Molecular and Biological Characterization of a Neurovirulent Molecular Clone of Simian Immunodeficiency Virus

Transcription

1 JOURNAL OF VIROLOGY, Aug. 1997, p Vol. 71, No X/97/$ Copyright 1997, American Society for Microbiology Molecular and Biological Characterization of a Neurovirulent Molecular Clone of Simian Immunodeficiency Virus MAUREEN T. FLAHERTY, DEBRA A. HAUER, JOSEPH L. MANKOWSKI, M. CHRISTINE ZINK, AND JANICE E. CLEMENTS* Division of Comparative Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland Received 24 January 1997/Accepted 24 April 1997 To identify the molecular determinants of neurovirulence, we constructed an infectious simian immunodeficiency virus (SIV) molecular clone, SIV/17E-Fr, that contained the 3 end of a neurovirulent strain of SIV, SIV/17E-Br, derived by in vivo virus passage. SIV/17E-Fr is macrophage tropic in vitro and neurovirulent in macaques. In contrast, a molecular clone, SIV/17E-Cl, that contains the SU and a portion of the TM sequences of SIV/17E-Br is macrophage tropic but not neurovirulent. To identify the amino acids that accounted for the replication differences between SIV/17E-Fr and SIV/17E-Cl in primary macaque cells in vitro, additional infectious molecular clones were constructed. Analysis of these recombinant viruses revealed that changes in the TM portion of the envelope protein were required for the highest level of replication in primary macaque macrophages and brain cells derived from the microvessel endothelium. In addition, a full-length Nef protein is necessary for optimum virus replication in both of these cell types. Finally, viruses expressing a full-length Nef protein in conjunction with the changes in the TM had the highest specific infectivity in a smagi assay. Thus, changes in the TM and nef genes between SIV/17E-Cl and SIV/17E-Fr account for replication differences in vitro and correlate with replication in the central nervous system in vivo. Encephalitis and dementia are common manifestations of human immunodeficiency virus (HIV) infection of humans. However, the pathogenesis of these central nervous system (CNS) diseases is not well understood. In AIDS dementia, virus isolated from the CNS is macrophage tropic (i.e., replicates in both lymphocytes and macrophages) (8, 14, 17, 35, 36), but not all individuals infected with macrophage-tropic strains of HIV develop neurological disease. This finding suggests that not all macrophage-tropic viruses are neurovirulent and that other viral factors, including virus load in the CNS, may play a role in the development of CNS disease. In addition, cellular or host factors may contribute to the pathogenesis of HIV-induced CNS disease (50). In the simian immunodeficiency virus (SIV) animal model, SIV-infected macaques develop AIDS and some develop encephalitis (18, 22, 31, 41, 42). Monkeys infected with molecular clones of SIV that are predominantly lymphocyte tropic develop AIDS, while those infected with macrophage-tropic SIV also develop encephalitis and interstitial pneumonia (3, 18, 23, 31, 41, 42). The role of macrophage-tropic strains in the progression to AIDS has not been clearly determined. However, recent studies analyzing the viruses present early after infection with HIV type 1 (HIV-1) provide strong evidence that the transmitted viruses are genotypically homogeneous, compared to the heterogeneity of viruses isolated later in infection (10, 26, 32). The transmitted viruses are macrophage tropic (regardless of route of transmission), in comparison to the lymphocyte-tropic viruses that predominate later during disease progression (10, 26, 32, 46 49). Recent studies have shown that HIV-1 and SIV replicate in vivo in the brain microvessel endothelia that comprise the blood-brain barrier (BBB) (2, 21, 25, 30, 44). Entry of both * Corresponding author. Mailing address: Johns Hopkins University School of Medicine, 720 Rutland Ave., Traylor G-60, Baltimore, MD Phone: (410) Fax: (410) HIV-1 and SIV into the CNS endothelial cells occurs via a CD4-independent mechanism (25, 30). These in vivo findings suggest that replication of these viruses in endothelial cells plays a role in the development of HIV/SIV-induced neurological disease. Infection of endothelial cells may increase virus entry into the CNS, either directly or as a result of virusinduced alterations of the BBB. Studies have demonstrated the loss of integrity of the BBB in patients with AIDS dementia (33, 34, 37). Alterations in the integrity of the BBB may, in turn, contribute to the development of dementia and encephalitis. In a previous study, the predominantly lymphocyte-tropic infectious clone SIV mac 239 was passaged in monkeys, resulting in a virus strain that is macrophage tropic and neurovirulent, SIV/17E-Br (42). To identify the viral sequences associated with macrophage tropism and neurovirulence, an infectious molecular clone that replaced the surface glycoprotein of SIV mac 239 with nucleotide sequences derived from SIV/ 17E-Br was constructed (1). This virus, SIV/17E-Cl, was macrophage tropic but did not replicate productively in brain cells derived from microvessel endothelium (BDME) as do other neurovirulent strains of SIV (25). Further, monkeys inoculated with this virus did not develop neurological disease (12, 24). Thus, the nucleotide sequences that are responsible for macrophage tropism of SIV were not sufficient to confer neurovirulence. To characterize the viral contribution to the pathogenesis of CNS disease, infectious molecular clones of SIV were constructed. SIV/17E-Fr, containing the entire env and nef genes as well as the 3 long terminal repeat (LTR) of the neurovirulent strain SIV/17E-Br, replicates in macrophages and is neurovirulent (24), while the macrophage-tropic molecular clone SIV/17E-Cl does not cause CNS lesions in macaques (24). To identify the sequences responsible for this difference in disease potential in vivo, we took advantage of the differential replication of these two clones in primary macrophages and in BDME by constructing additional recombinant viruses that 5790

2 VOL. 71, 1997 CHARACTERIZATION OF A NEUROVIRULENT CLONE OF SIV 5791 delineated the amino acid changes required for these replicative differences. In addition, the viral determinants of infectivity were assessed by using a smagi assay (7). MATERIALS AND METHODS Viruses. Viral stocks were prepared in CEMx174 cells grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS; Atlanta Biologicals), 10 g of gentamicin (GIBCO) per ml, and 2 mm glutamine (GIBCO). A macrophage-tropic strain (SIV/17E-Br) was obtained by passage of SIV mac 239 in rhesus macaques (41). The SIV/17E-Br virus stock was obtained by cocultivation of brain homogenate from macaque 17E with primary macaque macrophages. A recombinant molecular clone, SIV/17E-Cl, that contains the surface glycoprotein (gp120) and a portion of the transmembrane glycoprotein (gp41) of SIV/17E-Br in the SIV mac 239 molecular clone was constructed (18). Stocks of SIV/17E-Cl as well as all the recombinant viruses constructed in this study were prepared by transfection of DNA from the molecular clone into CEMx174 cells (see below). Cells. Primary rhesus macaque lymphocytes and macrophages were obtained from heparinized peripheral blood collected from adult macaques (12). Blood was centrifuged at 2,500 rpm for 15 min, plasma was removed, and cells were resuspended in 2 volume with Hanks buffered saline solution. Peripheral blood mononuclear cells (PBMCs) were isolated on either Ficoll-Hypaque or Percoll density gradients. The cells were washed three times with Hanks buffered saline solution and resuspended in medium to culture either lymphocytes or macrophages. To culture peripheral blood lymphocytes, cells were resuspended at 10 6 /ml in RPMI 1640 supplemented with 10% FBS, gentamicin (50 g/ml), 2 mm glutamine, 10 mm HEPES buffer, 100 U of recombinant human interleukin-2 and 2.0 g of phytohemagglutinin per ml and cultured for 3 days. Cells were washed and resuspended in the same medium without phytohemagglutinin. To culture primary macrophages, cells were resuspended at /ml in RPMI 1640 supplemented with 10% human serum, gentamicin (50 g/ml), glutamine (2 mm/ml), 10 mm HEPES buffer, and 100 U each of macrophage colony-stimulating factor and granulocyte-macrophage colony-stimulating factor (both gifts from Genetics Institute, Cambridge, Mass.) per ml and cultured for 3 to 5 days. Nonadherent cells were removed, and the cultures were refed with the same supplemented medium. Under these culture conditions, lymphocytes do not proliferate and the cultures are greater than 95% macrophages. BDME were isolated from rhesus macaques and prepared as previously described (25). Virus growth curves. Primary lymphocyte, macrophage, and BDME cultures were infected with recombinant viruses derived from transfected CEMx174 cells. The virus stock of the SIV/17E-Br strain was propagated in CEMx174 cells. Cells were infected with a virus inoculum containing 20,000 cpm of reverse transcriptase activity; the mock-infected cells received medium alone. The virus was adsorbed overnight at 37 C. After incubation, the virus inoculum was removed and the cells were washed twice with phosphate-buffered saline. Infected cells were maintained in the appropriate medium, and 1-ml aliquots of supernatant were removed for reverse transcriptase assays as previously described (11). Virus growth curves were performed 10 times in macrophages, 6 times in lymphocytes, and 3 times in BDME. smagi assay. The CMMT-CD4-LTR- -Gal (smagi) cells, from Julie Overbaugh (7), were obtained from the NIH AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases (NIAID). Cells were plated in six-well plates at cells/well in Dulbecco modified Eagle medium (DMEM) supplemented with 10% FBS, 50 g of gentamicin per ml, and 2 mm glutamine. The next day, the medium was removed and the cells were infected with a virus inoculum containing 50,000 cpm of reverse transcriptase activity in 500 l of DMEM containing 15 g of DEAEdextran per ml. After a 5-h incubation at 37 C, the virus inoculum was removed and complete DMEM was placed on the cells. After 24 h, the cells were fixed and stained and the blue infectious centers were counted as previously described (7). Infectivity assays. Fivefold dilutions of cell culture supernatant were inoculated into the wells of a 96-well tissue culture plate containing RPMI 1640 supplemented with 10% human serum, gentamicin (50 g/ml), glutamine (2 nmol/ml), and 10 mm HEPES buffer, and 10 6 CEMx174 cells were added to each well. The wells were assessed for virus-specific cell cytopathology at 3, 5, and 7 days postinfection, and the 7-day results were used to calculate the 50% tissue culture infective dose by the method of Karber (16). Construction of recombinant viruses. The infectious molecular clone SIV/ 17E-Cl was constructed as previously described (1) and used for the construction of the other infectious molecular clones described here. The nucleotide sequence used here is based on that of the SIV mac 239 molecular clone containing only viral sequences (18). To construct the molecular clone SIV/17E-Fr, DNA from primary macaque macrophages infected with the neurovirulent virus strain SIV/ 17E-Br was used to PCR amplify sequences from bp 8741 to The 5 primer (5 GCTCTAGTCGACATGCTAGCTAAGTTAAGGCAGG3 ) contains an NheI site that is found in the viral genome; the 3 primer (5 GTAGTC GACGCTTAGCTGCTAGGGATTTTCCTGCTTGG3 ) was located at the very 3 end of the U5 sequences and contains a Bpu1102I site. There is a Bpu1102I site in the cellular flanking sequence of the original clone, SIV/17E-Cl; the insertion of the PCR fragment from SIV/17E-Br removes 359 bp of cellular flanking sequence from the SIV/17E-Fr clone compared to the SIV/17E-Cl molecular clone. The PCR fragment was digested with NheI and Bpu1102I, and the fragment was inserted into SIV/17E-Cl clone that had been digested with NheI and Bpu1102I. To examine the effects of these viral sequences on a lymphocyte-tropic virus, this fragment was also inserted into SIV mac 239 that had been digested with NheI and Bpu1102I to construct the molecular clone SIV/ E(Nhe-Bpu). To construct recombinant clones with different nef sequences, the 1.5-kb NheI-Bpu1102 fragments from SIV mac 239 and SIV/17E-Fr were amplified by PCR using primers containing SalI sites. The PCR products were digested with SalI and inserted into SalI-digested plg338/ibi-30. The subclones were digested with Bsu36I to isolate viral sequences from bp 9049 to 9556, a region which includes 480 nucleotides of the nef gene. The Bsu36I fragment from SIV mac 239 was inserted into plg-17e-fr ( ) Bsu, and the Bsu36I fragment from SIV/ 17E-Fr was inserted into plg-239 ( ) Bsu. The constructs were sequenced to verify the orientation and sequence of the nef gene. The subclones were digested with NheI and Bpu1102I, and the 1.5-kb fragments were inserted into SIV mac 239, SIV/17E-Cl, or SIV/17E-Fr to construct full-length molecular clones with different nef sequences. To construct SIV/Fr-2 (17E-Fr/239 nef open) and clone 3-11 (17E-Cl nef open), the Bsu36I fragment from p239spe3 nef open (obtained from the NIAID AIDS Research and Reference Reagent Program) was inserted into plg-17e-fr ( ) Bsu or plg-239 ( ) Bsu. The subclones were digested with NheI and Bpu1102I, and the 1.5-kb fragment was inserted into SIV/17E-Fr or SIV/17E-Cl. To construct SIV/17E-Fr nef, the Nhe-Bpu fragment from SIV/17E-Cl nef was amplified by PCR, using overlapping primers to mutate the initiating methionine codon in Nef to a threonine. This sequence modification does not alter the amino acid sequence of the overlapping transmembrane region of the envelope. The PCR product was digested with Bsu36I and inserted into plg-17e-fr ( ) Bsu. The construct was sequenced to verify the orientation and the sequence of the nef gene. The subclone was digested with NheI and Bpu1101I, and this fragment was inserted into SIV/17E-Fr ( ) Nhe-Bpu to construct the full-length molecular clone with a mutation at the initiating methionine and a 182-bp nef deletion. Transfection of recombinant viruses. CEMx174 cells were transfected with infectious DNA by electroporation using a Bio-Rad Gene Pulser with a pulse of 200 V and 960 F; 10 to 20 g of each viral clone was used in the transfections. After 4 to 7 days, cultures were examined for fusion cytopathic effects and reverse transcriptase activity. The supernatants from the cultures were collected, and virus was titered in CEMx174 cells and stored at 80 C. RESULTS Construction of an infectious molecular clone with the in vitro and in vivo characteristics of the neurovirulent strain SIV/17E-Br. Previously, an infectious molecular clone that contained the SU and a portion of the TM glycoprotein from the neurovirulent strain SIV/17E-Br in the genetic background of the infectious molecular clone SIV mac 239 was constructed (1). This virus, SIV/17E-Cl, is macrophage tropic but does not replicate in primary cultures of macaque BDME (1, 24). When inoculated into macaques, SIV/17E-Cl induces a vigorous immune response with a relatively long period before the development of an AIDS-like disease (greater than 2.5 years). These macaques had no evidence of neurological disease. Thus, this macrophage-tropic molecular clone is not neurovirulent (12, 24). Since the SU env sequences in SIV/17E-Cl were derived from the neurovirulent virus strain SIV/17E-Br, these results suggested that additional viral sequences from the neurovirulent strain were required to confer neurovirulence. Another molecular clone of SIV that contained the entire env gene and the nef gene as well as the 3 LTR from the neurovirulent strain SIV/17E-Br was constructed. These sequences were amplified by PCR from the cocultivation of primary macaque macrophages with the original brain homogenate from macaque 17E (42) and inserted into the backbone of the infectious molecular clone SIV/17E-Cl. The region of the genome substituted was from bp 8741 to (1, 18) (Fig. 1A). DNA from the newly derived molecular clone, SIV/17E-Fr, was transfected into CEMx174 cells and primary macaque PBMCs to obtain infectious virus.

3 FIG. 1. Schematic of the genetic composition of parental and recombinant viruses. Sequences from the neurovirulent strain SIV/17E-Br were placed in the background of the infectious molecular clone SIV mac 239 to construct the recombinant viruses SIV/17E-Cl, SIV/17E-Fr, and SIV/239-17E(Nhe-Bpu) (A). The restriction sites used to make the constructs are indicated. *, stop codon present in the nef gene of SIV mac 239 and in the TM of the SIV/17E-Fr molecular clone;, change in the nef sequence that overlaps the U3 region of the 3 LTR. The Bsu36I fragments from SIV mac 239 and SIV/17E-Fr were used to make additional recombinant clones (B). 5792

4 VOL. 71, 1997 CHARACTERIZATION OF A NEUROVIRULENT CLONE OF SIV 5793 FIG. 2. (A) The amino acid sequences of the Env proteins of SIV molecular clones. The amino acid sequence of SIV mac 239, the lymphocyte-tropic virus used to construct the molecular clones SIV/17E-Cl, SIV/17E-Fr, and SIV316EM (1, 29), is presented on the top line. The variable regions (V1 to V5) have been identified by analogy to HIV-1. The location of the proteolytic cleavage site in the Env polyprotein is indicated by an arrow above the SIV mac 239 amino acid sequence. The line above the sequence at 695 to 713 indicates the transmembrane domain in the TM protein. The arrow under the sequence of SIV/17E-Cl and the NheI site indicates the position where the SIV/17E-Fr clone sequences begin., location of a base change that is silent; *, location of the stop codon in the TM. (B) The amino acid sequences of the Nef proteins of SIV molecular clones. The amino acid sequence of SIV mac 239 is on the top line, and that of SIV/17E-Fr is below (1, 18). The asterisk indicates the presence of the stop codon in the Nef protein of SIV mac 239; the stippled bar indicates the location of the PXXP domain. Nucleotide sequence analyses of SIV/17E-Fr. The nucleotide sequence of SIV/17E-Fr was compared to that of the lymphocyte-topic virus SIV mac 239 from which it was derived as well as to that of a macrophage-tropic clone SIV316EM, also derived from SIV mac 239 (18, 29) (Fig. 2). In addition to the envelope changes previously identified in SIV/17E-Cl (no changes in the first open reading frame of Tat, but a single conservative amino acid change in the first open reading frame of Rev), SIV/ 17E-Fr has three base pair changes in the transmembrane region of the env gene; however, only one of these differences results in a biologically relevant amino acid change (Fig. 2A). An A-to-G change at nucleotide 8854 results in an arginineto-glycine substitution, and a G-to-A change at bp 8896 results in a stop codon in the cytoplasmic domain of the TM protein. After the stop codon, there is an additional nucleotide change at bp 9110 of C to T, resulting in an alanine-to-valine change in the TM protein. The nef gene contains seven nucleotide changes resulting in six amino acid differences in the Nef protein (Fig. 2B). One of these changes, a T-to-C substitution at nucleotide position 9353, results in the reversion of a stop codon present in SIV mac 239 to a glutamine residue in the Nef protein of SIV/17E-Fr. Two changes in the nef sequence result in nucleotide changes in the overlapping U3 region of the 3 LTR (positions 9524 and 9576). Neither of the U3 changes alters the transcriptional control elements identified for SIV; further, the U3 changes that overlap the nef gene have been shown to play no role in virus replication or pathogenesis (6, 15, 20, 45). There is also a nucleotide change in the R region of the 3 LTR (position 10063). This change will not be present in the virus progeny of the molecular clone. The nucleotide sequence of the 1.5-kb NheI-to-Bpu1102I fragment was also compared to direct sequence analysis of PCR products from the DNA of macrophages cocultivated with 17E brain homogenate. A difference was found at bp 8901, where an A was found in the clone, compared to agin the viral DNA, creating a stop codon in the SIV/17E-Fr TM

5 5794 FLAHERTY ET AL. J. VIROL. protein. It was not possible to obtain a molecular clone without the termination codon. The stop codon in the cytoplasmic tail of the TM protein occurs just before the lytic peptide sequence identified in many lentivirus TM proteins (27). Another difference, which changes a methionine residue to an isoleucine in the Nef protein of the clone, was found at bp These changes are most likely the result of PCR and cloning since they were not found in the SIV/17E-Br sequence. The SIV/ 17E-Br sequence also contains the open nef gene as found in the SIV/17E-Fr clone. To examine the frequency of the changes in the transmembrane portion of the env gene, products of 10 independent PCRs (bp 8790 to 9130) done on the SIV/17E-Br infected macrophages DNA (see above) were sequenced. All 10 PCR products contained the arginine-to-glycine substitution at bp 8854 and the alanine-to-valine change at bp In addition, there was no stop codon at bp 8896 in the SIV/17E-Br virus strain. Growth properties of SIV/17E-Fr in primary lymphocytes, macrophages, and BDME. The replication properties of SIV/ 17E-Fr were compared to those of SIV mac 239 and SIV/17E-Cl in different primary macaque cells in order to examine the effects of their sequence differences on cell tropism. In addition, to examine exclusively the contribution of the TM and Nef changes identified in SIV/17E-Fr, we made another recombinant virus, SIV/239-17E(Nhe-Bpu), that contained only these sequences in the background of SIV mac 239. The levels of reverse transcriptase activity in the primary macaque lymphocytes infected with the macrophage-tropic clones (SIV/17E-Cl and SIV/17E-Fr) are similar to the levels of SIV mac 239 in lymphocytes (Fig. 3A). Clone SIV/239-17E(Nhe-Bpu) replicates to titers similar to those of SIV mac 239 in the macaque lymphocytes (Fig. 3A). In primary macaque macrophages, SIV/17E-Fr consistently replicates to higher levels than SIV/ 17E-Cl. The molecular clone SIV/239-17E(Nhe-Bpu), like SIV mac 239, does not replicate well in macrophages, confirming that the changes in the surface envelope protein are necessary for macrophage tropism (Fig. 3B). BDME are components of the BBB. Virus replication in these cells may contribute to loss of BBB integrity as well as increased virus loads in the CNS. The replication of the macrophage-tropic molecular clones and strains in these cells were examined. SIV/17E-Fr replicates productively in BDME (Fig. 4A), although the levels of reverse transcriptase activity are lower than in the uncloned strain SIV/17E-Br (Fig. 4B). None of the other molecular clones [SIV mac 239, SIV239-17E(Nhe- Bpu), and SIV/17E-Cl] replicated productively in BDME (Fig. 4), although SIV/17E-Cl-infected cells were positive for viral DNA by PCR (data not shown). These data suggest that changes in the surface envelope protein that confer macrophage tropism are necessary but not sufficient to confer a tropism for BDME. Construction of molecular clones to identify the specific amino acid changes important for replication in BDME. The molecular clone SIV/17E-Cl, expressing the surface envelope protein and a portion of the transmembrane protein of the SIV/17E-Br virus, conferred macrophage but not BDME tropism on SIV mac 239. In contrast, SIV/17E-Fr, containing the entire env gene as well as the nef gene and 3 LTR of SIV/ 17E-Br, replicated more efficiently in macrophages and productively in BDME, suggesting that other viral sequences are important for cell tropism. The differences between SIV/ 17E-Cl and SIV/17E-Fr are amino acid changes in the TM and the presence of the nef gene derived from the strain SIV/ 17E-Br in SIV/17E-Fr. To determine the effects of the amino acid changes in TM and the stop codon, additional recombinant viruses were constructed (Fig. 1B). Clone 2-1 has the FIG. 3. Replication of parental and recombinant viruses in primary macaque lymphocytes (A) and macrophages (B). Cell cultures were infected with a virus inoculum containing 20,000 cpm of reverse transcriptase (RT) activity. Virus stocks were prepared from transfected CEMx174 cells. Virus production was monitored by reverse transcriptase assay of culture supernatants as described in Materials and Methods. transmembrane portion of SIV/17E-Fr placed in the background of SIV mac 239. This recombinant virus replicates well in macaque lymphocytes (data not shown) but did not grow in primary macrophages or BDME (Fig. 5A). Clone 3-7, containing the surface envelope and nef genes from SIV/17E-Fr, grew as well as SIV/17E-Cl in lymphocytes (data not shown) and macrophages (Fig. 5A). Like SIV/17E-Cl, clone 3-7 did not replicate productively in BDME (Fig. 5A). The only differences between SIV/17E-Fr and clone 3-7 are the arginine-toglycine change at bp 8854 and the stop codon at bp 8896 in the TM of SIV/17E-Fr. The original virus strain SIV/17E-Br expresses a full-length TM and replicates productively in macrophages and BDME. Thus, the truncation of the TM in SIV/ 17E-Fr does not appear to alter the tropism of the molecular clone. Therefore, the only relevant difference between SIV/ 17E-Fr and SIV/17E-Cl is the arginine-to-glycine change in the TM. This change appears to be absolutely required for SIV/ 17E-Fr replication in BDME. To further examine the requirement for this amino acid change in the TM, an additional construct was made; clone 3-11 has the nef open gene from SIV mac 239 in the background of SIV/17E-Cl (Fig. 1B). This recombinant virus replicates efficiently in macrophages (Fig. 5A) but did not grow in BDME (Fig. 5B), again suggesting that the arginine-to-glycine change in the TM is required for replication in BDME. To examine the role of the nef gene in cell tropism, the sequences of SIV mac 239 and SIV/17E-Fr were compared. There are seven nucleotide changes in the SIV/17E-Fr nef gene resulting in six amino acid coding differences (Fig. 2B). To

6 VOL. 71, 1997 CHARACTERIZATION OF A NEUROVIRULENT CLONE OF SIV 5795 FIG. 4. Replication of parental and recombinant viruses in primary macaque BDME. The only recombinant virus that replicates productively in BDME is SIV/17E-Fr (A); the levels of reverse transcriptase (RT) activity are lower than those from the uncloned strain SIV/17E-Br (B). Infection of cells and measurement of virus production were performed as described in the legend to Fig. 3. determine if these changes in the nef gene of SIV/17E-Fr influence virus replication in macrophages and BDME, recombinant molecular clones containing nef sequences from either SIV mac 239 or SIV/17E-Fr were constructed (Fig. 1B). The Bsu36I fragment contains 480 nucleotides of the nef gene and includes all but one of the amino acid changes identified in SIV/17E-Fr Nef (the tyrosine-to-phenylalanine change at amino acid position 167 in the Nef protein is not included). By exchanging the Bsu36I fragments, the effects of these amino acid changes on cell tropism can be determined. The replication properties of these recombinant viruses were analyzed in primary rhesus macrophages and BDME (Fig. 5). The nef gene from SIV/17E-Fr was inserted into SIV mac 239 to construct clone 1-5 (Fig. 1B). Virus derived from clone 1-5 does not grow in macrophages or BDME, indicating that the replacement of the nef gene alone does not confer the ability to replicate in macrophages or BDME (Fig. 5). Clone 4-1 contains the entire env gene from SIV/17E-Fr and expresses the truncated form of Nef from SIV mac 239 (the 3 LTR contains a single nucleotide difference from 239). In lymphocytes, clone 4-1 replicates as well as SIV/17E-Fr (data not shown), but in primary macrophages, the replication rate is delayed (Fig. 5A). Unlike SIV/17E-Fr, clone 4-1 does not grow in the BDME (Fig. 5B), although the cells did contain viral DNA (data not shown). These results suggest that a full-length Nef protein in conjunction with the amino acid change (arginine to glycine at bp 8854) in the TM is necessary for efficient replication in macrophages and BDME. To examine further the role of a full-length Nef protein in FIG. 5. Replication of recombinant viruses in primary macaque macrophages (A) and BDME (B). Only SIV/17E-Fr expressing a full-length Nef protein and envelope from the dual-tropic virus replicates productively in primary BDME. Infection of cells and measurement of virus production were performed as described in the legend to Fig. 3. RT, reverse transcriptase. virus replication in BDME, an additional construct was made. Clone SIV/Fr-2 has the envelope of SIV/17E-Fr and the nef open gene from SIV mac 239 (Fig. 1B). This recombinant virus replicates efficiently in lymphocytes (data not shown) and in macrophages (Table 1). Like SIV/17E-Fr, SIV/Fr-2 replicates productively in BDME, while no infectious virus was detected from the cells infected with clone 4-1 (Table 1). These results demonstrate that specific amino acid residues in the Nef protein are not required for replication in BDME, but a full-length Nef protein is essential. These data and the replication properties of the recombinant viruses indicate that the ability to TABLE 1. Infectivities of SIV/17E-Br and SIV recombinants a Virus BDME virus TCID 50 Macrophage virus SIV/17E-Br SIV/17E-Fr SIV/Fr Clone a Assessed by syncytium formation on CEMx174 cells as described in Materials and Methods. The 50% tissue culture infective dose (TCID 50 ) was calculated 7 days postinfection. Supernatants from infected BDME were assayed at 12 days postinfection. Supernatants from infected macrophages were assayed at 14 days postinfection.

7 5796 FLAHERTY ET AL. J. VIROL. FIG. 6. Specific infectivities of SIV recombinant viruses as determined by the smagi assay. Cells were infected, fixed, and stained as described in Materials and Methods. The percent blue infectious centers was determined 24 h after infection. The results represent two independent experiments. Error bars indicate standard deviations. productively replicate in BDME maps to a single amino acid change (arginine to glycine at bp 8854) in the transmembrane portion of the envelope and a nef open gene. Specific infectivities of SIV recombinants. The specific infectivities of the recombinant viruses were determined by using the smagi assay. This assay detects infectious virus after a single cycle of viral replication, allowing the comparison of viruses with different replication rates (7). Thus, the viral determinants of infectivity can be assessed. The smagi cells were infected with cell-free virus inocula derived from transfected CEMx174 cells and standardized by reverse transcriptase activity. The ratios of blue infectious centers to uninfected cells were determined 24 h after infection (Fig. 6). Comparisons of the SIV/17E-Cl recombinant viruses revealed that viruses expressing full-length Nef proteins (clone 3-7 [8%] and clone 3-11 [10%]) had higher specific infectivities than SIV/ 17E-Cl (3%) (Fig. 6). SIV/17E-Fr and SIV/Fr-2 had the highest infectivities (15 and 20%, respectively). Clone 4-1, expressing a truncated Nef protein, had a lower specific infectivity (5%). When the nef gene was deleted in SIV/17E-Fr (SIV/17E- Fr nef), the level of blue infectious centers fell to 2%. These results demonstrate that a full-length Nef protein is required for optimal infectivity in smagi cells. In addition, viruses expressing a full-length Nef protein in conjunction with the amino acid changes in the TM portion of the envelope (SIV/ 17E-Fr and SIV/Fr-2) have the highest specific infectivities. DISCUSSION Previous data have demonstrated that changes in the SU portion of the env gene are sufficient to confer macrophage tropism on SIV mac 239 (1, 3, 4, 29). The recombinant virus SIV/17E-Cl, expressing only the surface envelope glycoprotein of the SIV/17E-Br virus, is macrophage tropic, replicating in both lymphocytes and macrophages, but does not replicate productively in BDME. Although macrophage-tropic viruses are involved in the development of CNS disease, in vivo studies have shown that SIV/17E-Cl does not cause neurological disease, suggesting that not all macrophage-tropic viruses are neurovirulent (12, 24). To identify the viral determinants of neurotropism, a recombinant clone containing the entire env gene as well as the nef gene and 3 LTR of SIV/17E-Br was constructed. This recombinant virus, SIV/17E-Fr, replicated more efficiently than SIV/17E-Cl in primary macrophages. In addition, SIV/17E-Fr replicated productively in BDME. Further, SIV/17E-Fr was found to cause neurological disease when inoculated into macaques (24). These data suggest that although changes in the SU portion of the env gene are sufficient to confer macrophage tropism, additional regions of the genome enhance viral replication in macrophages and may play a role in neurotropism and neurovirulence. The genetic differences between SIV/17E-Cl and SIV/ 17E-Fr include changes in the TM glycoprotein, truncation of the TM glycoprotein in SIV/17E-Fr, and the presence of an open nef gene in SIV/17E-Fr. SIV/17E-Fr was derived from the SIV/17E-Br strain, which contains full-length TM and Nef proteins and replicates well in macrophages and BDME. The cell tropism of SIV/17E-Fr for primary macrophages and BDME matches that of the SIV/17E-Br strain. Recombinant clones were constructed to delineate the genetic elements of SIV/17E-Fr that conferred its replicative ability in BDME. We conclude that the single amino acid change in the transmembrane portion of the envelope from arginine to glycine (bp 8854) was sufficient for efficient entry and replication in the BDME. Further, the truncation of the TM does not appear to affect the tropism of SIV/17E-Fr. SIV/17E-Cl was found to enter the BDME, but there was no viral RNA, protein, or virus particles present in these cells (24). Thus, this change in TM appears to be important for an early replication event, possibly uncoating of the virus after cell entry. The TM protein may also play a role in the inclusion or exclusion of particular cellular proteins in the viral coat as well as the density of the SU glycoprotein in the coat. If this is the case, the differences in the cell tropism of SIV/17E-Fr and SIV/17E-Cl could be due in part to the incorporation of cellular proteins in the viral coat that interact with membrane proteins of endothelial cells. These proteins may contribute to the efficient entry and uncoating of the virus. In addition, our data suggest that the nef gene plays an important role in cell tropism. Recombinant viruses containing different nef genes exhibit altered replication properties in primary cell cultures. A macrophage-tropic virus (clone 4-1) containing a truncated nef gene replicates less efficiently in primary macrophages and cannot productively infect BDME. When a full-length Nef protein is expressed, the virus replicates productively in macrophages and in BDME. These results demonstrate that a full-length Nef protein in conjunction with the arginine-to-glycine change in the TM is required for efficient virus replication in primary macrophages and in BDME and optimal infectivity in smagi cells. The nef gene has been found to affect the level of replication of SIV and HIV in primary lymphocytes and macrophages, although it does not seem to alter viral replication in lymphocyte cell lines (9, 28, 45, 48). The nef gene is also required for efficient virus replication and disease progression in vivo. SIV mac viruses containing point mutations in the nef gene are found to revert rapidly in vivo to wild-type sequence, and viruses containing deletions in the nef gene cause infection in rhesus macaques but not progression to disease (13, 15, 19). Previous studies have demonstrated that Nef alters signal transduction pathways and increases cellular activation (5, 43). Both HIV and SIV Nef proteins contain a conserved proline rich motif, PXXP, that binds to the Src homology region 3 domains of Hck and Lyn (38). This motif is required for the Nef-mediated enhancement of HIV-1 replication in PBMCs (38). In addition, both HIV and SIV Nef proteins interact with a cellular serine kinase which affects virus replication in vitro and in vivo (39, 40). The Nef protein of SIV mac 239 contains a stop codon immediately upstream of the PXXP motif, and sequences required for interaction of Nef with the serine ki-

8 VOL. 71, 1997 CHARACTERIZATION OF A NEUROVIRULENT CLONE OF SIV 5797 nase are not present in the truncated protein. Expression of these conserved motifs may correlate with enhanced virus replication and virion infectivity. Recombinant viruses expressing the truncated Nef protein replicate inefficiently in primary macrophages and do not grow productively in BDME. The recombinant, macrophage-tropic viruses expressing a truncated Nef protein are capable of entering the BDME (viral DNA detected by PCR) but do not replicate productively in these cells. In addition, viruses expressing a truncated Nef protein or a deleted nef gene are less infectious in the smagi assay. Therefore, the Nef protein may act very early after infection by altering the intracellular environment by activating or sequestering cellular proteins to promote efficient virus replication or by modifying the virus particle to increase infectivity. ACKNOWLEDGMENTS We thank Maryann Brooks for preparation of the manuscript. This work was supported by grants NS32208, NS35751, and NS07392 from the National Institutes of Health. REFERENCES 1. Anderson, M. G., D. Hauer, D. P. Sharma, S. V. Joag, O. Narayan, M. C. Zink, and J. E. Clements Analysis of envelope changes acquired by SIVmac239 during neuroadaption in rhesus macaques. Virology 195: Bagasra, O., E. Lavi, L. Bobroski, J. P. Pestamer, R. Tawadros, and R. J. Pomerantz Cellular reservoirs of HIV-1 in the central nervous system of infected individuals: identification by the continuation of in situ polymerase chain reaction and immunohistochemistry. AIDS 10: Banapour, B., M. Marthas, R. Munn, and P. Luciw In vitro macrophage tropism of pathogenic and nonpathogenic molecular clones of simian immunodeficiency virus (SIVmac). Virology 183: Banapour, B., M. L. Marthas, R. A. Ramos, B. L. Lohman, R. E. Unger, M. B. Gardner, N. C. Pedersen, and P. A. Luciw Identification of viral determinants of macrophage tropism for simian immunodeficiency virus SIVmac. J. Virol. 65: Baur, A., E. T. Sawai, P. Dazin, W. J. Fantl, C. Cheng-Mayer, and B. M. Peterlin HIV-1 Nef leads to inhibition or activation of T cells depending on its intracellular localization. Immunity 1: Bellas, R., N. Hopkins, and Y. Li The NF-kappa B binding site is necessary for efficient replication of simian immunodeficiency virus of macaques in primary macrophages but not T cells in vitro. J. Virol. 67: Chackerian, B., N. L. Haigwood, and J. Overbaugh Characterization of a CD4-expressing macaque cell line that can detect virus after a single replication cycle and can be infected by diverse simian immunodeficiency virus isolates. Virology 213: Cheng-Mayer, C., C. Weiss, D. Seto, and J. A. Levy Isolates of HIV-1 from brain may constitute a special group of AIDS viruses. Proc. Natl. Acad. Sci. USA 86: Chowers, M. Y., C. A. Spina, T. J. Kwoh, N. J. S. Fitch, D. D. Richman, and J. C. Guatelli Optimal infectivity in vitro of human immunodeficiency virus type 1 requires an intact nef gene. J. Virol. 68: Cichutek, K., S. Norley, R. Linde, W. Kreuz, M. Gahr, J. Lower, G. von- Wangenheim, and R. Kurth Lack of HIV-1 V3 region sequence diversity in two haemophiliac patients infected with a putative biologic clone of HIV-1. AIDS 5: Clabough, D. L., D. Gebhard, M. T. Flaherty, L. E. Whetter, S. T. Perry, L. Coggins, and F. J. Fuller Immune-mediated thrombocytopenia in horses infected with equine infectious anemia virus. J. Virol. 65: Clements, J. E., R. C. Montelaro, M. C. Zink, A. Martin-Amedee, S. Miller, A. M. Trichel, B. Jagerski, D. Hauer, L. N. Martin, R. P. Bohm, and M. Murphey-Corb Cross-protective immune responses induced in rhesus macaques by immunization with attenuated macrophage-tropic simian immunodeficiency virus. J. Virol. 69: Daniel, M. D., F. Kirchhoff, C. Czajak, P. K. Sehgal, and R. C. Desrosiers Protective effects of a live attenuated SIV vaccine with a deletion in the nef gene. Science 258: Gartner, S., P. Markovitz, D. M. Markovitz, M. H. Kaplan, R. C. Gallo, and M. Popovic The role of mononuclear phagocytes in HTLV-III/LAV infection. Science 233: Ilyinskii, P., M. Daniel, M. Simon, A. Lackner, and R. Desrosiers The role of upstream U3 sequences in the pathogenesis of simian immunodeficiency virus-induced AIDS in rhesus monkeys. J. Virol. 68: Karber, G Beitrag zue kollektiven Behandlung pharmakologischer Reihenversuche. Arch. Exp. Pathol. Pharmakol. 162: Kato, T., A. Hirano, J. F. Llena, and H. M. Dembitzer Neuropathology of the acquired immune deficiency syndrome (AIDS) in 53 autopsy cases with particular emphasis on microglial nodules and multinucleated giant cells. Acta Neuropathol. 73: Kestler, H., T. Kodama, D. Ringler, M. Marthas, N. Pedersen, A. Lackner, D. Regier, P. Sehgal, M. Daniel, N. King, and R. Desrosiers Induction of AIDS in rhesus monkeys by molecularly cloned simian immunodeficiency virus. Science 248: Kestler, H. W., D. J. Ringler, K. Mori, D. L. Panicali, P. D. Sehgal, M. D. Daniel, and R. C. Desrosiers Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 65: Kirchhoff, F., H. Kestler, and R. Desrosiers Upstream U3 sequences in simian immunodeficiency virus are selectively deleted in vivo in the absence of an intact nef gene. J. Virol. 68: Lane, T. E., M. J. Buchmeier, D. D. Watry, D. B. Jakubowski, and H. W. Fox Serial passage of microglial SIV results in selection of homogeneous env quasispecies in the brain. Virology 212: Letvin, N. L., M. D. Daniel, P. K. Sehgal, R. C. Desrosiers, R. D. Hunt, L. M. Waldron, J. J. MacKey, D. K. Schmidt, L. V. Chalifoux, and N. W. King Induction of AIDS-like disease in macaque monkeys with T cell tropic retrovirus STLV-III. Science 230: Luciw, P. A., K. E. S. Shaw, R. E. Unger, V. Planelles, M. W. Stout, J. E. Lackner, E. Pratt-Lowe, N. J. Leung, B. Banapour, and M. L. Marthas Genetic and biological comparisons of pathogenic and nonpathogenic molecular clones of simian immunodeficiency virus (SIVmac). AIDS Res. Hum. Retroviruses 8: Mankowski, J. L., M. T. Flaherty, J. P. Spelman, D. A. Hauer, P. J. Didier, A. M. Amedee, M. Murphey-Corb, L. M. Kirstein, A. Muñoz, J. E. Clements, and M. C. Zink Pathogenesis of simian immunodeficiency virus encephalitis: viral determinants of neurovirulence. J. Virol. 71: Mankowski, J. L., J. P. Spelman, H. G. Ressetar, J. D. Strandberg, J. Laterra, J. E. Clements, and M. C. Zink Neurovirulent simian immunodeficiency virus replicates productively in endothelial cells of the central nervous system in vivo and in vitro. J. Virol. 68: McNearney, T., Z. Hornickova, R. Markham, A. Birdwell, M. Arens, A. Saah, and L. Ratner Relationship of human immunodeficiency virus type 1 sequence heterogeneity to stage of disease. Proc. Natl. Acad. Sci. USA 89: Miller, M. A., R. F. Garry, J. M. Jaynes, and R. C. Montelaro A structural correlation between lentivirus transmembrane proteins and natural cytolytic peptides. AIDS Res. Hum. Retroviruses 7: Miller, M. D., M. T. Warmerdam, I. Gaston, W. C. Greene, and M. B. Feinberg The human immunodeficiency virus-1 nef gene product: a positive factor for viral infection and replication in primary lymphocytes and macrophages. J. Exp. Med. 179: Mori, K., D. J. Ringler, T. Kodama, and R. C. Desrosiers Complex determinants of macrophage tropism in env of simian immunodeficiency virus. J. Virol. 66: Moses, A. V., F. E. Bloom, C. D. Pauza, and J. A. Nelson Human immunodeficiency virus infection of human brain capillary endothelial cells occurs via a CD4/galacytosylceramide-independent mechanism. Proc. Natl. Acad. Sci. USA 90: Naidu, Y. M., H. W. Kestler, Y. Li, C. V. Butler, D. P. Silva, D. K. Schmidt, C. D. Troup, P. K. Sehgal, P. Sonigo, M. D. Daniel, and R. C. Desrosiers Characterization of infectious molecular clones of simian immunodeficiency virus (SIVmac) and human immunodeficiency virus type 2: persistent infection of rhesus monkeys with molecular cloned SIVmac. J. Virol. 62: Pang, S., Y. Schlesinger, E. S. Daar, T. Moudgil, D. D. Ho, and I. S. Chen Rapid generation of sequence variation during primary HIV-1 infection. AIDS 6: Petito, C. K., and K. S. Cash Blood-brain barrier abnormalities in the acquired immunodeficiency syndrome: immunohistochemical localization of serum proteins in postmortem brain. Ann. Neurol. 32: Power, C., P. A. Kong, T. O. Crawford, S. Wessilingh, J. D. Glass, J. C. McArthur, and B. D. Trapp Cerebral white matter changes in acquired immunodeficiency syndrome dementia: alterations of the blood-brain barrier. Ann. Neurol. 34: Price, R. W., B. Brew, J. J. Sidtis, M. Rosenblum, A. C. Scheck, and P. Cleary The brain in AIDS: central nervous system HIV-1 infection and AIDS dementia complex. Science 239: Price, R. W., B. J. Brew, and M. Rosenblum The AIDS dementia complex and HIV-1 brain infection: a pathogenic model of virus-immune interaction, p In B. M. Waksman (ed.), Immunologic mechanism in neurologic and psychiatric disease. Raven Press, New York, N.Y. 37. Rhodes, R. H Evidence of serum-protein leakage across the bloodbrain barrier in the acquired immunodeficiency syndrome. J. Neuropathol. Exp. Neurol. 50: Saksela, K., G. Cheng, and D. Baltimore Proline-rich (PxxP) motifs in HIV-1 Nef bind to SH3 domains of a subset of Src kinases and are required

9 5798 FLAHERTY ET AL. J. VIROL. for the enhanced growth of Nef viruses but not for down-regulation of CD4. EMBO J. 14: Sawai, E. T., A. Baur, H. Struble, B. M. Peterlin, J. A. Levy, and C. Cheng- Mayer Human immunodeficiency virus type 1 Nef associates with a cellular serine kinase in T lymphocytes. Proc. Natl. Acad. Sci. USA 91: Sawai, E. T., I. H. Khan, P. M. Montbriand, C. Cheng-Mayer, and P. A. Luciw Activation of PAK by HIV and SIV Nef: importance for AIDS in rhesus macaques. Curr. Biol. 6: Sharma, D. P., L. Beltz, and M. C. Zink Pathogenesis of acute infection in rhesus macaques with a lymphocyte-tropic strain of SIVmac. J. Infect. Dis. 166: Sharma, D. P., M. C. Zink, M. G. Anderson, R. Adams, J. E. Clements, S. V. Joag, and O. Narayan Derivation of neurotropic SIV from exclusively lymphocyte-tropic parental virus: pathogenesis of infection in macaques. J. Virol. 66: Skowronski, J., D. Parks, and R. Mariani Altered T-cell activation and development in transgenic mice expressing the HIV-1 nef gene. EMBO J. 12: Watry, D., T. E. Lane, M. Streb, and H. S. Fox Transfer of neuropathogenic SIV with naturally infected microglia. Am. J. Pathol. 146: Winandy, S., B. Renjifo, Y. Li, and N. Hopkins Nuclear factors that bind two regions important to transcriptional activity of simian immunodeficiency virus long terminal repeat. J. Virol. 66: Wolfs, T. F. W., G. Zwart, M. Bakker, and J. Goudsmit HIV-1 genomic RNA diversification following sexual and parenteral virus transmission. Virology 189: Wolinsky, S. M., C. N. Wike, B. T. M. Korber, C. Hutto, W. P. Parks, L. A. Rosenblum, K. J. Kunstman, M. R. Furtado, and J. L. Munoz Selective transmission of human immunodeficiency virus type-1 variants from mothers to infants. Science 255: Zhang, L. Q., P. MacKenzie, A. Cleland, E. C. Holmes, A. J. L. Brown, and P. Simmonds Selection of specific sequences in the external envelope protein of human immunodeficiency virus type 1 upon primary infection. J. Virol. 67: Zhu, T., H. Mo, N. Wang, D. S. Nam, Y. Cao, R. A. Koup, and D. D. Ho Genotypic and phenotypic characterization of HIV-1 in patients with primary infection. Science 261: Zink, M. C., A. Amedee-Martin, J. L. Mankowski, L. Craig, A. Munoz, P. Didier, D. L. Carter, M. Murphey-Corb, and J. E. Clements. Pathogenesis of SIV encephalitis: selection and replication of neurovirulent SIV. Am. J. Pathol., in press.