGTGCAGCTGGTGCAGTCTGGGGGTCAGATGAAGAAGCCTGGCGAGTCGATGAGAATTTCTTGTCGGGCTTCTGGATATGAATTTATTGATTGTACGCTAAATTGGATTCGTCTGGCC
More informationSupporting Information
Supporting Information Sui et al..7/pnas.997 Pre-CLP CM9 LA9 SL Tat# Pol Vif % Tetramer + CD + CD + Vac+IL- +IL- Vac Fig. S. Frequencies of six different CD + CD + Mamu-A*-tetramer + cells were measured
More informationTargeting the CD4- and Coreceptor-Binding Sites of the HIV-1 Envelope Glycoprotein
Targeting the CD4- and Coreceptor-Binding Sites of the HIV-1 Envelope Glycoprotein The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters.
More informationLongitudinal Antigenic Sequences and Sites from Intra-Host Evolution (LASSIE) Identifies Immune-Selected HIV Variants
This manuscript is currently under consideration for publication in Viruses http://www.mdpi.com/journal/viruses Longitudinal Antigenic Sequences and Sites from Intra-Host Evolution (LASSIE) Identifies
More informationPotent and Broad Neutralization of HIV-1 Subtype C by Plasma Antibodies Targeting a Quaternary Epitope Including Residues in the V2 Loop
JOURNAL OF VIROLOGY, Apr. 2011, p. 3128 3141 Vol. 85, No. 7 0022-538X/11/$12.00 doi:10.1128/jvi.02658-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Potent and Broad Neutralization
More informationClone 3 Human Monoclonal Antibody Neutralizing Effect on HIV 2017
Science Improving Health Clone 3 Human Monoclonal Antibody Neutralizing Effect on HIV 2017 www.bioclonetics.com Invest at: www.wefunder.com/bioclonetics. Our video: https://youtu.be/spciismitxe Invest
More informationH5N1 and H7 LAIV-IAV Prime-Boost Studies
NIAID H5N1 and H7 LAIV-IAV Prime-Boost Studies Kanta Subbarao, MD, MPH NIAID, NIH The LID Pandemic Influenza Vaccine Program Program: CRADA with MedImmune Clinical Trials: Center for Immunization Research,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Infection strategy.
Supplementary Figure 1 Infection strategy. To test the antibody responses against influenza viruses, animals were sequentially infected with two divergent strains of the same subtype. For H1N1 infections,
More information4/14/2016. HIV Vaccines and Immunoprotection: Where Are We? Learning Objectives. After attending this presentation, participants will be able to:
HIV Vaccines and Immunoprotection: Where Are We? Mark J. Mulligan, MD, FIDSA Distinguished Professor of Medicine Emory University School of Medicine Atlanta, Georgia FINAL: 04/01/16 Atlanta, Georgia: Friday,
More informationCopyright 2015 David F. Boyd
Copyright 2015 David F. Boyd Developing improved challenge viruses for macaque models of HIV-1 infection David F. Boyd A dissertation submitted in partial fulfillment of the requirements for the degree
More informationCrystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen
Crystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen David Lutje Hulsik Unit for Virus Host Cell Interaction UMI 3265 University Joseph Fourier-EMBL-CNRS, Grenoble Env catalyzed
More informationImmunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group
report Immunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group John Mascola, C Richter King & Ralph Steinman on behalf of a Working Group convened by the Global HIV
More informationSEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS:
SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS: POSSIBILITIES OF SEROLOGICAL DIAGNOSIS TYPES OF SEROLOGICAL REACTIONS SEROLOGICAL REACTIONS Ag-Ab reactions used for the detection of unknown Ag or Ab, in vitro
More informationEMERGING ISSUES IN THE HUMORAL IMMUNE RESPONSE TO HIV. (Summary of the recommendations from an Enterprise Working Group)
AIDS Vaccine 07, Seattle, August 20-23, 2007 EMERGING ISSUES IN THE HUMORAL IMMUNE RESPONSE TO HIV (Summary of the recommendations from an Enterprise Working Group) The Working Group Reston, Virginia,
More informationDefining kinetic properties of HIV-specific CD8 + T-cell responses in acute infection
Defining kinetic properties of HIV-specific CD8 + T-cell responses in acute infection Yiding Yang 1 and Vitaly V. Ganusov 1,2,3 1 Department of Microbiology, University of Tennessee, Knoxville, TN 37996,
More informationModeling Virus- and Antibody-Specific Factors to Predict Human Immunodeficiency Virus Neutralization Efficiency
Article Modeling Virus- and Antibody-Specific Factors to Predict Human Immunodeficiency Virus Neutralization Efficiency Hillel Haim, 1,2 Ignacio Salas, 1 Kathleen McGee, 1 Noah Eichelberger, 2 Elizabeth
More informationReservoir BINGO. Methods Small group work/ large group discussion
Reservoir BINGO Objectives Describe the differences in current technologies available for measuring the reservoir Discuss the risk and benefit of each technology Methods Small group work/ large group discussion
More informationHIV-1 p24 ANTIGEN CAPTURE ASSAY
HIV-1 p24 ANTIGEN CAPTURE ASSAY Enzyme Immunoassay for the detection of Human Immunodeficiency Virus Type 1 (HIV-1) p24 in tissue culture media. Catalog # 5421 株式会社東京未来スタイル Tokyo Future Style, Inc 305-0047
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationIncomplete immune response to Coxsackie B viruses. associates with early autoimmunity against insulin
Incomplete immune response to Coxsackie B viruses associates with early autoimmunity against insulin Michelle P. Ashton 1, Anne Eugster 1, Denise Walther 1, Natalie Daehling 1, Stephanie Riethausen 2,
More informationMolecular Evolution of Broadly Neutralizing Llama Antibodies to the CD4-Binding Site of HIV-1
Molecular Evolution of Broadly Neutralizing Llama Antibodies to the CD4-Binding Site of HIV-1 The Harvard community has made this article openly available. Please share how this access benefits you. Your
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationHow HIV Causes Disease Prof. Bruce D. Walker
How HIV Causes Disease Howard Hughes Medical Institute Massachusetts General Hospital Harvard Medical School 1 The global AIDS crisis 60 million infections 20 million deaths 2 3 The screen versions of
More information