TKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection
|
|
- Basil Evans
- 6 years ago
- Views:
Transcription
1 TKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection Amy Lee, Arbutus Biopharma DIA/FDA Oligonucleotide-Based Therapeutics Conference September 9 Washington, DC
2 Disclaimer The views and opinions expressed in the following PowerPoint slides are those of the individual presenter and should not be attributed to DIA, its directors, officers, employees, volunteers, members, chapters, councils, Communities or affiliates, or any organization with which the presenter is employed or affiliated. These PowerPoint slides are the intellectual property of the individual presenter and are protected under the copyright laws of the United States of America and other countries. Used by permission. All rights reserved. DIA and the DIA logo are registered trademarks or trademarks of Drug Information Association Inc. All other trademarks are the property of their respective owners DIA, Inc. All rights reserved.
3 Chronic HBV Global Unmet Medical Need 350M people chronically infected with HBV 780K people die every year as a consequence of HBV Approved treatments control viral load but do not cure the infection 3
4 TKM-HBV Therapeutic Objective The goal of TKM-HBV is to facilitate the loss of HBV surface antigen (HBsAg) in chronic HBV patients by: Reducing levels of HBV surface antigen by inhibiting its production (not simply blocking secretion) HBsAg is thought to promote host immune tolerance of the virus Thus its removal should promote immune recognition and viral clearance Inhibiting production and function of all other Hepatitis B proteins & viral RNAs, including the replication intermediate Use in combination with other anti-hbv therapeutics including nucleos(t)ide (NUC) standard of care or investigational drugs (e.g., core protein inhibitors) 4
5 RNA Interference Approach to Chronic HBV A Distinct and Complementary Mechanism of Action NUC intervenes at pregenomic RNA conversion to HBV genomic DNA NUC do not inhibit production of viral proteins incl. HBsAg Anti-HBV sirna intervenes by cleaving viral mrna & pgrna reducing production of all HBV proteins (HBsAg, HBcAg, HBeAg, polymerase, HBxAg) 5
6 Arbutus Lipid Nanoparticle Delivery Platform Enabling Nucleic Acid Based Therapeutics LNP encapsulate, protect and deliver the drug payload Enables efficient cellular uptake and intracellular release Payload types: sirna, UsiRNA mrna, mirna etc 6
7 7
8 Accumulated LNP Experience in Human Eight Products have Entered the Clinic Since 2008 Representative Ongoing Clinical Activity Product Company Phase Indication Comments ALN-TTR02 Alnylam 3 Amyloidosis Potent pharmacodynamic effect demonstrated, well tolerated TKM-PLK1 Arbutus 2 Oncology Promising signs of RNAi drug activity TKM-Ebola-Guinea Arbutus 2 Ebola infection Strong survival benefit in primates with high pre-existing viral titres 9 th product IND application filed recently (DCR-PH1 for primary hyperoxaluria, Dicerna) > 250 patients treated w/ sirna-lnp, some with repeat-dosing for >1 year Potent, long lasting effects after a single dose Continually growing body of clinical safety data since 2008 LNP enabled RNAi drugs have strong clinical validation 8
9 Established cgmp Manufacturing Expertise Controlled self assembly Highly scalable to kgs Lyophilizable Efficient Consistent particle size Particle Formation Skid in Arbutus cgmp Facility (suitable for 100g+ batches) 9
10 Rationale for RNAi Approach to Treatment of Chronic HBV LNP Technology Platform for RNAi Trigger Delivery TKM-HBV Drug Design Preclinical Pharmacology Clinical Development & Future Directions 10
11 Targeting Multiple Hepatitis B Viral Transcripts Primary target is HBsAg cccdna sirna sites that target 3 viral transcripts sirna site that targets all 4 transcripts RNAi-mediated cleavage anywhere along 2.1/2.4 kb mrnas will destroy sag transcripts All lead triggers target the sag 2.1/2.4 kb mrnas Triggers also cleave 3.5 kb and 0.7 kb mrna and pgrna with potential for additional therapeutic benefit by reducing HBc, HBe & HBx Inclusion of 3 RNAi triggers allows for broad knock down of all viral antigens, pan-genotypic activity, and mitigation of viral resistance 11
12 Advantages of a Multi-Trigger Approach Single-Trigger Selection of Resistant Mutants in WHV Model Normalized individual results Group geometric means Doses: Doses: 2-log knockdown of viral DNA achieved with single-trigger siwhs siwhx less effective, but more sustained effect Rapid viral recrudescence while on repeat-dose sirna therapy Evaluated sirna target sites for changes that could confer resistance Collaboration with Bristol-Myers Squibb 12
13 Advantages of A Multi-Trigger Approach Sequencing Identifies Potential Resistance Mutations Effect of single-trigger siwhs not sustained through dosing period Viral DNA was extracted from all siwhs- and siluc-treated animals at Days 0 and 28 and sequenced across the siwhs target site Animal sirna Day 0 Sequence at siwhs Target Site Day 28 Sequence at siwhs Target Site 6193 siluc ACAACAGTCAATTGCAGACAA ACAACAGTCAATTGCAGACAA 6721 siluc ACAACAGTCAATTGCAGACAA ACAACAGTCAATTGCAGACAA 6539 siwhs ACAACAGTCAATTGCAGACAA ACAACARTMAMTTGCAGACAA 6323 siwhs ACAACAGTCAATTGCAGACAA ACAACADYMAMTTGCAGACAA 6597 siwhs ACAACAGTCAATTGCAGACAA ACAACADTMAMTTGCAGACAA Multiple mutations in siwhs target site present in all siwhs-treated animals at Day 28, but not in any other animals Mutations in siwhx target site were not detected in any animals, consistent with continued effects of siwhx throughout the dosing period Collaboration with Bristol-Myers Squibb 13
14 Rationale for RNAi Approach to Treatment of Chronic HBV LNP Technology Platform for RNAi Trigger Delivery TKM-HBV Drug Design Preclinical Pharmacology Clinical Development & Future Directions 14
15 TKM-HBV Targets All Hepatitis B Genotypes Triggers selected from regions of high conservation in viral genome Increased universality by combining 2+ UsiRNA Genotype A B C D E F G H A-D A-H Trigger 1 % Target Trigger 2 Sites w/ Conserved Trigger 3 Core Each chosen target site is conserved in 94% known HBV genomes 3-trigger cocktail has 1 perfect match to 99.8% of viral genomes 15
16 TKM-HBV Acts Against Multiple Genotypes Infected Primary Human Hepatocyte Model 120 Genotype A 120 Genotype B Untreated Luc-LNP HBsAg as % Untreated HBsAg as % Untreated % 20-96% TKM-HBV 0 0 Entecavir 120 Genotype C 120 Genotype D HBsAg as % Untreated HBsAg as % Untreated % 20-98%
17 Verification of Molecular Mechanism of Action HBV mrna Silencing in HepDE19 Stably Transfected Cell Model Site-specific cleavage of viral RNA by TKM-HBV confirmed using 5 -RACE PCR 3.5 kb 2.4 kb 2.1 kb 0.7 kb HBV transcripts 5 RACE Assay for Target Site 1 UsiRNAs cleave HBV RNAs at target sites 5 RACE Assay for Target Site 2 5 RACE Assay for Target Site 3 PCR-amplified product is of expected size Verified exact mrna cleavage locations via direct & clonal sequencing 17
18 Verification of Molecular Mechanism of Action HBV mrna silencing in HDI Mouse and HepDE19 Cells >90% silencing of viral mrna with rapid onset Strong effect on 2.1/2.4 kb mrnas encoding sag, as well as other transcripts % Untreated Hepatic mrna bdna assay Hepatic HBV mrnas (all) Hepatic 3.5 kb RNA Probe Set 1 (Blue curve) Northern Blot kb 2.4 kb 2.1 kb 3.5 kb 2.4 kb 2.1 kb 0.7 kb Probe Set 2 (maroon curve) 1 Non targeting control 2 Cocktail 1,2,3 3 UsiRNA 1 4 UsiRNA 2 5 UsiRNA 3 HBV transcripts Day 18s rrna 18
19 Rapid Onset of Action Hepatic mrna Hepatic Protein Secreted Viral Particles Hepatic HBV mrnas (all) Hepatic HBV RNAs (3.5 kb) 100 Hepatic HBsAg (ELISA) Hepatic HBcAg (IHC) 100 Serum HBsAg Serum HBV DNA % Untreated % Untreated Core protein inhibition in IHC images on next slide % Untreated Day Day Day Reductions of target mrna and downstream viral products within 1+ days 19
20 Rapid Onset of Action Hepatic HBV Surface Ag Day 0 Day 1 Day 7 Day 14 Hepatic HBV Core Ag Day 0 Day 1 Day 7 Day 14 Intrahepatic HBV surface and core antigen reductions detected by IHC Reduction of intracellular surface Ag is rapid (nadir at Day 1) followed by core Ag (nadir at Day 7) 200 μm 20
21 Validation of RNAi-LNP Approach in Chimpanzee Human HBV has narrow host range Efficient infection well-documented only for human and chimpanzee Δ HBsAg (log 10 pg/ml) (relative to Day 0) Single sirna-lnp dose at iv 0.25 mg/kg to 1 log decrease in sag 1 to 2 log decrease in viral titre 1 to 2 month duration of effect Normalized Serum sag HBV sirna -LNP Days Control sirna -LNP 4 chimpanzees studied; some interpretation challenges, widely variable titres A B C D Δ Viral Load (log 10 copies/ml) (relative to day 0) Normalized Viral Titre HBV sirna -LNP 21 Control sirna -LNP A B C D Days Sepp-Lorenzino et al. Sirna Therapeutics Merck Alnylam
22 Antiviral Activity in HBV-Infected Chimeric Mouse TKM-HBV Inhibits HBV Antigens and Viral Replication Removes viral products from peripheral and intracellular compartments Viral cccdna is reduced by TKM-HBV Serum HBsAg as % Baseline Treatments Untreated Serum HBsAg TKM-HBV 0.3 mg/kg Day % Untreated at Day Serum eag -75% Day 32 % Untreated at Day Liver HBV DNA cccdna Liver Serum Day 42 22
23 Antiviral Activity in HBV-Infected Chimeric Mouse TKM-HBV Inhibits HBV Antigens and Viral Replication Removes viral products from peripheral and intracellular compartments Saline Control Luc-LNP TKM-HBV Liver surface Ag Liver core Ag 23
24 TKM-HBV Complements NUC Standard of Care No antagonism of either drug action in infected chimeric mice Serum HBV DNA Serum HBsAg Serum HBV DNA as % Baseline) Saline Entecavir, daily oral TKM-HBV, weekly iv Entecavir + TKM-HBV Daily Entecavir Treatment S erum HB sag as % Baseline Saline Entecavir, daily oral TKM-HBV, weekly iv Entecavir + TKM-HBV Daily Entecavir Treatment Day Weekly LNP Day LNP 24
25 TKM-HBV Preclinical Pharmacology Summary Advantages of 3-trigger approach: Multi-component payload combines strengths of individual triggers Inhibits replication, reduces HBV DNA, sag, eag, cag and cccdna Increases universality in diverse patient populations, across genotypes Reduces potential for anti-viral resistance RNAi drug mechanism of action is well -characterized Complementary to NUC standard of care, works well in combination Well-validated LNP delivery technology Clinical experience from multiple programs, incl. repeat-dosing > 1 yr POC in chimpanzee model of chronic HBV using earlier-generation LNP TKM-HBV uses 3rd-gen LNP formulation technology with improved potency 25
26 TKM-HBV Program Clinical Development: Phase 1 SAD study in healthy volunteers (Canada) ongoing Phase 2a MAD study in HBV patients taking NUCs Next Steps: Explore combinations with established and investigational drug classes 26
27 Arbutus HBV Development Pipeline Addressed HBV Persistence Factor* Stage of Development Candidate/Program HBV Replication Inhibition Immune System Stimulation/ Reactivation cccdna Formation Inhibition/ Elimination Research Lead Optimization Preclinical IND Enabling Phase I TKM-HBV (RNAi) TKM-PLK1** (RNAi) OCB-030 (Cyclophilin Inhibitor) CYT003 (TLR9 Agonist) cccdna Formation Inhibitor Surface Antigen Secretion Inhibitor Core Protein/Capsid Assembly Inhibitors (2 Candidates) cccdna Epigenetic Modifier STING Agonist *Darker colored circles denote most pronounced activity of candidate/program **TKM-PLK1 is currently undergoing evaluation in Phase I/II clinical trials for oncology indications GI-NET/ACC and HCC. 27
28 Our Strategy All Needed Assets Under One Roof HBV biology is more complex than HCV Curative therapy requires a combination to overcomes three pillars of viral persistence: 1. Replicating continually in liver hepatocytes 2. Expressing viral antigens that suppress the patients immune response 3. Establishing stable cccdna reservoir in nucleus Our unique set of assets allow for efficient development of drug combinations acting by complementary mechanisms of action Suppress Viral Replication Reactivate/ Stimulate the Immune System Eliminate cccdna Near term-goal: Increase cure rates with finite dosing duration Ultimate goal: All oral curative regimen To succeed in achieving an HBV Cure, all facets of HBV persistence need to be addressed 28
29 Acknowledgements Contributing Scientists Emily Thi Ammen Dhillon Xin Ye Luying Pei Nicholas Snead Janet Phelps Alice Li Jennifer Cross Trisha Barnard Sandie Du Ian MacLachlan LNP Formulation Chemistry James Heyes Bristol-Myers Squibb Siew Ho Scott Balsitis Steven Levine Joe Baldick Dan Tenney With support from many other parts of the Arbutus (formerly Tekmira) organization 29
30 Ask
RNA Interference: A New Tool in the Toolbox for Treatment of HBV. Discovery On Target Senior Director, Research 25 September 2017
RNA Interference: A New Tool in the Toolbox for Treatment of HBV Amy Lee Discovery On Target Senior Director, Research 25 September 2017 Arbutus Biopharma Boston, MA NASDAQ: ABUS www.arbutusbio.com Chronic
More informationRNAi Therapy for Chronic HBV Infection
RNAi Therapy for Chronic HBV Infection Bill Symonds, PharmD Chief Development Officer October 2017 NASDAQ: ABUS www.arbutusbio.com Forward Looking Statements This presentation contains forward-looking
More informationA Leading HBV Therapeutics Company. Corporate Overview August 2017
A Leading HBV Therapeutics Company Corporate Overview August 2017 NASDAQ: ABUS www.arbutusbio.com Forward Looking Statements This presentation contains forward-looking statements within the meaning of
More informationALN-HBV. Laura Sepp-Lorenzino November 11, Alnylam Pharmaceuticals, Inc.
ALN-HBV Laura Sepp-Lorenzino November 11, 2016 2016 Alnylam Pharmaceuticals, Inc. 1 N-Acetyl Galactosamine (GalNAc) sirna Conjugates Subcutaneous Investigational RNAi Therapeutics 5 -sense 5 -AS ASGPR
More informationCombination Therapy for Curing HBV. Michael J. Sofia Chief Scientific Officer April 22, 2016 CHI Antiviral Symposium, San Diego, CA
Combination Therapy for Curing HBV Michael J. Sofia Chief Scientific Officer April 22, 2016 CHI Antiviral Symposium, San Diego, CA NASDAQ: ABUS www.arbutusbio.com Forward Looking Statements This presentation
More informationR&D Webinar: Product Pipeline Update
R&D Webinar: Product Pipeline Update Dr. Mark Murray, President & CEO Dr. Mark Kowalski, Chief Medical Officer Dr. Ian MacLachlan, Chief Scientific Officer Ian Mortimer, Executive Vice President Bruce
More informationCombination Therapy for Curing HBV
Combination Therapy for Curing HBV Michael J Sofia Chief Scientific Officer June 1, 2016 GTC Bio 5 th Antiviral Research and Development Conference, San Diego, CA NASDAQ: ABUS www.arbutusbio.com Chronic
More informationKey to Therapeutic Success in HBV
Abstract # PS-027 Preclinical antiviral drug combination studies utilizing novel orally bioavailable agents for chronic hepatitis B infection: AB-506, a next generation HBV capsid inhibitor, and AB-452,
More informationDevelopment of subcutaneously administered RNAi therapeutic ARO-HBV for chronic hepatitis B virus infection
Development of subcutaneously administered RNAi therapeutic ARO-HBV for chronic hepatitis B virus infection Christine Wooddell, Rui Zhu, Holly Hamilton, Qili Chu, Heather Sternard, Joshua Schumacher, Thomas
More informationHepatitis B New Therapies
Hepatitis B New Therapies Richard K. Sterling, MD, MSc, FACP, FACG, FAASLD, AGAF VCU Hepatology Professor of Medicine Chief, Section of Hepatology Fellowship Director, Transplant Hepatology Virginia Commonwealth
More informationRNAi in HBV, the next backbone therapy for use in combinations? Bruce D. Given, MD COO, Arrowhead Pharmaceuticals L.I.F.E.R.
RNAi in HBV, the next backbone therapy for use in combinations? Bruce D. Given, MD COO, Arrowhead Pharmaceuticals L.I.F.E.R. October 20, 2017 Safe Harbor Statement This presentation contains forward-looking
More informationThe Evolution of sirna Therapeutics Targeting HBV at Arrowhead Pharmaceuticals. Sept 25, 2018
The Evolution of sirna Therapeutics Targeting HBV at Arrowhead Pharmaceuticals Sept 25, 2018 Disclosures I am an employee and shareholder in Arrowhead Pharmaceuticals, Inc. Safe Harbor Statement This presentation
More informationRobust Antiviral Activity in Chronic HBV Infected Chimpanzees by RNAi Treatment
Robust Antiviral Activity in Chronic HBV Infected Chimpanzees by RNAi Treatment Laura Sepp-Lorenzino, Daniel Freedman, Andrew Sprague, Martin Maier, Vasant Jadhav, Satya Kuchimanchi, Natalie Keirstead,
More informationHepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
More informationAre Immune Modulators Really Needed to Cure HBV infection?
Are Immune Modulators Really Needed to Cure HBV infection? Harry L.A. Janssen Francis Family Chair of Hepatology Director Toronto Centre for Liver Disease University Health Network University of Toronto,
More informationA Leading HBV Therapeutics Company Corporate Overview March 2018
A Leading HBV Therapeutics Company Corporate Overview March 2018 Forward-Looking Statements This presentation contains forward-looking statements within the meaning of Section 27A of the Securities Act
More informationArbutus Biopharma Corporation, Burnaby, Canada.
HBcrAg, HBV-RNA Declines in A Phase 2a Study Evaluating the Multi-Dose Activity of ARB-1467 in Positive and Negative Virally Suppressed Patients With Hepatitis B Kosh Agarwal 1, Ed Gane 2, Wendy Cheng
More informationInarigivir ACHIEVE Trial Results and HBV Clinical Program Update. August 2, 2018
Inarigivir ACHIEVE Trial Results and HBV Clinical Program Update August 2, 2018 FORWARD LOOKING STATEMENT This presentation includes forward-looking statements within the meaning of the Private Securities
More informationThe HBV pipeline and what the SIG can offer
The HBV pipeline and what the SIG can offer Current treatments and definition of cure Where can we get to with current therapies? Special interest group possibilities Where are we headed with HBV cure
More informationNew Drug Research for Chronic Hepatitis B Man-Fung Yuen, MD, PhD
New Drug Research for Chronic Hepatitis B Man-Fung Yuen, MD, PhD Department of Medicine. The University of Hong Kong, Queen Mary Hospital, Hong Kong OVERVIEW Emerging Drugs against HBV Direct-acting antiviral
More informationCorporate Overview H.C. Wainwright & Co. Global Life Sciences Conference April 10, 2018 Douglas M. Fambrough, CEO Jack Green, CFO
NASDAQ: DRNA Corporate Overview H.C. Wainwright & Co. Global Life Sciences Conference April 10, 2018 Douglas M. Fambrough, CEO Jack Green, CFO Forward looking statements This information may contain projections
More informationHepatitis B. HBV Cure: Insights for the Biotechnology and the Research Analyst Community November 11, Lalo Flores, PhD Global Head HBV R&D
Hepatitis B HBV Cure: Insights for the Biotechnology and the Research Analyst Community November 11, 2016 Lalo Flores, PhD Global Head HBV R&D Infectious Diseases Diseases Infectious 11 Janssen s Vision
More informationHBV Cure Definition and New Drugs in Development
HBV Cure Definition and New Drugs in Development Harry L.A. Janssen Francis Family Chair of Hepatology Director Toronto Centre for Liver Disease University Health Network University of Toronto, Canada
More informationHBV Treatment Pipeline: Prospects for a Cure. Marion Peters, MD UCSF San Francisco, CA
HBV Treatment Pipeline: Prospects for a Cure Marion Peters, MD UCSF San Francisco, CA HBV Control Inflammatory: normalize serum ALT, biopsy Virologic: decrease HBV DNA Immune: seroconversion HBeAg to anti-hbe
More informationBasics of hepatitis B diagnostics. Dr Emma Page MRCP MD(Res) Locum Consultant Sexual Health & Virology
Basics of hepatitis B diagnostics Dr Emma Page MRCP MD(Res) Locum Consultant Sexual Health & Virology Basics of hepatitis B diagnostics Background Epidemiology Morphology Life-cycle Diagnostic markers
More informationVirion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics
Hepadnaviruses Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Hepatitis viruses A group of unrelated pathogens termed hepatitis viruses cause the vast majority
More informationWhats new on HBsAg and other markers for HBV infection? Christoph Höner zu Siederdissen
Whats new on HBsAg and other markers for HBV infection? Christoph Höner zu Siederdissen Why diagnostic markers are important They are the basis for clinical decision makings treatment or no treatment?
More informationTargeting HBV Core Protein to Clear Infection and Achieve Higher Cure Rates
Targeting HBV Core Protein to Clear Infection and Achieve Higher Cure Rates Richard Colonno Executive Vice President and Chief Scientific Officer of Virology Operations 1 CAUTIONARY NOTE REGARDING FORWARD-LOOKING
More informationVarun Goel 1, Nathalie H Gosselin 2, Claudia Jomphe 2, Husain Attarwala 1, Xiaoping (Amy) Zhang 1, JF Marier 2, Gabriel Robbie 1
Population Pharmacokinetic (PK) / Pharmacodynamic (PD) Model of Serum Transthyretin (TTR) Following Patisiran Administration in Healthy Volunteers and Patients with Hereditary TTR-Mediated (hattr) Amyloidosis
More informationThe HBV capsid inhibitor AB-423 exhibits a dual mode of action and displays additive/synergistic effects in in vitro combination studies
The HBV capsid inhibitor AB-423 exhibits a dual mode of action and displays additive/synergistic effects in in vitro combination studies Rene Rijnbrand, PhD VP Biology Nagraj Mani, Andrew G. Cole, Andrzej
More informationCreating a Leading Global HBV Therapeutics Company. ARB-1467 Update Call December 12, 2016
Creating a Leading Global HBV Therapeutics Company ARB-1467 Update Call December 12, 2016 NASDAQ: ABUS www.arbutusbio.com Forward Looking Statements This presentation contains forward-looking statements
More informationA Next Generation HBV Capsid Inhibitor, AB-506: In Vitro and In Vivo Antiviral Characterization
Abstract #8 A Next Generation HBV Capsid Inhibitor, AB-506: In Vitro and In Vivo Antiviral Characterization Nagraj Mani PhD Arbutus Biopharma Inc. HEP DART 2017, Dec 3 7, 2017, Kona, Hawaii NASDAQ: ABUS
More informationRichard Colonno Executive Vice President and Chief Scientific Officer of Virology Operations
Targeting HBV Core Protein to Clear Infection and Achieve Higher Cure Rates Richard Colonno Executive Vice President and Chief Scientific Officer of Virology Operations 1 CAUTIONARY NOTE REGARDING FORWARD-
More informationCornerstones of Hepatitis B: Past, Present and Future
Cornerstones of Hepatitis B: Past, Present and Future Professor Man-Fung Yuen Queen Mary Hospital The University of Hong Kong Hong Kong 1 Outline Past Natural history studies Development of HBV-related
More informationHBV : Structure. HBx protein Transcription activator
Hepatitis B Virus 1 Hepatitis B Virus 2 Properties of HBV a member of the hepadnavirus group Enveloped, partially double-stranded DNA viruses, smallest DNA virus Replication involves a reverse transcriptase
More informationDisclosures. Grant: Arrowhead Pharmaceuticals
Prolonged RNA interference therapy with ARC-520 Injection in treatment naïve, HBeAg positive and negative patients with chronic HBV results in significant reductions of HBs antigen Man-Fung Yuen * 1, Kevin
More informationHepatitis B. ECHO November 29, Joseph Ahn, MD, MS Associate Professor of Medicine Director of Hepatology Oregon Health & Science University
Hepatitis B ECHO November 29, 2017 Joseph Ahn, MD, MS Associate Professor of Medicine Director of Hepatology Oregon Health & Science University Disclosures Advisory board Gilead Comments The speaker Joseph
More informationWhy do we need new HBV treatment and what is our definition for cure?
Why do we need new HBV treatment and what is our definition for cure? Harry L.A. Janssen Francis Family Chair of Hepatology Director Toronto Centre for Liver Disease University Health Network University
More informationUnderstanding HBV Testing: HBsAg, HBV RNA, cccdna, HBeAg and HBcrAg in Context of Antiviral Drug Development
Understanding HBV Testing: HBsAg, HBV RNA, cccdna, HBeAg and HBcrAg in Context of Antiviral Drug Development Professor Stephen Locarnini WHO Regional Reference Centre for Hepatitis B Victorian Infectious
More informationConsensus AASLD-EASL HBV Treatment Endpoint and HBV Cure Definition
Consensus AASLD-EASL HBV Treatment Endpoint and HBV Cure Definition Anna S. Lok, MD, DSc Alice Lohrman Andrews Professor in Hepatology Director of Clinical Hepatology Assistant Dean for Clinical Research
More information6/9/2015. Eugene R. Schiff, MD, MACP, FRCP, MACG, AGAF, FAASLD Director, Schiff Center for Liver Diseases University of Miami
Grant/Research Support: AbbVie, BMS, Gilead, Merck, Orasure Technologies, Roche Molecular, Janssen, Discovery Life Sciences, Beckman Coulter, Inc., Siemens Corporation, MedMira Inc., Conatus Eugene R.
More informationDicerna Pharmaceuticals Overview. Delivering RNAi-Based Breakthrough Therapies
Pharmaceuticals Overview Delivering RNAi-Based Breakthrough Therapies Forward-Looking Statements This information may contain projections and other forward looking statements regarding future events, including
More informationNew (Virological) Tools for Testing and Monitoring Hepatitis B and C
New (Virological) Tools for Testing and Monitoring Hepatitis B and C Professor Stephen Locarnini WHO Regional Reference Centre for Hepatitis B Victorian Infectious Diseases Reference Laboratory, Doherty
More informationNew therapeutic strategies in HBV patients
New therapeutic strategies in HBV patients Philippe HALFON MD, PhD Associate Professor of Medecine Internal Medecine and Infectious Diseases, Hopital Europeen, Marseille, France. NUC + PEG IFN, HBsAg Clearance
More informationPCSK9 RNAi Therapeutics. Kevin FitzGerald
PCSK9 RNAi Therapeutics Kevin FitzGerald Presenter Disclosure Information PSCK9 RNAi Therapeutics The following relationships exist related to this presentation:» Kevin Fitzgerald and Alnylam team members:
More informationHepatitis B and D Update on clinical aspects
Hepatitis B and D Update on clinical aspects B. Müllhaupt Gastroenterology and Hepatology Swiss Transplant and HPB-Center University Hospital Zurich beat.muellhaupt@usz.ch B.M. 11.11.17 Hepatitis Strategy
More informationRama Nada. - Malik
- 2 - Rama Nada - - Malik 1 P a g e We talked about HAV in the previous lecture, now we ll continue the remaining types.. Hepatitis E It s similar to virus that infect swine, so its most likely infect
More informationHepatitis B Virus infection: virology
Hepatitis B Virus infection: virology 167 Falk Symposium: Liver under constant attack from fat to viruses III Falk Gastro-Konferenz 17.-21. September 2008 Congress Centrum Mainz Maura Dandri Department
More informationDiagnostic Methods of HBV and HDV infections
Diagnostic Methods of HBV and HDV infections Zohreh Sharifi,ph.D Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine Hepatitis B-laboratory diagnosis Detection
More informationHepatitis B Cure: from discovery to regulatory endpoints in HBV clinical research A summary of the AASLD/EASL statement
Hepatitis B Cure: from discovery to regulatory endpoints in HBV clinical research A summary of the AASLD/EASL statement Fabien Zoulim Service d hépatologie, Hospices Civils de Lyon INSERM U1052, Cancer
More informationHBV Cure Overview of Viral and Immune Targets
HBV Cure Overview of Viral and Immune Targets Harry L.A. Janssen Francis Family Chair of Hepatology Director Toronto Centre for Liver Disease University Health Network University of Toronto, Canada October
More informationAn Update HBV Treatment
An Update HBV Treatment Epidemiology Natural history Treatment Daryl T.-Y. Lau, MD, MPH Associate Professor of Medicine Director of Translational Liver Research Division of Gastroenterology BIDMC, Harvard
More informationAssembly Biosciences, Inc. Corporate Presentation. March 2018 Nasdaq: ASMB
Assembly Biosciences, Inc. Corporate Presentation March 2018 Nasdaq: ASMB Cautionary Note Regarding Forward-Looking Statements The information in this presentation contains estimates and other forward-looking
More informationAsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics. March 1, 2012 Akin Akinc, PhD
AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics March 1, 2012 Akin Akinc, PhD Lead Selection Alnylam RNAi Product Platform Turning
More informationHBV Forum pre-easl 2018
HBV Roadmap Update from Recent and EASL Presentations HBV Forum pre-easl 2018 Robert G Gish MD Adjunct Professor Stanford University Medical Director HB Foundation See robertgish.com Disclosures Introduction
More informationComplete Blockage of HBV Virus Replication and Inhibition of cccdna Formation by Core Protein Allosteric Modifiers
Complete Blockage of HBV Virus Replication and Inhibition of Formation by Core Protein Allosteric Modifiers G. Renuka Kumar, Yuhua Zong, Alex Mercier, Pao-Chen Li, Cathal Mahon, Emily Connelly, Katherine
More informationAlnylam RNAi Roundtable. May 13, 2011
Alnylam RNAi Roundtable May 13, 2011 Agenda & Introductions Welcome Cynthia Clayton» Senior Director, Investor Relations and Corporate Communications Program Overview Akshay Vaishnaw, M.D., Ph.D. (Moderator)»
More informationPrediction of HBsAg Loss by Quantitative HBsAg Kinetics during Long-Term 2015
THAI J 16 GASTROENTEROL Treatment with Nucleos(t)ide Original Analogues Article Prediction of HBsAg Loss by Quantitative HBsAg Kinetics during Long-Term Treatment with Nucleos(t)ide Analogues Sombutsook
More informationHBV Novel Therapies Maria Buti MD, PhD
HBV Novel Therapies Maria Buti MD, PhD Liver Unit, Internal Medicine Department Vall d Hebron Hospital CONFLICT OF INTEREST I have financial relationships to disclose within the past 12 months relevant
More informationUnderstanding new medicines to treat chronic hepatitis B: toward a cure. October 26, 2016
Understanding new medicines to treat chronic hepatitis B: toward a cure October 26, 2016 Define an HBV cure Functionally (practical): Sustained, off drug response (loss of viremia and antigenemia Clinically:
More informationIdenix Pharmaceuticals Building a Leading Antiviral Franchise. Cowen & Company 27 th Annual Healthcare Conference March 13, 2007 Boston
Idenix Pharmaceuticals Building a Leading Antiviral Franchise Cowen & Company 27 th Annual Healthcare Conference March 13, 2007 Boston Safe Harbor This presentation includes forward-looking statements
More informationGDUFA: 2 ½ years later Impact & Importance
GDUFA: 2 ½ years later Impact & Importance Georgia Hizon Manager, Regulatory Publications Fresenius Kabi USA, LLC Disclaimer The views and opinions expressed in the following PowerPoint slides are those
More informationIsorce Nathalie, Testoni B., Luangsay S., Locatelli M., Zannetti C., Henry T., Hasan U., Zoulim F., Durantel D.
Activité antivirale de différents interférons (IFNs) et cytokines proinflammatoires dans des modèles pertinents d hépatocytes infectés par le virus de l hépatite B (HBV) Isorce Nathalie, Testoni B., Luangsay
More informationAlla ricerca del virus nascosto (quando il virus dell epatitie B si occulta )
Alla ricerca del virus nascosto (quando il virus dell epatitie B si occulta ) Giovanni Raimondo Epatologia Clinica e Biomolecolare Policlinico Universitario di Messina UI/ml pg/ml HBsAg HBeAg + anti-hbe
More informationAssembly Biosciences, Inc. Corporate Presentation. November 2017 Nasdaq: ASMB
Assembly Biosciences, Inc. Corporate Presentation November 2017 Nasdaq: ASMB Cautionary Note Regarding Forward-looking Statements The information in this presentation contains estimates and other forward-looking
More informationDEVELOPMENT OF AN INTERNATIONAL REFERENCE PREPARATION FOR HEPATITIS D VIRUS RNA - UPDATE
DEVELOPMENT OF AN INTERNATIONAL REFERENCE PREPARATION FOR HEPATITIS D VIRUS RNA - UPDATE SoGAT Clinical Diagnostics III 12-13 January 2011, London Michael Chudy Julia Kreß Micha Nübling Paul-Ehrlich-Institut
More informationThe Alphabet Soup of Viral Hepatitis Testing
The Alphabet Soup of Viral Hepatitis Testing August 18, 2011 Patricia Slev, PhD, DABCC Medical Director, Serologic Hepatitis and Retrovirus Laboratory, ARUP Laboratories Assistant Professor of Pathology,
More informationAcute Hepatitis B Virus Infection with Recovery
Hepatitis B: Clear as Mud Melissa Osborn, MD, MSCR Assistant Professor Emory University School of Medicine Atlanta, GA 1 Objectives 1. Distinguish the various stages in the natural history of chronic hepatitis
More informationThis is a free sample of content from The Hepatitis B and Delta Viruses. Click here for more information on how to buy the book.
Index A Acute liver failure (ALF), viral hepatitis, 7 Adalimab, hepatitis B management in immunosuppression patients, 279 Alemtuzumab, hepatitis B management in immunosuppression patients, 280 ALF. See
More informationA Novel Recombinant Virus Reagent Products for Efficient Preparation Of Hepatitis B Animal Models
About FivePlus Beijing FivePlus Molecular Medicine Institute was established in 2005. The company has been dedicating itself to continuous innovation of viral vectors. The meaning of FivePlus is based
More information2013 OTS Annual Meeting Pre-clinical Development of ALN-AS1 RNAi Therapeutic for the Treatment of Acute Intermittent Porphyria.
2013 OTS Annual Meeting Pre-clinical Development of ALN-AS1 RNAi Therapeutic for the Treatment of Acute Intermittent Porphyria October 8, 2013 Acute Intermittent Porphyria (AIP) Program Unmet Need and
More informationSlides are the property of the author and AASLD. Permission is required from both AASLD and the author for reuse.
Inarigivir Demonstrates Potent Dose Dependent Anti-Viral Activity in HBV Treatment-Naïve Patients: Role of HBeAg Status and Baseline HBsAg in Anti-Viral Response MF Yuen, M. Elkhashab, CY Chen, YF Chen,
More informationHepatitis B Case Studies
NORTHWEST AIDS EDUCATION AND TRAINING CENTER Hepatitis B Case Studies Nina Kim, MD MSc Associate Professor of Medicine University of Washington Harborview Madison Clinic and Hepatitis & Liver Clinic No
More informationPrevention Of Liver Fibrosis and Cancer in Africa
HIGH INCIDENCE OF A HEPATITIS B VIRUS PRES2 DELETION IN WEST AFRICA AMONG HBV CHRONIC CARRIERS : ASSOCIATION WITH HEPATOCELLULARCARCINOMA Prevention Of Liver Fibrosis and Cancer in Africa Isabelle CHEMIN
More informationThe Impact of HBV Therapy on Fibrosis and Cirrhosis
The Impact of HBV Therapy on Fibrosis and Cirrhosis Jordan J. Feld, MD, MPH Associate Professor of Medicine University of Toronto Hepatologist Toronto Centre for Liver Disease Sandra Rotman Centre for
More informationHealthcare Professional Information & Patient Information Leaflet (PL)
New concept for the SmPC/ Healthcare Professional Information & Patient Information Leaflet (PL) Fiona Reekie Director Global Regulatory Affairs Johnson & Johnson Pharmaceuticals Group Disclaimer The views
More information4th International HIV/Viral Hepatitis Co-Infection Meeting
4th International HIV/Viral Hepatitis Co-Infection Meeting The Rocky Road to Viral Hepatitis Elimination: Assuring access to antiviral therapy for ALL co-infected patients from low to high income settings
More information23 ε Γηεκερίδα Ιογελώλ Ηπαηηηίδωλ Β θαη C «Ση. Χαηδεγηάλλες» 30 θαη 31 Ιαλοσαρίοσ 2016
23 ε Γηεκερίδα Ιογελώλ Ηπαηηηίδωλ Β θαη C «Ση. Χαηδεγηάλλες» 30 θαη 31 Ιαλοσαρίοσ 2016 Λεηηοσργηθή θαη Ιοιογηθή Ιαζε ηες Χρολίας Ηπαηίηηδας Β: Παρόλ θαη Μέιιολ Σηέθαλος Χαηδεγηάλλες Οκόηηκος Καζεγεηής
More informationOccult Hepatitis B Infection: why, who and what to do?
Occult Hepatitis B Infection: why, who and what to do? MF Yuen, MD, PhD Chair of Gastroenterology and Hepatology Department of Medicine The University of Hong Kong Queen Mary Hospital, Hong Kong Who? Different
More informationPMDA Perspectives on Oncology Panel. REIKO YANAGIHARA, Ph.D. Office of In Vitro Diagnostics PMDA
15th DIA Japan Annual Meeting 2018 Promoting Better Collaboration to Drive Global Health and Innovation in an Era of Medical and Scientific Transformation November 11-13, 2018 Tokyo Big Sight PMDA Perspectives
More informationProfessor Vincent Soriano
Five Nations Conference on HIV and Hepatitis in partnership with Professor Vincent Soriano Hospital Carlos III, Madrid, Spain Professor Vincent Soriano in partnership with Hospital Carlos III, Madrid,
More informationCDC website:
Hepatitis B virus CDC website: http://www.cdc.gov/ncidod/diseases/hepatitis/slideset/hep_b/slide_1.htm Relevance Key Features es of Hepatitis t B Virus 250 million people infected worldwide. In areas of
More informationBIOTECH SHOWCASE. David Suhy, Chief Scientific Officer. 8 January 2018 NASDAQ: BNTC ASX: BLT
BIOTECH SHOWCASE NASDAQ: BNTC ASX: BLT 8 January 2018 David Suhy, Chief Scientific Officer SAFE HARBOR STATEMENT This presentation contains "forward-looking statements" within the meaning of section 27A
More informationDIA Oligonucleotide-Based Therapeutics Conference
DIA Oligonucleotide-Based Therapeutics Conference North Bethesda MD October 25-27 Translating PD Biomarkers From Preclinical Studies to Clinical Trials: MRG-201, an Oligonucleotide Mimic of mir- 29, Inhibits
More informationCHRONIC HEPATITIS B VIRUS Prospects for Cure
VIRAL HEPATITIS and CO-INFECTION with HIV Bucharest, Romania, 6-7 October, 2016 CHRONIC HEPATITIS B VIRUS Prospects for Cure Patrick T. F. Kennedy Reader in Hepatology & Consultant Hepatologist Blizard
More informationNatural History of Chronic Hepatitis B
Natural History of Chronic Hepatitis B Anna SF Lok, MD Alice Lohrman Andrews Professor in Hepatology Director of Clinical Hepatology Assistant Dean for Clinical Research University of Michigan Ann Arbor,
More informationGlobal Reporting System for Hepatitis (GRSH) An introduction. WHO Global Hepatitis Programme
Global Reporting System for Hepatitis (GRSH) An introduction WHO Global Hepatitis Programme 2018 Objectives 1. Explain the role of the new reporting system 2. Outline the reporting required from countries
More informationCRISPR/Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus
0 0 CRISPR/Cas cleavage of viral DNA efficiently suppresses hepatitis B virus Authors: Vyas Ramanan,, Amir Shlomai,, David B.T. Cox,,,, Robert E. Schwartz,,, Eleftherios Michailidis, Ankit Bhatta, David
More informationThe Global Viral Hepatitis Summit 15 th International Symposium on Viral Hepatitis and Liver Disease Presentation O-09
REP 2139 monotherapy and combination therapy with pegylated interferon: Safety and potent reduction of HBsAg and HDV RNA in Caucasian Patients with chronic HBV / HDV co-infection M. Bazinet 1, V. Pântea
More informationIntrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
More informationTherapeutic immunization strategies in chronic hepatitis B
Therapeutic immunization strategies in chronic hepatitis B Mengji Lu Institut für Virologie Universitätsklinkum Essen Falk Symposium Berlin, 04. October 2005 The aim of therapeutic immunization to achieve
More informationForward Looking Statements
Antiviral Therapies Forward Looking Statements This presentation contains forward-looking statements, including the timing of our drug development programs. Risks include delays in manufacturing created
More informationHepatitis virus immunity. Mar 9, 2005 Rehermann and Nascimbeni review Crispe review
Hepatitis virus immunity Mar 9, 2005 Rehermann and Nascimbeni review Crispe review HBV & HCV infection outcomes Both viruses cause immune-mediated active and chronic hepatitis HBV Vertical transmission
More informationArrowhead Analyst and Investor Day September 24, 2015
Arrowhead Analyst and Investor Day September 24, 2015 Welcome Remarks Vince Anzalone, CFA - Vice President, IR 2 Safe harbor statement This presentation contains forward-looking statements within the meaning
More informationPROPOSAL FOR THE DEVELOPMENT OF AN INTERNATIONAL REFERENCE PREPARATION FOR HEPATITIS D VIRUS RNA
PROPOSAL FOR THE DEVELOPMENT OF AN INTERNATIONAL REFERENCE PREPARATION FOR HEPATITIS D VIRUS RNA SoGAT Clinical Diagnostics II 30 September / 1 October 2009, Istanbul Michael Chudy Julia Kreß C. Micha
More informationModeling Kinetics of HBV Infection and Recommendations for Moving Forward
Modeling Kinetics of HBV Infection and Recommendations for Moving Forward Alan S. Perelson Theoretical Biology and Biophysics Los Alamos National Laboratory Los Alamos, NM HBV Models Hepatology 1999 Tsiang
More informationHBV Diagnosis and Treatment
HBV Diagnosis and Treatment Anna S. F. Lok, MD Alice Lohrman Andrews Professor in Hepatology Director of Clinical Hepatology Assistant Dean for Clinical Research University of Michigan Ann Arbor, MI, USA
More informationFor now, do not stop NUCs PHC R. PARANÁ Federal University of Bahia, Brazil HUPES-University Hospital Gastro-Hepatology Unit
For now, do not stop NUCs PHC 2019 R. PARANÁ Federal University of Bahia, Brazil HUPES-University Hospital Gastro-Hepatology Unit Disclosure PI: Clinical Trials -ABBVIE -INTERCEPT -GILEAD -Novartis -BMS
More informationOther EU Activities Contributing to Harmonization of Labeling
Other EU Activities Contributing to Harmonization of Labeling Dr Laurent Brassart European Medicines Agency Medical Information Sector DIA Labeling Harmonisation 2011 Workshop October 13-14. 2011 Disclaimer
More information