Data Package. Multiplex Oncology I 96 96

Size: px
Start display at page:

Download "Data Package. Multiplex Oncology I 96 96"

Transcription

1 Data Package Multiplex Oncology I 96 96

2 Table of contents 1. Introduction Technology Data analysis 3 2. Performance characteristics Sample types Analytical Measurement 4 Detection limit 4 Measuring ranges 4 High dose hook effect Precision Repeatability Reproducibility 2.4 Analytical Specificity Recovery by addition Endogenous interference 2.5 Scalability 3. References 11 Technical support For technical support, please contact us at support@olink.com or

3 1. Introduction Proseek Multiplex Oncology I is a reagent kit measuring 92 cancer related human protein biomarkers simultaneously in serum, plasma or other biological samples. The analytical performance of the product has been carefully validated and the results are presented below. 1.1 Technology The Proseek reagents are based on PEA, a Proximity Extension Assay technology 1, where 92 oligonucleotide labeled antibody probe pairs are allowed to bind to their respective target present in the sample. A PCR reporter sequence is formed by a proximity dependent DNA polymerization event and is subsequently detected and quantified using real-time PCR. The assay is performed in a homogeneous 96-well format without any need for washing steps, see Figure Data analysis Data analysis was performed by employing a preprocessing normalization procedure. For each data point, delta Cq (dcq) values were obtained by subtracting the value for the internal run control (Extension control), thus normalizing for technical variation. To generate delta delta Cq (ddcq) values, the normalized dcq was set relative to the background by subtracting the obtained value in the first step from the normalized background value. All calculations up to this point are based on log2 data. Linearization of data was employed by the mathematical operation 2 dcq or 2 dd Cq. Statistical analyses, e.g. coefficient of variation (CV) calculations were performed on linearized values. Incubation Extension Detection Allow the 92 antibody probe pairs to bind to their respective proteins in your samples. Create and pre-amplify 92 unique DNA reporter sequences by proximity extension. Quantify each biomarker s DNA reporter using high throughput real-time qpcr. Fig 1. Proseek Multiplex assay procedure employs three core steps: Incubation, Extension and Detection. High throughput real-time qpcr is performed by using the Fluidigm BiomarkTM HD system. Proseek Multiplex Oncology I Data Package 3

4 2. Performance characteristics 2.1 Sample types The ability to use different sample types was evaluated with the Proseek Multiplex Oncology I by collecting matched serum, acid citrate dextrose (ACD), ethylenediaminetetraacetic acid (EDTA) and heparin plasma samples from 5 individuals. Table 1 shows linearized signal-to-background values for each sample type and assay, as well as relative percentage differences of serum, citrate and heparin plasma to EDTA plasma. The results indicated that serum, as well as citrate and EDTA plasma are suitable sample types for most analytes. Highest number of assays below limit of detection was observed for heparin plasma, although many of the assays function without major limitation in that sample type as well. 2.2 Analytical Measurement Detection limit Limit of detection (LOD) was defined as 3 standard deviations of ddcq above background, and reported in pg/ml for 9 proteins out of 92, for which recombinant antigen was available, see Figure 2 and Table 1. Measuring ranges The analytical measuring range was defined by the lower limit of quantification (LLOQ) and upper limit of quantification (ULOQ) and reported in pg/ml. Quantification limits of LLOQ and ULOQ were calculated with the following trueness and precision criteria; relative error 30% and CV 30%, of backcalculated values, respectively. Measuring ranges were reported in order of log. See Figure 2 and Table 1. Calibrator curves were determined for 9 out of 90 protein biomarkers for which recombinant antigen was available. Representative assays with their analytical measurement data are exemplified in Figure 2 and the distribution of their corresponding measuring range per assay is shown in Figure 3. Separate calibrator curves established for each assay may be viewed at High dose hook effect A high dose hook effect is a state of antigen excess relative to the reagent antibodies resulting in falsely lower values. If undetected, a significantly lower value will be reported which can lead to misinterpretation of results. Therefore, the high dose hook effect was determined for each analyte, here reported in pg/ml. See Figure 2 and Table 1. A) C) B) D) Signal ( Cq) Signal ( Cq) Signal ( Cq) Signal ( Cq) LOD: pg/ml LLOQ: pg/ml ULOQ: pg/ml Hook: pg/ml Range: 2.4 log 0.1 LOD: 0.06 pg/ml LLOQ: 0.24 pg/ml ULOQ: pg/ml Hook: pg/ml Range: 4. log 0.1 LOD: 46.6 pg/ml LLOQ: 61.0 pg/ml ULOQ: pg/ml Hook: pg/ml Range: 3.0 log 0.1 LOD: 0.06 pg/ml LLOQ: 0.24 pg/ml ULOQ: pg/ml Hook: pg/ml Range: 4.2 log 0.1 LLOQ LLOQ Carcinoembryonic antigen LLOQ Concentration (pg/ml) Adrenomedullin 0 Interleukin 0 LLOQ ULOQ 000 Concentration (pg/ml) 000 Concentration (pg/ml) Interleukin ULOQ 000 Concentration (pg/ml) ULOQ ULOQ LOD LOD LOD LOD Fig 2. Calibrator curves from 4 representative assays and their corresponding analytical measurement data. Signal ( Cq) Signal ( Cq) Proseek Multiplex Oncology I Data Package

5 CTSD Gal-3 ER CD62E REG-4 PRL MK PECAM-1 FABP4 EGFR MPO TNF-R2 IL6RA TIE-2 CPI-B ADM CCL21 hk11 IL-1ra THPO MIA PSA ErbB2/Her2 EPO GDF-15 FS TNF TR-AP MYD FAS BAFF IL-2 GM-CSF PDGF subunit B TGF-beta-1 MIC-A BTC CD30-L EPR CAIX CXCL11 IFN-gamma FR-alpha CEA HGF receptor HE4 VEGF-D CASP-3 VEGFR-2 ErbB4/Her4 ErbB3/Her3 CXCL9 SCF KLK6 CXCL13 PRSS AR TNFRSF4 CXCL5 HGF CXCL CCL19 FasL TNFRSF14 IL17RB CD69 HB-EGF CCL24 IL- IL-4 TGF-alpha U-PAR Ep-CAM EMMPRIN IL-7 TNF-RI TF CD40-L Flt3L IL2RA MCP-1 EGF GH CSF-1 PlGF VEGF-A IL- IL-6 OPG % 0% 60% 40% 20% 0% Concentration (pg/ml) Fig 3. Distribution of analytical measuring range, defined by the limits of quantification LLOQ-ULOQ, for 9 out of 92 analytes. Proseek Multiplex Oncology I Data Package 5

6 Table 1. Sample Types, Analytical Measurement; Limit of Detection, LOD, Lower Limit of Quantification, LLOQ, Upper Limit of Quantification, ULOQ, High Dose Effect, Hook, and Precision indicative of assay performance are shown for 92 analytes. Values below limit of detection were not reported (NR). Sample types Analytical measurment Precision Signal-to-background (2 ddcq ) Relative 2 ddcq to EDTA plasma pg/ml log Target UniProt No ACD EDTA Heparin Serum ACD Heparin Serum LOD LLOQ ULOQ Hook Range Intra-assay Inter-assay Inter-site Adrenomedullin P % 76% 56% % 26% 39% Amphiregulin P % 7% 111% % 22% 26% Angiopoietin-1 receptor Q % 74% 93% % 13% % B-cell activating factor Q9Y % 70% 96% % 14% 24% Betacellulin P NR NR 5% NR NR NR CA242 tumor marker % % 4% NR NR NR NR NR NR NR NR Carbonic Anhydrase IX Q % 69% 93% % % 27% Carcinoembryonic antigen P % 95% 115% % 27% % Caspase-3 P % 52% 35% % 1% 37% Cathepsin D P % 71% 114% % 23% 22% C-C motif chemokine 19 Q % 6% 1% % 15% 27% C-C motif chemokine 21 O % 4% 93% % 27% 31% C-C motif chemokine 24 O % 76% 4% % 17% 20% CD40 ligand P % 26% 93% % 22% 35% C-X-C motif chemokine P % 64% 1% % 17% 39% C-X-C motif chemokine 11 O % 2% 321% % 1% 35% C-X-C motif chemokine 13 O % 77% 3% % 1% % C-X-C motif chemokine 5 P % 13% 249% % 1% 17% C-X-C motif chemokine 9 Q % 75% 97% % 14% 23% Cystatin B P % 5% 95% % 20% 24% Early activation antigen CD69 Q % 9% 233% % 17% 25% Epidermal growth factor P % 19% 564% % 14% 37% Epidermal growth factor receptor P % 6% 96% % 15% 42% Epididymal secretory protein E4 Q % 77% 99% % 15% 29% Epiregulin O % 299% % 23% 40% Epithelial cell adhesion molecule P % 6% 3% % 17% 19% Erythropoietin P % 74% 11% % 27% 21% E-selectin P % 63% 96% % 17% 29% Estrogen receptor P NR NR 114% NR NR NR Extracellular matrix metalloproteinase inducer P % 77% 94% % 15% 31% Fas antigen ligand P % 91% 111% % 20% 30% Fatty acid binding protein 4 adipocyte P % 73% 2% % 19% 17% Fms-related tyrosine kinase 3 ligand P % 2% 111% % % 21% Folate receptor alpha P % 79% 9% % 23% 34% Follistatin P % 76% 3% % % 26% Galectin-3 P % 77% 1% % % 21% Granulocyte-macrophage colonystimulating factor P NR NR 6% NR NR NR Growth Hormone P % 77% 5% % 15% 23% Growth/differentiation factor 15 Q % 72% 4% % % 32% Heparin-binding EGF-like growth factor Q % 40% 221% % 14% 27% Hepatocyte growth factor P % 53% 119% % 14% 27% Hepatocyte growth factor receptor P % 3% 2% % 17% 22% Interferon gamma P % 6% 4% % 24% 32% Interleukin 1 receptor antagonist protein P % 67% 7% % % 24% Interleukin P % 72% 0% % 22% 21% Interleukin 17 receptor B Q9NRM % 77% 111% % 21% 23% Interleukin 2 P % 92% 2% NR NR NR Interleukin 2 receptor subunit alpha P % 0% 7% % 15% 23% Interleukin 4 P % 90% 3% NR NR NR Interleukin 6 P % 75% 113% % 14% 1% 6 Proseek Multiplex Oncology I Data Package

7 Sample types Analytical measurment Precision Signal-to-background (2 ddcq ) Relative 2 ddcq to EDTA plasma pg/ml log Target UniProt No ACD EDTA Heparin Serum ACD Heparin Serum LOD LLOQ ULOQ Hook Range Intra-assay Inter-assay Inter-site Interleukin 6 receptor subunit alpha P % 2% 114% % % 29% Interleukin 7 P % 6% 223% % 1% 52% Interleukin P % 56% 1% % % 23% Kallikrein-11 Q9UBX % 5% 1% % 1% 1% Kallikrein-6 Q % 77% 111% % 15% 2% Macrophage colony-stimulating factor 1 P % 0% % % 23% 20% Matrix metalloproteinase-3 P % 97% 119% NR NR NR NR NR 5% 3% 46% Melanoma-derived growth regulatory protein Q % 7% 95% % 13% 2% MHC class I polypeptide-related sequence A Q % 1% % % 27% 2% Midkine P % 75% % % 21% 37% Monocyte chemotactic protein-1 P % 93% 140% % 13% 20% Myeloid differentiation primary response protein MyD Q % 65% 2% % 47% 55% Myeloperoxidase P % 64% 204% % 15% 24% Osteoprotegerin O % 71% 96% % 11% 20% Ovarian cancer-related tumor marker 5 QWXI % 0% 119% NR NR NR NR NR % 26% 34% Placenta Growth Factor P % 71% 6% % 14% 2% Platelet endothelial cell adhesion molecule P % 75% 3% % % 20% Platelet-derived growth factor subunit B P % % 203% % 21% 62% Prolactin P % 74% 4% % 1% 1% Prostasin Q % 4% 117% % 17% 30% Prostate-specific antigen P % 91% 9% % 31% 31% Receptor tyrosine-protein kinase ErbB-2 P % 73% 95% % 19% 1% Receptor tyrosine-protein kinase ErbB-3 P % 73% 7% % 17% 22% Receptor tyrosine-protein kinase ErbB-4 Q % 0% 113% % 22% 29% Regenerating islet-derived protein 4 Q9BYZ % 7% 3% % 23% 25% Stem cell factor P % 74% 0% % 17% 20% Tartrate-resistant acid phosphatase type 5 P % 60% 92% % 17% 27% Thrombopoietin P % 57% 15% % 19% 22% Tissue Factor P % 74% 7% % 14% 22% Transforming growth factor alpha P % 7% 379% % 20% 35% Transforming growth factor beta 1 P % 55% 202% % % 2% Tumor necrosis factor alpha P % 77% 92% NR NR NR Tumor necrosis factor ligand superfamily member 14 O % 69% 365% % 20% 24% Tumor necrosis factor ligand superfamily member P % 60% 7% % 27% 35% Tumor necrosis factor receptor 1 P % 0% 9% % 13% 23% Tumor necrosis factor receptor 2 P % 74% % % 14% 25% Tumor necrosis factor receptor superfamily member 4 P % 0% 115% % 2% 20% Tumor necrosis factor receptor superfamily member 6 P % 0% 11% % 14% 29% Urokinase plasminogen activator surface receptor Q % 76% % % % 19% Vascular endothelial growth factor A P % 70% 143% % % 26% Vascular endothelial growth factor D O % 77% 93% % 20% 31% Vascular endothelial growth factor receptor 2 P % 1% 2% % 17% 23% Proseek Multiplex Oncology I Data Package 7

8 2.3 Precision Repeatability Within-run variation (intra-assay) was calculated as the mean coefficient of variation (% CV) for individual serum samples, within each of 11 separate runs during the validation studies. Between-run variation (inter-assay) was calculated as the mean coefficient of variation (% CV), for the same individual serum samples, between the 11 separate runs during the validation studies. Variation calculations were assessed on linearized values for 5 out of 92 analytes. Assays with values below limit of detection were not reported. See Table 1. Across 5 assays, the mean CV within-run and between-run variations were observed to be % and 19%, respectively. The distribution of both within-run and between-run variations per assay is shown in Figure 4. Between-run variations (Inter-assay) ranged from 25% to % while the between-site variation (Intersite) ranged from 22% to 14%, here shown in direct comparison to Olink Bioscience in Figure 5. Overall, the Proseek Multiplex Oncology I showed very good reproducibility and repeatability with average between-site variation of 2%, in particular considering that, all external sites were first time users. β 1 Intra 1: 15% Intra 2: % Inter: 25% 21% β 3 Intra 1: NR Intra 2: % Inter: NR 1% No. of protein biomarkers Intra Inter β 2 14% Intra 1: 1% Intra 2: 9% Intra: % Inter: 19% 22% β 4 Intra 1: 1% Intra 2: 14% > 40 Inter: 19% Inter: % %CV Fig 4. Distribution of intra-assay and inter-assay variations of Proseek Multiplex Oncology I Reproducibility Between-site variation was also investigated during the validation in a β-site study, to estimate the expected variations in values between different laboratories, with different operators and using different equipment. Eight individual serum samples were distributed to each site together with Proseek Multiplex Oncology I reagent kits. Each site was instructed to perform the analysis of the individual serum samples according to the same run design. Each site was also asked to perform two independent runs. The overall design of the β-site study enabled the estimation of both the within-run and between-run variations for 3 sites and the between-site variation for each site, here shown in Figure 5. Within-run variations (Intra-assay) ranged from 1% to 15% in the first analysis and 14% to % in the second analysis. Due to technical error of analysis number 1 at β-site 3, the between-run estimation could not be determined. Fig 5. Validation of the Proseek Multiplex Oncology I at 4 (β1-β4) different laboratories. Larger boxes shows within-run and between-run variations for each site and small boxes represent the between-site run variations in direct comparison to Olink Bioscience. NR; data not reported. 2.4 Analytical Specificity Recovery by addition Recovery was calculated as the relative difference in signal between a complex (EDTA plasma) and a noncomplex matrix (buffer). Two concentrations, 5 ng/ml and 50 ng/ml, of target antigens were spiked in. Twentyfive assays out of 92 reached high dose hook effect values or had endogenous protein levels exceeding spike-in antigen concentrations and were withdrawn from the analysis. Recovery was calculated as the ratio of observed results to expected results, expressed as % recovery. The average recovery at 50 ng/ml spike-in antigen concentrations was determined to be 96% for 44 assays and at 5 ng/ml spike-in antigen concentrations to be 99% for 43 assays. For 23 assays results were obtained for both spike-in concentrations. Recovery value of 0% to 0% is considered acceptable and the results are summarized in Table 2. Proseek Multiplex Oncology I Data Package

9 Table 2. Performance characteristics. Representative recovery values (%) for at least one spike-in concentration is presented for 67 out of 92 assays Endogenous interference was performed by addition of hemolysate, lipids and bilirubin in serum matrix. Reported are the highest tested concentrations without impact on assay performance. Recovery Endogenous interference Recovery Endogenous interference 1 ng/ml 5 ng/ml 50 ng/ml 200 ng/ml 1 g/l g/l Targets 1-46 Hemolysate Lipids Bilirubin Targets Hemolysate Lipids Bilirubin Adrenomedullin % Interleukin 2-115% 7% Amphiregulin - 1% 9% Interleukin 2 receptor subunit alpha Angiopoietin-1 receptor % Interleukin 4-79% B-cell activating factor - 115% 1% Interleukin 6-9% Betacellulin 130% Interleukin 6 receptor subunit alpha CA242 tumor marker Interleukin 7 3% Carbonic Anhydrase IX - 96% 99% Interleukin 136% Carcinoembryonic antigen - 3% 59% Kallikrein-11-97% 91% Caspase-3-137% 2% Kallikrein-6-3% 7% Cathepsin D % Macrophage colony-stimulating factor 1 - % C-C motif chemokine % Matrix metalloproteinase C-C motif chemokine 21 67% Melanoma-derived growth regulatory protein - 9% 7% C-C motif chemokine MHC class I polypeptide-related sequence A - 52% 69% CD40 ligand - 3% Midkine - - 5% C-X-C motif chemokine - 6% Monocyte chemotactic protein-1-5% C-X-C motif chemokine % Myeloid differentiation primary response protein MyD - 62% 51% C-X-C motif chemokine 13 % Myeloperoxidase % C-X-C motif chemokine 5 136% Osteoprotegerin - % C-X-C motif chemokine 9-4% 1% Ovarian cancer-related tumor marker Cystatin B % Placenta Growth Factor - 2% Early activation antigen Platelet endothelial cell - 130% 134% CD69 adhesion molecule % Epidermal growth factor 144% Platelet-derived growth factor subunit B - - 1% Epidermal growth factor receptor % 96% Prolactin % 91% Epididymal secretory protein E4-79% 6% Prostasin - 0% Epiregulin - 2% Prostate-specific antigen - 1% 92% Epithelial cell adhesion Receptor tyrosine-protein kinase - 0% molecule ErbB % Erythropoietin - 22% 6% Receptor tyrosine-protein kinase ErbB % E-selectin Receptor tyrosine-protein kinase ErbB-4-46% 67% Estrogen receptor - - 9% Regenerating islet-derived protein % Extracellular matrix metalloproteinase inducer - 61% Stem cell factor - 99% 1% Fas antigen ligand - 7% Tartrate-resistant acid phosphatase type % Fatty acid binding protein 4 adipocyte % Thrombopoietin - % 91% Fms-related tyrosine kinase 3 ligand 1% Tissue Factor - 7% Folate receptor alpha - 2% 91% Transforming growth factor alpha - 0% Follistatin % Transforming growth factor beta % Galectin Tumor necrosis factor alpha - 56% 50% Granulocyte-macrophage Tumor necrosis factor ligand - 3% 2% colony-stimulating factor superfamily member 14-11% Growth Hormone - 97% Tumor necrosis factor ligand superfamily member - 77% Growth/differentiation factor 15-0% 119% Tumor necrosis factor receptor % Heparin-binding EGF-like growth factor 14% Tumor necrosis factor receptor % Hepatocyte growth factor - 135% Tumor necrosis factor receptor superfamily member 4-2% Hepatocyte growth factor Tumor necrosis factor receptor receptor superfamily member % Interferon gamma - 150% 7% Urokinase plasminogen activator surface receptor - 62% Interleukin 1 receptor Vascular endothelial growth antagonist protein factor A % Interleukin 1% Vascular endothelial growth factor D - - 1% Interleukin 17 receptor B - 62% 7% Vascular endothelial growth factor receptor % ng/ml 5 ng/ml 50 ng/ml 200 ng/ml 1 Proseek Multiplex Oncology I Data Package 9

10 Endogenous interference Endogenous interference from heterophilic antibodies, e.g. HAMA, is known to cause problems in immunoassays. To evaluate the potential impact of this specific interference, a special mismatch system was designed. The only way to generate a signal here is by antibody probe pairs being brought into proximity, by cross-binding substances other than antigens, e.g. heterophilic antibodies and similarly acting rheumatoid factor. Six different mismatched probe pairs of varying antibody host species origin were designed and evaluated with a Heterophilic Assessment Panel from Scantibodies Laboratory Inc. (part no. 3KG027). No interference could be detected for any of the panel samples, indicating a sufficient blocking ability in all assays in the Proseek Multiplex Oncology I The potential impact of certain known interfering serum and plasma components was evaluated by using serial dilutions of hemolysate, lipids and bilirubin, respectively in serum, as shown in Figure 6. These additions represent different patient health conditions and/or sample collection irregularities. No interference was detected by addition of bilirubin while 1 assay was observed to be affected by lipids and assays out 92 were altered by hemolysate. The latter is probably due to actual analyte leaking out from the disrupted blood cells rather than disturbance of the assay mechanism. Table 2 shows the highest concentrations without impact on assay performance for each component. A) Hemolysate 15 g/l 7.5 g/l 3.75 g/l 1. g/l 0.94 g/l 0.47 g/l 0.23 g/l Serum 2.5 Scalability Assay performance was further evaluated with regard to scalability, meaning the capability of the Proseek Multiplex technology to maintain the same quality of performance irrespective of multiplex grade. A stepwise increase of multiplex grade (24, 4, 72 and 96) was performed and the observed dcq values for the 24-plex were plotted against the 4-plex, 72-plex and 96-plex for each analyte. The correlation coefficient R 2 value generated by linear regression analysis reflects the correlation between the multiplex assays. The R 2 values were >0.99 for the different multiplex blocks, as shown in Figure 7, demonstrating the scalability of the system. A) B) 24-plex (dcq) 24-plex (dcq) y = x R² = plex (dcq) y = 1.017x R² = 0.99 B) Lipids plex (dcq) Serum C) y = 1,025x - 0,427 R² = 0,9971 C) Bilirubin 24-plex (dcq) Serum plex (dcq) Fig 6. Endogenous interference. Levels tested for hemolysate were g/l hemoglobin, lipids and bilirubin The highest hemolysate concentration translates to about % hemolysis. Fig 7. Scalability of the Proseek Mutliplex technology platform. Human serum samples were analyzed with a 24-plex, 4- plex and 72-plex assay and the complete Proseek Mutliplex Oncology I panel. The observed dcq (log2) values were plotted, and the correlation coefficient R2 value was generated by linear regression. Proseek Multiplex Oncology I Data Package

11 3. References 1. Lundberg M, Eriksson A, Tran B, Assarsson E and Fredriksson S. Homogeneous antibody-based proximity extension assays provide sensitive and specific detection of owabundant proteins in human blood. Nucleic Acid Res 6 June (2011). doi:.93/nar/gkr424 Proseek Multiplex Oncology I Data Package 11

12 This product is for research use only. Not for use in human diagnostic or therapeutic procedures. This product includes a license for non-commercial use of Proseek products. Commercial users may require additional licenses. Please contact Olink AB for details. There are no warranties, expressed or implied, which extend beyond this description. Olink AB is not liable for property damage, personal injury, or economic loss caused by this product. The following trademarks are owned by Olink AB: Olink, Olink Bioscience, Proseek, Duolink and PLA. This product is covered by several patents and patent applications including US 6,511,09, US 7,306,904, and related US and foreign patents. This product is sold under license from PHRI Properties, Inc. and may be used under PHRI Properties patent rights outside the field of human in vitro diagnostics. Components in the Proseek Multiplex Probe Kit utilise Lightning-Link technology and are provided under license from Innova Biosciences Olink AB. All third party trademarks are the property of their respective owners. 0962, v1.3, Olink Bioscience Dag Hammarskjölds v. 52B SE Uppsala, Sweden

DATA PACKAGE. Multiplex CVD I 96 96

DATA PACKAGE. Multiplex CVD I 96 96 DATA PACKAGE Multiplex CVD I 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection limit

More information

Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension.

Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension. VALIDATION DATA 1. Introduction Olink Inflammation is a reagent kit measuring 92 inflammation related human protein biomarkers simultaneously. The analytical performance of the product has been carefully

More information

VALIDATION DATA. Multiplex CVD II 96 96

VALIDATION DATA. Multiplex CVD II 96 96 VALIDATION DATA Multiplex CVD II 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Quality Controls 3 1.3 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical

More information

FirePlex Multiplex Immunoassay product list

FirePlex Multiplex Immunoassay product list FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes

More information

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA.

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. AUTOANTIBODY PROFILING SYSTEM ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. Detect Quantify Classify Phone: +1-814-262-7331; Fax: +1-814-262-7334, Email: itsi@itsibio.com Website:

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

Nori Rabbit IL-2 ELISA Kit DataSheet

Nori Rabbit IL-2 ELISA Kit DataSheet Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the

More information

Hexagon PSA. Design Verification. Contents

Hexagon PSA. Design Verification. Contents Design Verification Hexagon PSA Contents 1. Function...2 2. Sensitivity, Dynamic Range and Traceability...2 Description of Control Materials...2 Analytical Sensitivity...2 3. Clinical Evaluation...3 Evaluation

More information

Human Neurology 3-Plex A

Human Neurology 3-Plex A Human Neurology 3-Plex A SUMMARY AND EXPLANATION OF THE TEST The Human N3PA assay is a digital immunoassay for the quantitative determination of total Tau, Aβ42, and Aβ40 in human plasma and CSF. Determination

More information

ELISA kits for Cancer

ELISA kits for Cancer ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL

More information

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it.

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it. Electrolytes Version: 1 Edited by: Jason Kim (note that the following list should be linked to the appropriate location.) Summary Reagents and Materials Protocol Reagent Preparation Reagent 1 Reagent 2

More information

PERIOSTIN ELISA CONTENTS

PERIOSTIN ELISA CONTENTS PERIOSTIN ELISA for the quantitative determination of Periostin in human serum, EDTA plasma, heparin plasma, and citrate plasma Cat. No. BI-20433. 12 x 8 tests CONTENTS ASSAY CHARACTERISTICS Summary...

More information

Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies

Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies Abstract Background: Cardiovascular diseases account for the largest fraction of smoking-induced

More information

Supplemental Material

Supplemental Material Supplemental Material The metabolic syndrome, inflammation and colorectal cancer risk; an evaluation of large panels of plasma protein markers using repeated, prediagnostic samples Sophia Harlid, Robin

More information

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D ) 1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo

More information

The Role of Microenvironment in the Control of Tumor Angiogenesis

The Role of Microenvironment in the Control of Tumor Angiogenesis The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,

More information

Instant ELISA Kits. Accelerate Time to Result

Instant ELISA Kits. Accelerate Time to Result Instant ELISA Kits Accelerate Time to Result High quality by design equals performance. 1 Our ELISA portfolio provides you with a complete offering of kits with a reputation of: High sensitivity Reliable

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures.

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures. TNF-alpha ELISA For the quantitative determination of TNF-alpha in serum, plasma, buffered solution or cell culture medium. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number:

More information

MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration

MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration Units: pg/ml pg/ml pg/ml pg/ml Assay Name RnD Systems Millipore Magnetic Hormone ELISA Adipokine Panel 2 Panel Catalog Number DCP HADK2MAG-61K HCYTOMAG-6K HMHMAG-34K EGF, FGF-2, Eotaxin, TGF-a, G-CSF,

More information

RayBio Human Thyroglobulin ELISA Kit

RayBio Human Thyroglobulin ELISA Kit RayBio Human Thyroglobulin ELISA Kit Catalog #: ELH-Thyroglobulin User Manual Last revised July 6, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite

More information

DKK-1 ELISA, Cat.No. BI For the quantitative determination of DKK-1 in human serum

DKK-1 ELISA, Cat.No. BI For the quantitative determination of DKK-1 in human serum DKK-1 ELISA, Cat.No. BI-20413 For the quantitative determination of DKK-1 in human serum ASSAY CHARACTERISTICS Method Standard range Conversion factor Sample volume / well Incubation time, temp. Sensitivity

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Willeit K, Pechlaner R, Willeit P, et al. Association between vascular cell adhesion molecule 1 and atrial fibrillation. JAMA Cardiol. Published online March 2, 2017. doi:10.1001/jamacardio.2017.0064

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic

Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic September 9, 2017 Patricia W Bedard, Jason Lapetoda, Jagadeesha Dammanahalli, Jessica Van Allen, Susan Lin, Lee Landeen

More information

RayBio Human ENA-78 ELISA Kit

RayBio Human ENA-78 ELISA Kit RayBio Human ENA-78 ELISA Kit Catalog #: ELH-ENA78 User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,

More information

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma P909 Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma Tedeschi R, Bidoli E 2, Bortolin MT, Pratesi C, Basaglia G, Zanussi

More information

Genetics and Cancer Ch 20

Genetics and Cancer Ch 20 Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)

More information

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Dr. Markus Ehrat Mr. Markus Tobler Zeptosens A Division of Bayer (Schweiz) AG Benkenstr. 254 CH-4108 Witterswil Switzerland

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive TECHNICAL NOTE Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive In this technical note you will learn about: Step-by-step set-up of parallel reaction monitoring (PRM)

More information

Dilution Factor Serum Plasma Urine CSF (Other)

Dilution Factor Serum Plasma Urine CSF (Other) R-PLEX s and Assay/Antibody Combinations The tables below provide the dilution factors and primary diluent combinations for samples tested with R-PLEX s. These dilution factors and diluent combinations

More information

USING THE ACCESS AMH ASSAY IN YOUR LABORATORY

USING THE ACCESS AMH ASSAY IN YOUR LABORATORY INFORMATION BULLETIN USING THE ACCESS AMH ASSAY IN YOUR LABORATORY ///////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////

More information

Evaluation Report: Eurolyser CRP test (ST0100 and ST0102) on. CUBE analyser (CA0100)

Evaluation Report: Eurolyser CRP test (ST0100 and ST0102) on. CUBE analyser (CA0100) Evaluation Report: Eurolyser CRP test (ST0100 and ST0102) on CUBE analyser (CA0100) Location Location: Eurolyser Diagnostica GmbH Operators: Simone Wieser; Franz Helminger; Michael Gruber Date: July-November

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

ProcartaPlex multiplex immunoassays for the Luminex platform

ProcartaPlex multiplex immunoassays for the Luminex platform ProcartaPlex multiplex immunoassays for the Luminex platform Get exactly the panel you want Optimize your research with ProcartaPlex multiplex immunoassays What would the ability to simultaneously quantitate

More information

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes

More information

Speciality and Research Controls

Speciality and Research Controls Controls Speciality and Research Product Range Product Antimicrobial Array 1 Plus Control 3 x 1 ml AMC5084 Antimicrobial Control II 3 x 1 ml AMC5035 Antimicrobial Control III 3 x 1 ml AMC5036 Growth Promoter

More information

Cytokines and Growth Factors

Cytokines and Growth Factors Cytokines and Growth Factors Cytokines are a category of signalling proteins and glycoproteins that, like hormones and neurotransmitters, are used extensively in cellular communication. While hormones

More information

Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer

Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer Original Article Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer Hongyan Huang, Yanbin Zhang, Sha Li, Jing Zhao, Xiaoli

More information

Hepatic Inflammation and Cellular Therapy

Hepatic Inflammation and Cellular Therapy Hepatic Inflammation and Cellular Therapy Lee K. Landeen, Jessica Van Allen, Patricia W. Bedard Vital Therapies, Inc., San Diego, CA, USA Alcoholic Hepatitis: Role of Inflammation Inflammatory Mediators

More information

HbA1c (Human) ELISA Kit

HbA1c (Human) ELISA Kit HbA1c (Human) ELISA Kit Cat. No.:DEIA3509 Pkg.Size:96T Intended use GHbA1c (Human) ELISA Kit is a sandwich enzyme immunoassay for the quantitative measurement of human GHbA1c. General Description vhemoglobin,

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p

More information

9607 Dr. Perry Road Suite 103. Ijamsville, MD Tel: (301) Fax: (301) Ultrasensitive Samoa Human IL-33 Immunoassay

9607 Dr. Perry Road Suite 103. Ijamsville, MD Tel: (301) Fax: (301) Ultrasensitive Samoa Human IL-33 Immunoassay AssayGate, Inc. 9607 Dr. Perry Road Suite 103. Ijamsville, MD 21754. Tel: (301)874-0988. Fax: (301)560-8288. Ultrasensitive Samoa Human IL-33 Immunoassay INTRODUCTION Interleukin-33 (IL-33), a cytokine

More information

Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents

Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents 2016 SomaLogic, Inc. Florence Pinet, Inserm UMR1167, Univ Lille, Ins?tut Pasteur de Lille, Lille - FRANCE florence.pinet@pasteur-

More information

LDL (Human) ELISA Kit

LDL (Human) ELISA Kit LDL (Human) ELISA Kit Cat. No.:DEIA3864 Pkg.Size:96T Intended use This immunoassay kit allows for the specific measurement of human low density lipoprotein, LDL concentrations in cell culture supernates,

More information

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018 Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect

More information

Rat Mullerian Inhibiting Substance/Anti-Mullerian hormone, MIS/AMH ELISA kit

Rat Mullerian Inhibiting Substance/Anti-Mullerian hormone, MIS/AMH ELISA kit Rat Mullerian Inhibiting Substance/Anti-Mullerian hormone, MIS/AMH ELISA kit Catalog No. E0228r (96 tests) Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS!

More information

Colorectal cancer - CEA

Colorectal cancer - CEA Colorectal cancer - CEA What is carcinoembryonic antigen? Human carcinoembryonic antigen (CEA) (MW = 175000 200000 g/mol) is a glycoprotein involved in cell adhesion. It is normally produced during fetal

More information

The Adiponectin Turbidimetric Immunoassay Reagent Kit

The Adiponectin Turbidimetric Immunoassay Reagent Kit The Adiponectin Turbidimetric Immunoassay Reagent Kit Catalogue number: 51010 For the quantitative determination of Adiponectin in human serum and plasma This package insert must be read in its entirety

More information

GSI Canine IL-5 ELISA Kit-2 Plates DataSheet

GSI Canine IL-5 ELISA Kit-2 Plates DataSheet Interleukin5 (IL5) is a secreted glycoprotein that belongs to the α-helical group of cytokines (1, 2, 3). Unlike other family members, it is present as a covalently linked antiparallel dimer (4, 5). IL-5

More information

BNP Fragment EIA (Cat.No. BI-20852W) For the Determination of BNP Fragment in Human Samples

BNP Fragment EIA (Cat.No. BI-20852W) For the Determination of BNP Fragment in Human Samples BNP Fragment EIA (Cat.No. BI-20852W) For the Determination of BNP Fragment in Human Samples ASSAY CHARACTERISTICS Method Competitive Enzyme Immunoassay, HRP/TMB. Microtiter plates are coated with a polyclonal

More information

ProcartaPlex Multiplex Immunoassays

ProcartaPlex Multiplex Immunoassays ProcartaPlex Immunoassay ProcartaPlex Multiplex Immunoassays Get exactly the panel you want What would the ability to simultaneously quantitate more than 60 cytokines or other soluble biomarkers from a

More information

human Total Cathepsin B Catalog Number: DY2176

human Total Cathepsin B Catalog Number: DY2176 human Total Cathepsin B Catalog Number: DY2176 This DuoSet ELISA Development kit contains the basic components required for the development of sandwich ELISAs to measure natural and recombinant human Total

More information

Human Leptin ELISA Kit

Human Leptin ELISA Kit Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone

More information

Insulin (Porcine/Canine) ELISA

Insulin (Porcine/Canine) ELISA Insulin (Porcine/Canine) ELISA For the quantitative measurement of insulin in Porcine/Canine serum and plasma (EDTA) For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number: 80-INSPO-E01

More information

A Phase I Study of RO , a γ-secretase Inhibitor of Notch Signaling, in Patients with Refractory Metastatic or Locally Advanced Solid Tumors

A Phase I Study of RO , a γ-secretase Inhibitor of Notch Signaling, in Patients with Refractory Metastatic or Locally Advanced Solid Tumors A Phase I Study of RO4929097, a γ-secretase Inhibitor of Notch Signaling, in Patients with Refractory Metastatic or Locally Advanced Solid Tumors Tolcher, et al Data Supplement 1 ONLINE APPENDIX Appendix

More information

To compare the relative amount of of selected gene expression between sham and

To compare the relative amount of of selected gene expression between sham and Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter

More information

Insulin ELISA. For the quantitative determination of insulin in serum and plasma

Insulin ELISA. For the quantitative determination of insulin in serum and plasma Insulin ELISA For the quantitative determination of insulin in serum and plasma For In Vitro Diagnostic use within the United States of America. This product is for Research Use Only outside of the United

More information

2 Screen Islet Cell Autoantibody Human ELISA

2 Screen Islet Cell Autoantibody Human ELISA 2 Screen Islet Cell Autoantibody Human ELISA Cat. No.:DEIA4453 Pkg.Size:96T Intended use The 2 Screen Islet Cell autoantibody (2 Screen) ELISA kit is intended for use by professional persons only, for

More information

Automated and Standardized Counting of Mouse Bone Marrow CFU Assays

Automated and Standardized Counting of Mouse Bone Marrow CFU Assays Automated and Standardized Counting of Mouse Bone Marrow CFU Assays 2 Automated and Standardized Colony Counting Table of Contents 4 Colony-Forming Unit (CFU) Assays for Mouse Bone Marrow 5 Automated Assay

More information

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57 Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

More information

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

More information

Mercodia Equine Insulin ELISA

Mercodia Equine Insulin ELISA Mercodia Equine Insulin ELISA Directions for Use 10-1205-01 REAGENTS FOR 96 DETERMINATIONS Manufactured by Mercodia AB Sylveniusgatan 8A SE-754 50 Uppsala Sweden EXPLANATION OF SYMBOLS USED ON LABELS =

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of rat TNF-alpha concentrations in cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity

More information

S4. Summary of the GALNS assay validation. Intra-assay variation (within-run precision)

S4. Summary of the GALNS assay validation. Intra-assay variation (within-run precision) S4. Summary of the GALNS assay validation (i.) Intra-assay variation (within-run precision) Intra-assay variation was determined by measuring standard blood samples (low activity standard; medium activity

More information

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human TNF-alpha in serum, plasma and cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity

More information

Growth Factors. BIT 230 Walsh Chapter 7

Growth Factors. BIT 230 Walsh Chapter 7 Growth Factors BIT 230 Walsh Chapter 7 3 Definitions Autocrine: a mode of hormone action in which a hormone affects the function of the cell type that produced it. Paracrine: Relating to the release of

More information

Technical Bulletin No. 162

Technical Bulletin No. 162 CPAL Central Pennsylvania Alliance Laboratory Technical Bulletin No. 162 cobas 6800 HCV Viral Load Assay - New Platform - June 1, 2017 Contact: Heather Habig, MLS (ASCP) CM, MB CM, 717-851-1422 Operations

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity

More information

Insulin ELISA. For the quantitative determination of insulin in serum and plasma.

Insulin ELISA. For the quantitative determination of insulin in serum and plasma. Insulin ELISA For the quantitative determination of insulin in serum and plasma. For In Vitro Diagnostic use within the United States of America. This product is for Research Use Only outside of the United

More information

Mouse C-Peptide ELISA Kit

Mouse C-Peptide ELISA Kit Mouse C-Peptide ELISA Kit Cat.No: DEIA4507 Lot. No. (See product label) Size 96T Intended Use The Mouse C-Peptide ELISA kit is for the quantitative determination of c-peptide in mouse serum, plasma, and

More information

Basis of Immunology and

Basis of Immunology and Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie

More information

Morinaga Mouse C-peptide ELISA Kit

Morinaga Mouse C-peptide ELISA Kit Morinaga Mouse C-peptide ELISA Kit For the quantitative determination of C-peptide in mouse serum, plasma, and fluid 96wells For Laboratory Use Only, not for use in diagnostic procedure Please read full

More information

Technical Bulletin No. 161

Technical Bulletin No. 161 CPAL Central Pennsylvania Alliance Laboratory Technical Bulletin No. 161 cobas 6800 HIV-1 Viral Load Assay - New Platform - June 1, 2017 Contact: Heather Habig, MLS (ASCP) CM, MB CM, 717-851-1422 Operations

More information

Human C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-cell Expressed and Secreted (CCL5 / RANTES) Kit

Human C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-cell Expressed and Secreted (CCL5 / RANTES) Kit TECHNICAL DATA SHEET AlphaLISA Research Reagents Caution: For Laboratory Use. A research chemical for research purposes only. Human C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-cell Expressed

More information

basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman

basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman D15001 C-60014 Angiopoietin 1 (HeLa cell-derived), (Ang-1), rhuman 20 µg 32,000 D15002 C-60016 Apolipoprotein A1, (APO-A1), rhuman 100 µg 32,000 D15003 C-60017 Apolipoprotein E2, (APO-E2), rhuman 500 µg

More information

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes

More information

Mouse Leptin ELISA Kit Instructions

Mouse Leptin ELISA Kit Instructions V.6/Mar/2008 CRYSTAL CHEM INC. Mouse Leptin ELISA Kit Instructions For the quantitative determination of leptin in mouse serum or plasma and fluid Catalog #: 90030 96 Assays For Research Use Only. Not

More information

02006B 1 vial 02006B 1 vial Store at -20 C. Lyophilized recombinant IL-2

02006B 1 vial 02006B 1 vial Store at -20 C. Lyophilized recombinant IL-2 For detection and measurement of human interleukin 2 Catalog #02006 Catalog #02007 2 Plates 10 Plates Product Description The Human Interleukin 2 (IL-2) ELISA Kit is designed for the quantitative detection

More information

Design Verification IMTEC-TSH R -A C Intended Use... 2 Diagnostic Sensitivity and Diagnostic Specificity... 2 Interferences... 4 Imprecision...

Design Verification IMTEC-TSH R -A C Intended Use... 2 Diagnostic Sensitivity and Diagnostic Specificity... 2 Interferences... 4 Imprecision... Design Verification IMTEC-TSH RECEPTOR-ANTIBODIES CONTENTS 1 Intended Use... 2 2 Diagnostic Sensitivity and Diagnostic Specificity... 2 2.1 Determination of Diagnostic Sensitivity and Diagnostic Specificity...

More information

Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones

Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones Cytokines Luděk Šefc Cytokines Protein regulators of cellular communication Cytokines x hormones Hormones Cytokines Production sites few many Cell targets few many Presence in blood yes rarely Biological

More information

EliKine Free Thyroxine (ft4) ELISA Kit

EliKine Free Thyroxine (ft4) ELISA Kit EliKine Free Thyroxine (ft4) ELISA Kit Booklet Item NO. KET0005 Product Name EliKine Free Thyroxine (ft4) ELISA Kit ATTENTION For laboratory research use only. Not for clinical or diagnostic use TABLE

More information

Chapter 11 CYTOKINES

Chapter 11 CYTOKINES Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune

More information

Porcine/Canine Insulin ELISA

Porcine/Canine Insulin ELISA Porcine/Canine Insulin ELISA For the quantitative determination of insulin in porcine or canine serum and plasma. Please read carefully due to Critical Changes, e.g., Calculation of Results. For Research

More information

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH ALETA A SOURCE OF 1,3-BETA GLUCANS Aleta is highly bioavailable, offering a concentration greater than 5% of 1,3-beta glucans. Aleta provides a consistent response

More information

Tumor Associated Macrophages as a Novel Target for Cancer Therapy

Tumor Associated Macrophages as a Novel Target for Cancer Therapy Tumor mass Tumor Associated Macrophage Tumor Associated Macrophages as a Novel Target for Cancer Therapy This booklet contains forward-looking statements that are based on Amgen s current expectations

More information

RFE MEMO. The expiration dates for the following kit components have also been extended: A May 2021 Same as Original

RFE MEMO. The expiration dates for the following kit components have also been extended: A May 2021 Same as Original Page 1 of 1 RFE MEMO Product Description(s): V-PLEX and V-PLEX Plus Proinflammatory Panel 2 (rat) Kit Catalog Number(s) / Size(s): K15059-series Lot Number: K0080651 Based on additional testing, the original

More information

Global Headquarters 86 Cummings Park Woburn, MA Tel:

Global Headquarters 86 Cummings Park Woburn, MA Tel: Human IL-2 ELISA Kit Cat:RK00002 This ELISA kit used for quantitation of human interleukin 2 (IL-2) concentration in cell culture supernate, serum and plasma. For research use only, and it s highly recommended

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

Hyaluronan Quantification Kit

Hyaluronan Quantification Kit Product manual (ELISA-like assay for HA / Hyaluronic Acid) Updated on Jan. 6th, 207 - Background Hyaluronan (HA) is an unbranched glycosaminoglycan composed of repeating disaccharide units of D-glucronic

More information

liquicolor (AMP Buffer, IFCC) Design Verification

liquicolor (AMP Buffer, IFCC) Design Verification Design Verification (AMP Buffer, IFCC) liquicolor 1 Introduction... 2 2 Imprecision... 2 3 arity and Detection Limit... 2 3.1 arity... 2 3.2 Detection Limit... 3 4 Comparison of Methods... 3 5 Stability...

More information

Canine Thyroid Stimulating Hormone, TSH ELISA Kit

Canine Thyroid Stimulating Hormone, TSH ELISA Kit Canine Thyroid Stimulating Hormone, TSH ELISA Kit Catalog No: E0463c 96 Tests Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS! PLEASE READ THROUGH

More information

CTLA-4 (Human) AlphaLISA Detection Kit

CTLA-4 (Human) AlphaLISA Detection Kit TECHNICAL DATA SHEET AlphaLISA Research Reagents Research Use Only. Not for use in diagnostic procedures. CTLA-4 (Human) AlphaLISA Detection Kit Product No.: AL3050 Contents Product Information... 2 Quality

More information

Accuracy and Precision. Intra- and inter-assay accuracy and precision for both rifapentine

Accuracy and Precision. Intra- and inter-assay accuracy and precision for both rifapentine Supplemental Materials Assay Validation Methods Accuracy and Precision. Intra- and inter-assay accuracy and precision for both rifapentine (RPT) and desacetyl-rifapentine (desrpt) were determined through

More information

Immunoassays LEGENDplex & ELISA Kits

Immunoassays LEGENDplex & ELISA Kits Immunoassays LEGENDplex & ELISA Kits BioLegend is ISO 13485:2003 Certified Toll-Free Tel: (US & Canada): 1.877.BIOLEGEND (246.5343) Tel: 858.768.5800 biolegend.com 02-0017-00 World-Class Quality Superior

More information

Official Journal of the European Communities COMMISSION

Official Journal of the European Communities COMMISSION 16.5.2002 EN Official Journal of the European Communities L 131/17 COMMISSION COMMISSION DECISION of 7 May 2002 on common technical specifications for in vitro-diagnostic medical devices (notified under

More information

Tissue repair. (3&4 of 4)

Tissue repair. (3&4 of 4) Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

More information