Supplementary Information

Size: px
Start display at page:

Download "Supplementary Information"

Transcription

1 Supplementary Information Splenic red pulp macrophages are intrinsically superparamagnetic and contaminate magnetic cell isolates Lars Franken, arika Klein, arina Spasova, nna Elsukova, Ulf Wiedwald, eike Welz, ercy Knolle, ichael Farle, ndreas Limmer and Christian Kurts

2 Supplementary Figure 1: FITC C E-Cy7 unstained unstained DCs Supplementary Figure 1: Flow cytometrical analysis of the autofluorescent properties of and DCs. The autofluorescence was analyzed in the indicated channel. The signal is depicted as a black line, the DC signal as grey background.

3 Supplementary Figure 2: ml) 5 3 Source cells LN ml) Dendritic cells T cells 15 5 ml) cells Dendritic cells T cells ml) 3 ml) 5 3 ml) 3 Supplementary figure 2: -contaminations alter cytokine concentrations in supernatants from in vitro cultures of conventional dendritic cells, T Cells and -Cells. cells, T cells and DCs were obtained by magnetic cell purification from spleens or the mesenteric lymph nodes without or with -depletion using the 3 antibody method. Cells were activated as described and 18 hours later supernatants were collected and cytokine levels were analyzed. () TNF-alpha concentrations in supernatants of cells, DCs and T cell cultures. () CCL3-concentrations in supernatants of - or T cell cultures or CCL4-concentrations in supernatants of DC cultures. esults are shown for one representative of two to three individual experiments using 3 mice per group. Error bars, s.d. (n=3 mice); <.5; <.1

4 Supplementary Figure 3: undepleted 3-antibody protocol CFSE proliferation of OT-II-T-cells in % no OV undepleted 3 antibody protocol Supplementary Figure 3: ntigen presentation by CD11c cells and obtained by CS. The cells were purified by the standard protocol or depleted of using our 3-antibody protocol. () Flow cytometrical analysis of the proliferation of CFSE-labeled OT-II T cells. Cells incubated with ovalbumine are depicted as black line, negative control that did not receive ovalbumin as grey background. () Statistical evaluation of ().

5 Supplementary Figure 4: 15 CD163 Expression level relative to Spleen 6 (%) 5... Source Spl Spl Spl LN Spl Spl Spl LN Spl Spl Spl LN Spi-C expression cells Dendritic cells T cells Supplementary Figure 4: -contaminations are responsible for CD163 mn expression in splenic DCs, T cells or cells isolated by conventional CS. mn levels of CD163 determined by T-C., source tissue, SpiC-expression and -depletion as indicated. esults are shown for one representative of two individual experiments (n=3); mean ± s.e.m.; p<.5, p<.1 (One-way nova in combination with a onferroni multiple-comparison test).

6 Supplementary Figure 5: relative CD11c 3 Spi-C expression T cells Spi-C expression T cells Spi-C expression DCs C relative Source Spi-C expression Spl Spl Spl LN Spl cells relative CD Spi-C expression cells relative DEC5 3 Spi-C expression DCs Supplementary Figure 5: -depletion does not reduce the levels of non- genes during T-C analysis. (-C) cells, T cells and DCs were obtained by magnetic cell purification from spleens or the mesenteric lymph nodes without or with -depletion using the 3-antibody protocol. The expression levels of the genes CD8β, CD3ε (), CD11c, DEC5 (), 2 and CD19 (C) relative to GDH was determined using qt-c. s negative control expression of these genes was also determined in purified by magnetic cell separation. esults are shown for one representative of two to three individual experiments using 2-4 mice per group. Error bars, s.d. (n=3 mice); <.5; <.1

7 Supplementary Figure 6: 15 1 relative Hmox1 expression relative Fpna1 expression 1 5 relative VC1 expression undepleted 3-antibody protocol undepleted 3-antibody protocol undepleted 3-antibody protocol undepleted CD11c cells CD11c cells depleted with 3-antibody protocol Isoype staining VC Supplementary figure 6: Genes involved in iron recycling can be detected in CS purificates of CD11c cells. () T-C analysis of CD11c cells and obtained by CS. The cells were purified by the standard protocol or depleted of using our 3-antibody protocol. Depicted are the relative expression levels of Hmox1, Fpn1 and Vcam1. () Flow cytometric analysis of the VC1 expression in cells purified like in (). CD11c cells obtained by the standard CS protocol are depicted as red line, CD11c cells depleted of using our 3-antibody protocol are depicted as black line. Isotype staining depicted as grey background.

8 Supplementary Figure 7: 25K Initial Gating 25K Exclusion of duplets 25K CD45 Gating K K K 15K 15K 15K K.4 K 92.3 K K 5K 5K SSC- 5K K15K K 25K FSC- Life/dead Gating 25K K 15K K FSC- 5K K15K K 25K FSC-W C Gating FSC CD45 Standard L/D gating excludes autofluorescent 5K Correct gating displays autofluorescent F4/ Life/Dead F4/ CD11c Supplementary Figure 7: Gating scheme employed for flow cytometrical analysis of splenocytes and CS isolates. () Depicted is the initial gating to exclude small cells fragments (SSC- versus FSC-C, left dot plot), cell duplets (FSC- versus FSC-W, middle dot plot) and the gating on CD45 cells (FSC- versus CD45, right dot plot). () Gating scheme for the exclusion of dead cells and from flow cytometrical analysis. Dead cells are excluded by staining with a dead cell detection dye. are either left in the viable cell population (upper dot plot) or are excluded as shown (lower dot plot). The dot plots on the right demonstrate the composition of the viable cell population.

9 Supplementary Table 1: rimers used for T-C Gene Sense ntisense GITL CCTCGCCCTGCCTC CCGGTCCTTGGCCGT γ TGTGGCCCGCCTGC GTGTCCCTGGTTTTCGT 2 CCCTCCCCGTGTGCT TCGCTTGGCTGCTGTGT CD19 CCTGCCTCGGGGC CTTTGGTCTCCTGGCGG CD3ε CCTCCTGCTGTTGGCCTT GTGCCCTGTCCTCGCT CD8β CTGCCCCCCGGCT TCTCCTCCGCCCGT DEC5 GGCCTGTCTCGCTTCCT GTCCGGGCTCGGGTTT CD163 CCGGCCTCTTGGTTTGTG GGTTTTCCGGGTTTCGC CD11c TTCCTGGCTGTTGGCTTGTG GGCTGTGCTCCCGGC CGCTCGGCGGTGGCTCTG GCTTGCGCTTGCCCTTGCC Hmox1 GCTTTGCTGGTGTGGCT GTGGGCCCTCCGG Fpn1 CCCTGCTCTGGCTGTG GGTGGGCTCTTGTTCCTT Vcam1 TTTTCTGGGGCGGGTT CGTCGCCCGTCC

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α

More information

Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.

Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig. C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice

More information

NK cell flow cytometric assay In vivo DC viability and migration assay

NK cell flow cytometric assay In vivo DC viability and migration assay NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with

More information

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas

More information

SUPPLEMENT Supplementary Figure 1: (A) (B)

SUPPLEMENT Supplementary Figure 1: (A) (B) SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with

More information

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)

More information

Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice

Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry

More information

pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki

pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)

More information

Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c)

Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c) 1 Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c) Serum IgG1 (a), IgM (b) and IgG2 (c) concentrations in response to papain immediately before primary immunization (day

More information

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +

More information

Nature Medicine: doi: /nm.3922

Nature Medicine: doi: /nm.3922 Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun

More information

Supplementary Materials for

Supplementary Materials for www.sciencemag.org/content/348/6241/aaa825/suppl/dc1 Supplementary Materials for A mucosal vaccine against Chlamydia trachomatis generates two waves of protective memory T cells Georg Stary,* Andrew Olive,

More information

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong

More information

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates

More information

Nature Protocols: doi: /nprot Supplementary Figure 1

Nature Protocols: doi: /nprot Supplementary Figure 1 Supplementary Figure 1 Traditional electronic gating strategy for analysing cell death based on A5-FITC and 7-AAD. a, Flow cytometry analysis showing the traditional two-stage electronic gating strategy

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

D CD8 T cell number (x10 6 )

D CD8 T cell number (x10 6 ) IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p

More information

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

Eosinophils are required. for the maintenance of plasma cells in the bone marrow Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning

More information

SUPPORTING INFORMATIONS

SUPPORTING INFORMATIONS SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor

More information

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Supplemental Table I.

Supplemental Table I. Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,

More information

Nature Medicine doi: /nm.3957

Nature Medicine doi: /nm.3957 Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic

More information

B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C

B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C CD3-specific antibody-induced immune tolerance and suppression of autoimmune encephalomyelitis involves TGF-β production through phagocytes digesting apoptotic T cells Sylvain Perruche 1,3, Pin Zhang 1,

More information

Nature Medicine: doi: /nm.2109

Nature Medicine: doi: /nm.2109 HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance

More information

Supplemental Information. IRF-5 Promotes Cell Death in CD4 T Cells. during Chronic Infection

Supplemental Information. IRF-5 Promotes Cell Death in CD4 T Cells. during Chronic Infection Cell Reports, Volume 24 Supplemental Information IRF-5 Promotes Cell Death in T Cells during Chronic Infection Aymeric Fabié, Linh Thuy Mai, Xavier Dagenais-Lussier, Akil Hammami, Julien van Grevenynghe,

More information

Dual Targeting Nanoparticle Stimulates the Immune

Dual Targeting Nanoparticle Stimulates the Immune Dual Targeting Nanoparticle Stimulates the Immune System to Inhibit Tumor Growth Alyssa K. Kosmides, John-William Sidhom, Andrew Fraser, Catherine A. Bessell, Jonathan P. Schneck * Supplemental Figure

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

HD1 (FLU) HD2 (EBV) HD2 (FLU)

HD1 (FLU) HD2 (EBV) HD2 (FLU) ramer staining + anti-pe beads ramer staining a HD1 (FLU) HD2 (EBV) HD2 (FLU).73.11.56.46.24 1.12 b CD127 + c CD127 + d CD127 - e CD127 - PD1 - PD1 + PD1 + PD1-1 1 1 1 %CD127 + PD1-8 6 4 2 + anti-pe %CD127

More information

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH ALETA A SOURCE OF 1,3-BETA GLUCANS Aleta is highly bioavailable, offering a concentration greater than 5% of 1,3-beta glucans. Aleta provides a consistent response

More information

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,

More information

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV)

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV) A mln NK Cells(x ) 6 1 * ndln NK Cells (x ) ns C Lung NK Cells(x ) 1 1 7 * D LN NK Cells (x ) 1 7 1 7 Days post-infection (A/PR/8) * * E Liver NK Cells (x ) 1 7 Days post-infection (A/PR/8) * * * 1 7 Days

More information

Supplementary information

Supplementary information Supplementary information Intrahepatic myeloid cell-aggregates enable local CD8 + T cell expansion and successful immunotherapy against chronic viral liver infection Li- Rung Huang, Dirk Wohlleber, Florian

More information

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells

More information

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1 % of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György

More information

Dendritic cell subsets and CD4 T cell immunity in Melanoma. Ben Wylie 1 st year PhD Candidate

Dendritic cell subsets and CD4 T cell immunity in Melanoma. Ben Wylie 1 st year PhD Candidate Dendritic cell subsets and CD4 T cell immunity in Melanoma Ben Wylie 1 st year PhD Candidate Melanoma Melanoma is the 4 th most common cancer in Australia. Current treatment options are ineffective resulting

More information

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23 3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF

More information

Pearson r = P (one-tailed) = n = 9

Pearson r = P (one-tailed) = n = 9 8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable

More information

Table S1. Viral load and CD4 count of HIV-infected patient population

Table S1. Viral load and CD4 count of HIV-infected patient population Table S1. Viral load and CD4 count of HIV-infected patient population Subject ID Viral load (No. of copies per ml of plasma) CD4 count (No. of cells/µl of blood) 28 7, 14 29 7, 23 21 361,99 94 217 7, 11

More information

Supplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells

Supplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells Chien 1 Supplementary information Manuscript: SREP-16-42480A Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by Repeated Stimulation of Antigen-Presenting B Cells Chien-Hui Chien 1, Hui-Chieh

More information

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were

More information

Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were

Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were Supplemental Materials and Methods Mice Female C57BL/6 (B6, I-E null, H-2 b ), BALB/c (H-2 d ) + ), FVB/N (H-2 q, I-E null, CD45.1 + ), and B6D2F1 (H-2 b/d ) mice were purchased from the Animal Resources

More information

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the

More information

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Supplementary Table 1

Supplementary Table 1 Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,

More information

Supplementary Information:

Supplementary Information: Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection

Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection Supplementary Figure 1 Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection with influenza virus. (a) ST2-GFP reporter mice were generated as described in Methods.

More information

Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis

Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. .. Supplementary Figure 1 % of initial

More information

Supplementary Figure 1

Supplementary Figure 1 d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP

More information

Dendritic cells in cancer immunotherapy Aimin Jiang

Dendritic cells in cancer immunotherapy Aimin Jiang Dendritic cells in cancer immunotherapy Aimin Jiang Feb. 11, 2014 Dendritic cells at the interface of innate and adaptive immune responses Dendritic cells: initiators of adaptive immune responses Dendritic

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

In vitro human regulatory T cell suppression assay

In vitro human regulatory T cell suppression assay Human CD4 + CD25 + regulatory T cell isolation, in vitro suppression assay and analysis In vitro human regulatory T cell suppression assay Introduction Regulatory T (Treg) cells are a subpopulation of

More information

Supporting Information

Supporting Information Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Figure 1. NOS2 -/- mice develop an analogous Ghon complex after infection in the ear dermis and show dissemination of Mtb to the lung. (A) WT and NOS2 -/- mice were

More information

NC bp. b 1481 bp

NC bp. b 1481 bp Kcna3 NC 11 178 p 1481 p 346 p c *** *** d relative expression..4.3.2.1 CD4 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna Kcna6 Kcna7 Kcnn4 relative expression..4.3.2.1 CD8 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna

More information

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice SUPPLEMENTAL METHODS T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice Florian Wiede 1, Benjamin J. Shields 1, Sock Hui Chew 1, Konstantinos Kyparissoudis 2,

More information

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad

More information

Supplementary Figures

Supplementary Figures Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,

More information

Supporting Information

Supporting Information Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific

Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific SUPPLEMENTARY FIGURE LEGEND Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific CD4 + T cells correlates with intracellular CTLA-4 levels. (a) Comparative CTLA-4 levels

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed

More information

islets scored 1 week month months

islets scored 1 week month months Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2

Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2 Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2 SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1:

More information

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC

More information

CD44

CD44 MR1-5-OP-RU CD24 CD24 CD44 MAIT cells 2.78 11.2 WT RORγt- GFP reporter 1 5 1 4 1 3 2.28 1 5 1 4 1 3 4.8 1.6 8.1 1 5 1 4 1 3 1 5 1 4 1 3 3.7 3.21 8.5 61.7 1 2 1 3 1 4 1 5 TCRβ 2 1 1 3 1 4 1 5 CD44 1 2 GFP

More information

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. 1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Pathologic Stage. Lymph node Stage

Pathologic Stage. Lymph node Stage ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse

Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Ivan Zanoni*, Renato Ostuni*, Simona Barresi, Marco Di Gioia, Achille Broggi, Barbara Costa, Roberta

More information