Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Transcription

1 Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen, and Sally Temple Includes 3 figures and Supplemental Experimental Procedures Figure S1 related to Figure 3. Cultured Endothelial Cells Express SDF1 (A) Immunohistochemistry on cultured BPAEs for SDF1 revealed endothelial cells express the chemokine SDF1. (B) No primary antibody was added to BPAE as a control. Scale bar = 20um.

2 Figure S2 related to Figure 4: CXCR4 and CXCR7 Expression in the SVZ.

3 Immunohistochemistry on adult coronal sections. Photomicrographs were taken from a similar plane for each stain. (A) CXCR4 colocalized with GFP protein expressed from the GFAP promoter, revealing that a subset of GFAP+ cells express CXCR4 (yellow in the merged image). (B) EGFR positive cells express CXCR4. (C) A subset of doublcortin positive cells expresses CXCR4. Panels on the right are higher magnification of the SVZ. (D) E13 cortex was used as a positive control for CXCR7 immunohistochemistry on right, no primary antibody was added on the left panel as a control and pictures were taken with the same exposure times. (E) CXCR7 is not expressed in the adult SVZ. The right panel was stained with CXCR7 but showed no signal beyond the no primary antibody control. Figure S3 related to Figure 5. CXCR4 Blockade Effects on Survival and Proliferation (A) CXCR4 blockade with AMD3100 does not reduce survival or proliferation of NPCs. NPCs grown in adherent culture were treated with 0, 12.5 µg/ ml, 25µg/ml or 50µg/ml AMD3100 for 3 days. Cells were fixed and stained for the active form of caspase 3 (red) and counterstained using DAPI (blue) to label nuclei. The top two panels are phase/contrast micrographs with fluorescent overlay illustrating no obvious difference in cell morphology, caspase 3 expression or nuclear morphology between treated and non treated cells. 10 Fields per well were analyzed

4 for number of cells (Dapi positive cells) and percent of cells undergoing apoptosis (caspase 3 positive cells). Scale bar=25um. (B C) Lentiviral knockdown of CXCR4. (B)Western blot analysis of protein levels of neurospheres mock treated, transduced with H1 empty vector or 3 shcxcr4 knockdown lentivirus, illustrating decreased CXCR4 protein expression following treatment with the shcxcr4. The blot was stripped and reprobed with alpha tubulin antibody to test the amount of protein loaded into each well. (C) Transcript levels from QPCR of neurospheres transduced with H1 empty vector or two separate lentivirus small hairpin knockdown constructs designed against the untranslated 3 end (3 shcxcr4) or the open reading frame (ORF shcxcr4) of the CXCR4 gene. Data are presented as percent expression of the H1 empty vector treated transcript levels. Knockdown results in a 42% knockdown of transcript in NPCs treated with ORF shcxcr4 and a 67% decrease in transcript levels in cells treated with the 3 shcxcr4. Supplemental Experimental Procedures Immunohistochemistry SVZ whole mounts were fixed in 4% PFA for 30 minutes at room temperature and permeabalized in PBST (0.5% Triton 100 in PBS) for 1 hour. Fixed wholemounts or cells were blocked in 8 10% normal goat or donkey serum plus 1% BSA and then incubated at 4ºC in primary antibodies diluted in blocking solution for three days for wholemounts and overnight for cells, except for GFAP antibodies, which were incubated for 1 hour at room tempeture and Lex antibodies which were incubated in live cells for one hour before fixation. After washing, appropriate secondary antibodies conjugated to Alexa fluor (Invtrogen) or Cyanine or FITC (Jackson) secondary antibodies were added. Primary antibodies used were chicken anti laminin (1:500 Abcam) and rabbit anti laminin (1:500 Sigma) to detect blood vessels; rabbit anti GFAP (1:500 Dako) and guinea pig anti GLAST (1:2000 Chemicon) to detect astrocytes/nscs; rat anti CXCR4 (1:25 R&D Systems), rabbit anti EGFR (1:100 Epitomics, without triton), mouse anti SDF1 (1:50 R&D Systems), mouse anti PSA NCAM (1:800 Chemicon), goat anti doublecortin (1:400 Santa Cruz), mouse anti Nestin and Lex (1:4 Developmental Studies Hybridoma Bank), rabbit anti active

5 caspase 3 (1:500 Promega), rabbit anti olig2 (1:40,000 from Dr. Charles Stiles) chicken anti GFP (1:500 Aves Labs). Nuclear counterstaining was performed using a 1:1000 dilution of DAPI. Serum Free Slice Culture Medium This medium is a mixture of two basic media 75% DMEM and 25% CHBSS (1X Hanks Balanced Salt Solution (Gibco) with.002m HEPES buffer, 0.03M glucose, 0.001M CaCl 2, 0.001M MgSO 4 and 0.004M NaHCO 3 ). To this, we add 1mM L glutamine, 1X B 27, (Stem Cells Inc.,) 1X N2 (Gibco), 1mM N acetyl cysteine,1x Penicillin Streptomycin (Invitrogen) and 10ng/ml FGF2. FACS SVZ wholemounts were dissected from 8 12 week old Swiss Webster mice. SVZs were dissociated to single cells and incubated with mouse anti PSA NCAM (1:800 Chemicon) for 30 minutes on ice, followed by PE conjugated secondary antibody and 15ug/ml EGF Alexa Fluor 647 streptavidin complex (Invitrogen). Cells were isolated into DMEM on the basis of EGFR expression first, then PSA NCAM expression using a FACsAria (Becton Dickinson). Gates were set using appropriate negative controls. EGFR+, PSA NCAM+ or EGFR /PSA NCAM cell populations were treated with 500nM SDF1 or vehicle for 2 hours at 37ºC before being prepared for QPCR. Quantitative PCR Total RNA was isolated from FACs sorted cell populations, acutely dissociated SVZ cells, or virus treated, neurosphere expanded, adult NSCs, using an RNeasy Plus Mini (or Micro for FACs sorted cells) Kit (Qiagen). First strand cdna was prepared using Superscript III (Invitrogen) according to manufacturers'

6 protocol. Q PCR was carried out on cdna using Power SYBR Green PCR master mix (ABI) on the ABI7500 Sequence Detection System. All amplifications were done in triplicate and expression values for target genes of interest were normalized to GAPDH gene expression. PCR primer sequences used were: for CXCR4 5 TTTCAGCCAGCAGTTTCCTT 3 5 TCCTGCCCACCATCTACTTC 3 ; for EGFR 5 GTCTTCGCATGAATAGGCCAA 3 5 GCCATCTGGGCCAAAGATACC 3 for integrin alpha6 5 AGGAAGGATGTGGAGACGACAA 3 5 AAACGTGGCGATGAGTTTGGCT 3. Endothelial Conditioned Media Bovine Pulmonary Artery Endothelial cells (BPAEc, from ATCC) were grown in 6 well transwells with a pore size of 0.4µm (Costar) in 10% FBS in DMEM. When BPAEcs reached 70% confluence, the medium was changed to serum free medium. Media was collected after 3 days. Lentiviral Vector Production shrna contructs for CXCR4 were made, harvested and titered as previously described (Fasano et al., 2007).19mer oligonucleotides that target either the open reading frame (ORF) or 3 untranslated region (UTR) of CXCR4 followed by a loop sequence and then a reverse complement were constructed and cloned into the H1 lentivirus vector. Oligonucleotide sequences were as follows: CXCR4 ORF CGATCAGTGTGAGTATATA, CXCR4 3 UTR CCTTATGCAAAGACTTATA. For viral transduction lentivirus vectors at an MOI of 10 were added to dissociated adult SVZ cells after plating.