Supplemental Information
|
|
- Geoffrey McCoy
- 6 years ago
- Views:
Transcription
1 Cell Host & Microbe, Volume 14 Supplemental Information HIV-1 Induces the Formation of Stable Microtubules to Enhance Early Infection Yosef Sabo, Derek Walsh, Denis S. Barry, Sedef Tinaztepe, Kenia de los Santos, Stephen P. Goff, Gregg G. Gundersen, and Mojgan H. Naghavi
2 A. Supplemental Data Supplemental Figure Legends Figure S1, related to Figure 1. HIV-1 infection induces stable MT formation in human cells. (A) 293A cells were infected with either mock virus preparation (mock) or HIV-1-VSV at m.o.i. 3. Mock infected or HIV-1-VSV infected cells were fixed at the indicated h.p.i. and stained using anti-tyr-tubulin and anti-ac-tubulin antibodies. Scale bar, 10µm. (B-E) Quantification of the fluorescence signal intensity from IF images in Figure 1 and S1A; (B) HIV-1 infected U87.CD4.CCR5 (from Figure 1A), (C) NHDFs (from Figure 1B), (D) 293A (from S1A), or (E) CHME3 cells (from Figure 1C) normalized to that of uninfected cells. n 250 cells. (F) Quantification of the number of HIV-1 infected primary human macrophages (from Figure 1D) containing increased levels of AC-MTs. n 100 cells. (G-K) Heat-inactivated and nonenveloped viruses do not increase stable MT levels. 293A cells were infected with either mock virus preparation (mock), heat inactivated HIV-1-VSV (H.I.), HIV-1 carrying no envelope glycoproteins (No Env) or HIV-1-VSV. (G) Cells infected with heat-inactivated virus (H.I.) or HIV-1-VSV were fixed at the indicated h.p.i. and stained using anti-tyr-tubulin and anti-ac-tubulin antibodies. (H) Quantification of the fluorescence signal intensity in samples shown in G. normalized to that of the uninfected cells. n>250 cells. (I) Cells were infected with mock virus preparation (mock), No Env virus or HIV-1-VSV and processed as described in G. (J) Quantification of the fluorescence signal intensity in samples shown in I. normalized to that of the uninfected cells. n>250 cells. Scale bar, 10 µm. (K) WB analysis of HIV-1 Gag polyprotein p55 and capsid p24 levels using anti- HIV-1 p24 antibody in stock preparations of mock virus, No Env virus or HIV-1-VSV. This illustrates that viral particles lacking envelope were present in virus preparations used to infect
3 samples in C. and D. (L-N) HIV-1 infection increases stable Glu-MT levels in human cells. (L) 293A cells infected with mock virus preparation (mock) or HIV-1-VSV were fixed at the indicated h.p.i. then stained using anti-tyrosinated tubulin (Tyr-MTs) and anti-detyrosinated tubulin (Glu-MTs) antibodies. Scale bar, 10 µm. (M-N) WB analysis of the levels of acetylated (top panels) or detyrosinated (middle panels) MTs in mock infected and infected 293A (M) and CHME3 (N) cells using anti-acetylated (AC-MTs) and anti-detyrosinated (Glu-MTs) tubulin antibodies, respectively. eif4e (lower panels) was used as loading control. (O-T) HIV-1 infection increases stable MT levels in human cells regardless of the route of viral entry. 293A cells (O and R), CHME3 cells (P and S) or primary NHDFs (Q and T) were infected with mock virus preparation (mock) or HIV-1 carrying a MuLV amphotropic (HIV-1-Ampho) envelope. (O-Q) Cells were fixed at the indicated h.p.i. then stained using antityrosinated tubulin (Tyr-MTs) and anti-acelytated tubulin (AC-MTs) antibodies. Scale bar, 10 µm. (R-T) Quantification of the fluorescence signal intensity in samples in A- C normalized to that of uninfected cells. n>250 cells. Figure S2, related to Figure 4. EB1 is required for HIV-1 mediated MT stabilization. Quantification of the fluorescence (Alexafluor 488) signal intensity in IF images of mock infected and HIV-1-VSV infected cells treated with control GFP or EB1 sirnas (shown in Figures 4A and 4B, respectively) normalized to that of uninfected cells. n 250 cells. Data are represented as mean +/- SEM. Figure S3, related to Figure 6. EB1 depletion suppresses AC-MT induction by HIV-1. NHDFs were treated with control GFP or EB1 sirnas then infected with HIV-1-VSV-GFP-Vpr at m.o.i. 1 for 1h, 2h or 4h. Fixed samples were stained for (A)
4 Try-MTs (red) and EB1 (green) or (B) AC-MTs (green) and Tyr-MTs (red). Nuclei were stained with DAPI. Representative images are shown. Scale bar, 10µm. Figure S4, related to Figure 7. Expression of retroviral MA induces MT acetylation in human cells. (A) NHDF cells were transfected with control pcdna plasmid or pcdna plasmids encoding HA-tagged forms of HIV-1 MA or SIV MA. Whole cell extracts were analyzed by WB using anti-ha (to detect MA) and antiacelytated tubulin (AC-MTs) antibodies. eif4e served as loading control. (B) Kif4 is required for HIV-1-induced MT stabilization. CHME3 cells were transfected with control or Kif4 sirnas then infected with HIV-1-VSV for 6h. Fixed samples were stained for AC-MTs (green) and Tyr-MTs (red). Nuclei were stained with Hoechst. B. Supplemental Experimental Procedures Generation of viral vectors and expression constructs pnl4-3.zsgreen.r -.E - was created by replacing the luciferase gene in the pnl4-3.luc.r -.E - (AIDS Reagent Repository number 3418) (Connor et al., 1995) with the ZsGreen gene. Briefly, the ZsGreen ORF was amplified from plvx-zsgreen-n1 (Clontech) using primers 1 and 11 in Table S1 and ligated into pjet1.2. pjet1.2- zsgreen and pnl4-3.luc.r -.E - were digested with NotI and XhoI and the ZsGreen fragment was ligated into pnl4-3 to create pnl4-3.zsgreen.r -.E -. To generate HIV- 1 carrying a luciferase reporter or ZsGreen marker, pnl4-3.luc.r -.E - or pnl4-3.zsgreen.r -.E - were transfected into 293T cells together with plasmids expressing VSV-G (PMDG), MuLV amphotropic (phit456) or HIV-1 CCR5 tropic (pci-env) envelope glycoprotein (Naldini et al., 1996; Pugach et al., 2007; Soneoka et al.,
5 1995). Pseudotyped HIV-1-zsGreen virus was quantified as described (Sabo et al. 2011). Expression constructs encoding C-terminally HA-tagged HIV-1 Gag and MA were generated by PCR amplification from Rev-independent pgag-egfp (Hermida- Matsumoto and Resh, 2000), using primers 2 and 12 or 2 and 13 in Table S1, respectively, cloned into pcdna3.1-. The pcdna3.1 Gag-HA construct was then used as PCR template to generate constructs lacking 20 amino acids at the C terminus (-20) or the N terminus (-100) in the MA domain using the primers indicated in Table S1 (primers 8, 18 and 9,19, respectively). PCR products were sequenced and used to replace the wt sequence using the AgeI and XbaI restriction sites. Gag-HA with a single point mutation (N-Myr) MA G1A was created by annealing primers 7 and 17 (Table S1) and replacing the wt MA sequence using ClaI and XbaI in the pcdna3.1gag-ha construct. C-terminally HA-tagged SIV mac239 MA was generated by PCR amplification from VI-SIVmc(FL) (Zhang et al., 2009) plasmid, using primers 10 and 20 (Table S1), cloned into pcdna3.1- using XbaI and EcoRI. C-terminal and Full-length C-terminally Flag-tagged EB1 was amplified using cdna from 293T cells as template using the primers 4 and 10 in Table S1. This construct was then used as template to produce N-terminally truncated EB1 containing a C terminal Flag-tag using the primers 5 and 10 in Table S1. The restriction enzyme sites are in italics, and the Flag peptide sequence is underlined. EB1-Flag (full-length EB1) or EB1-C-Flag (truncated EB1) PCR products were then cloned into a MuLV based retroviral vector pqcxin (Clontech), and the inserts were confirmed by sequencing. VSV-G pseudotyped viral vectors (MuLV-VSV-neo) encoding EB1-Flag and EB1-C- Flag were produced by co-transfection of HEK239T cells with these pqcxin
6 plasmids together with MoMuLV Gag-Pol expressing vector (pcmvinteron) and VSV-G (PMDG) constructs (Naldini et al., 1996). HIV-1 fusion measurement Cells were infected for 2h with ZsGreen-HIV-1-VSV containing the BlaM-Vpr fusion protein (Addgene plasmid 21950; (Cavrois et al., 2002)) then washed with CO 2 independent medium and loaded with the CCF2/AM substrate together with 2.5mM probenecid for 2h according to the manufacturers instructions (Invitrogen). Samples were washed and incubated with CO 2 independent medium supplemented with 10% FBS for 16h at RT then washed with PBS and fixed with 1.2% paraformaldehyde overnight. CCF2 cleavage was monitored using a five-laser BD LSRII (Becton Dickinson, San Jose, CA). C. Supplemental References Cavrois, M., De Noronha, C., and Greene, W. C. (2002). A sensitive and specific enzyme-based assay detecting HIV-1 virion fusion in primary T lymphocytes. Nat Biotechnol 20, Connor, R. I., Chen, B. K., Choe, S., and Landau, N. R. (1995). Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology 206, Hermida-Matsumoto, L., and Resh, M. D. (2000). Localization of human immunodeficiency virus type 1 Gag and Env at the plasma membrane by confocal imaging. J Virol 74,
7 Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M., and Trono, D. (1996). In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272, Pugach, P., Marozsan, A. J., Ketas, T. J., Landes, E. L., Moore, J. P., and Kuhmann, S. E. (2007). HIV-1 clones resistant to a small molecule CCR5 inhibitor use the inhibitor-bound form of CCR5 for entry. Virology 361, Sabo, Y., Ehrlich, M., and Bacharach, E. (2011). The conserved YAGL motif in human metapneumovirus is required for higher-order cellular assemblies of the matrix protein and for virion production. Journal of virology 85, Soneoka, Y., Cannon, P. M., Ramsdale, E. E., Griffiths, J. C., Romano, G., Kingsman, S. M., and Kingsman, A. J. (1995). A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res 23, Zhang, F., Wilson, S. J., Landford, W. C., Virgen, B., Gregory, D., Johnson, M. C., Munch, J., Kirchhoff, F., Bieniasz, P. D., and Hatziioannou, T. (2009). Nef proteins from simian immunodeficiency viruses are tetherin antagonists. Cell Host Microbe 6,
8
9
10 Fold change intensity normalized to N.I GFP Mock GFP HIV-1 EB1 Mock EB1 HIV-1 H.P.I. 2 6
11
12
13 Table S1. Primer sequences Forward Primers Number and Name Sequence (5' 3') * 1. ZsGreen ORF-S ACGAATAGCGCGGCCGCATGGCCCAGTCCAAGCACGGCCTGACC 2. XbaI-Kozak-Gag/MA GAGCGTCTAGAACCATGGGTGCGAGAGCGTCAGTA 3. heb1-s CTGTATGCCACAGATGAAGG 4. heb1-s-noti GCAACTGCGGCCGCCATGGCAGTGAACGTATACTCAAC 5. heb1-c-s-noti GCAACTGCGGCCGCCATGTCAACACAGAGAACCGCTGC 6. MA fw TCTAGAACCATGGGTGCGAGAGCGTCAGTATTAAGCGGG 7. MA no myr fw CTAGAACCATGGCTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGAT 8. MA del 20c fw GATAGAGGAAGAGCAAAACAAGTCCAAGAAGCCTATAGTGCAGAACATCCAGGGGC 9. MA del100c fw GGGAAAGAAGAAGTACAAGCTAAAGCACATCGAAGGCTGTAGACAAATACTGGGACAG 10. SIV MA fw CTCTAGAACCATGGGCGTGAGAAACTCCGTCTTGTCAGGG Reverse Primers 11. ZsGreen ORF-A AAACTCGAGTTAGGGCAAGGCGGAGCCGGAGG 12. Gag-HA-TAA-EcoRI TTGCCGAATTCTTAAGCGTAATCTGGAACATCGTATGGGTATTGTGACGAGGGGTCGTTG 13. MA-HA-TAA-EcoRI TTCTGGAATTCTTAAGCGTAATCTGGAACATCGTATGGGTAGTAATTTTGGCTGACCTG 14. heb1-a CCAGACACAATGTCAAACGC 15. heb1-a-flag-bamhi GCAACGGGATCCTTACTTGTCGTCATCGTCTTTGTAGTCATACTCTTCTTGCTCCTCCTG 16. MA rev ACCGGTCTACATAGTCTCTAAAGGGTTCTTTTGGTCC 17. MA no myr rev CGATCTAATTCTCCCCCGCTTAATACTGACGCTCTCGCAGCCATGGTT 18. MA del 20c rev GCCCCTGGATGTTCTGCACTATAGGCTTCTTGGACTTGTTTTGCTCTTCCTCTATC 19. MA del100 rev CTGTCCCAGTATTTGTCTACAGCCTTCGATGTGCTTTAGCTTGTACTTCTTCTTTCCC 20. SIV MA-HA rev GGAATTCTTAAGCGTAATCTGGAACATCGTATGGGTAGTAATTTCCTCCTCTGCCGC *: Restriction sites are shown in bold; tag sequences (HA or Flag) are underlined.
VIROLOGY. Engineering Viral Genomes: Retrovirus Vectors
VIROLOGY Engineering Viral Genomes: Retrovirus Vectors Viral vectors Retrovirus replicative cycle Most mammalian retroviruses use trna PRO, trna Lys3, trna Lys1,2 The partially unfolded trna is annealed
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationThe intracellular transport and subcellular localization of
Distinct functions of diaphanous-related formins regulate HIV-1 uncoating and transport Michael Keegan Delaney a, Viacheslav Malikov a, Qingqing Chai a, Guangyuan Zhao a, and Mojgan H. Naghavi a,1 a Department
More informationSupplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR
Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4
More informationSupporting Information
Supporting Information Zhu et al. 1.173/pnas.11167618 SI Materials and Methods DNA Construction. The plasmid pcdna4to/myc-rzap, which expresses myc-tagged full-length rat ZAP, has been described previously
More informationDNA context and promoter activity affect gene expression in lentiviral vectors
ACTA BIOMED 2008; 79: 192-196 Mattioli 1885 O R I G I N A L A R T I C L E DNA context and promoter activity affect gene expression in lentiviral vectors Gensheng Mao 1, Francesco Marotta 2, Jia Yu 3, Liang
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationSUPPLEMENTARY INFORMATION
sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing
More informationQuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24)
Product Manual QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24) Catalog Number VPK-107 VPK-107-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction
More informationSupplementary Material
Supplementary Material Nuclear import of purified HIV-1 Integrase. Integrase remains associated to the RTC throughout the infection process until provirus integration occurs and is therefore one likely
More informationVIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer
VIRAL TITER COUNTS The best methods of measuring infectious lentiviral titer FLUORESCENCE CYCLES qpcr of Viral RNA SUMMARY Viral vectors are now routinely used for gene transduction in a wide variety of
More informationViral Vectors In The Research Laboratory: Just How Safe Are They? Dawn P. Wooley, Ph.D., SM(NRM), RBP, CBSP
Viral Vectors In The Research Laboratory: Just How Safe Are They? Dawn P. Wooley, Ph.D., SM(NRM), RBP, CBSP 1 Learning Objectives Recognize hazards associated with viral vectors in research and animal
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationQuickTiter Lentivirus Quantitation Kit (HIV p24 ELISA)
New and Improved Product Manual QuickTiter Lentivirus Quantitation Kit (HIV p24 ELISA) Catalog Numbers VPK-108-HIV-p24 96 tests VPK-108-HIV-p24-5 5 x 96 tests FOR RESEARCH USE ONLY Not for use in diagnostic
More informationVif Proteins of Human and Simian Immunodeficiency Viruses Require Cellular CBFβ to Degrade APOBEC3 Restriction Factors
JVI Accepts, published online ahead of print on 28 December 2011 J. Virol. doi:10.1128/jvi.06950-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13
More informationFigure S1. Schematic presentation of genomic replication of idsiv after transfection and infection. After transfection of idsiv plasmid DNA into 293T
Figure S1. Schematic presentation of genomic replication of idsiv after transfection and infection. After transfection of idsiv plasmid DNA into 293T cells, the RNA genomes with all modifications are generated
More informationGene transfer into stimulated and unstimulated T lymphocytes by HIV-1-derived lentiviral vectors
(2000) 7, 596 604 2000 Macmillan Publishers Ltd All rights reserved 0969-7128/00 $15.00 www.nature.com/gt VIRAL TRANSFER TECHNOLOGY RESEARCH ARTICLE Gene transfer into stimulated and unstimulated T lymphocytes
More informationSupporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
More informationTel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
More informationRecombinant Protein Expression Retroviral system
Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential
More information~Lentivirus production~
~Lentivirus production~ May 30, 2008 RNAi core R&D group member Lentivirus Production Session Lentivirus!!! Is it health threatening to lab technician? What s so good about this RNAi library? How to produce
More informationIdentification of Mutation(s) in. Associated with Neutralization Resistance. Miah Blomquist
Identification of Mutation(s) in the HIV 1 gp41 Subunit Associated with Neutralization Resistance Miah Blomquist What is HIV 1? HIV-1 is an epidemic that affects over 34 million people worldwide. HIV-1
More informationChoosing Between Lentivirus and Adeno-associated Virus For DNA Delivery
Choosing Between Lentivirus and Adeno-associated Virus For DNA Delivery Presenter: April 12, 2017 Ed Davis, Ph.D. Senior Application Scientist GeneCopoeia, Inc. Outline Introduction to GeneCopoeia Lentiviral
More informationClinical Significance of Human Immunodeficiency Virus Type 1 Replication Fitness
CLINICAL MICROBIOLOGY REVIEWS, Oct. 2007, p. 550 578 Vol. 20, No. 4 0893-8512/07/$08.00 0 doi:10.1128/cmr.00017-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Clinical Significance
More informationRabies virus-like particles expressed in HEK293 cells
Engineering Conferences International ECI Digital Archives Vaccine Technology IV Proceedings Spring 5-21-2012 Rabies virus-like particles expressed in HEK293 cells Diego Fontana Cell Culture Laboratory
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD
More informationRole of Matrix in an Early Postentry Step in the Human Immunodeficiency Virus Type 1 Life Cycle
JOURNAL OF VIROLOGY, May 1998, p. 4116 4126 Vol. 72, No. 5 0022-538X/98/$04.00 0 Copyright 1998, American Society for Microbiology Role of Matrix in an Early Postentry Step in the Human Immunodeficiency
More informationChoosing Optimal Viral Vector for T-cell Transduction. Viral vectors for blood cells
Choosing Optimal Viral Vector for T-cell Transduction Max Mamonkin, PhD Center for Cell and Gene Therapy Baylor College of Medicine PACT Webinar Nov 08, 2018 Viral for blood cells Short/long term gene
More informationFayth K. Yoshimura, Ph.D. September 7, of 7 RETROVIRUSES. 2. HTLV-II causes hairy T-cell leukemia
1 of 7 I. Diseases Caused by Retroviruses RETROVIRUSES A. Human retroviruses that cause cancers 1. HTLV-I causes adult T-cell leukemia and tropical spastic paraparesis 2. HTLV-II causes hairy T-cell leukemia
More informationReceived 30 January 2002/Accepted 18 December 2002
JOURNAL OF VIROLOGY, Mar. 2003, p. 3634 3646 Vol. 77, No. 6 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.6.3634 3646.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Rational Site-Directed
More informationFayth K. Yoshimura, Ph.D. September 7, of 7 HIV - BASIC PROPERTIES
1 of 7 I. Viral Origin. A. Retrovirus - animal lentiviruses. HIV - BASIC PROPERTIES 1. HIV is a member of the Retrovirus family and more specifically it is a member of the Lentivirus genus of this family.
More informationConstitutive Reporter Lentiviral Vectors Expressing Fluorescent Proteins
Constitutive Reporter Lentiviral Vectors Expressing Fluorescent Proteins www.vectalys.com/products/ Constitutive Reporter Lentiviral Vectors Catalog Number referring to this User Manual: 0008VCT; 0009VCT;
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More information33VASTVNGATSANNHGEPPS51PADARPR58
Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation
More informationDevelopment of Multigene and Regulated Lentivirus Vectors
JOURNAL OF VIROLOGY, Nov. 2000, p. 10589 10599 Vol. 74, No. 22 0022-538X/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Development of Multigene and Regulated Lentivirus
More informationSubcellular Localization of Feline Immunodeficiency Virus Integrase and Mapping of Its Karyophilic Determinant
JOURNAL OF VIROLOGY, Apr. 2003, p. 4516 4527 Vol. 77, No. 8 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.8.4516 4527.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Subcellular
More informationSupplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
More informationUnder the Radar Screen: How Bugs Trick Our Immune Defenses
Under the Radar Screen: How Bugs Trick Our Immune Defenses Session 7: Cytokines Marie-Eve Paquet and Gijsbert Grotenbreg Whitehead Institute for Biomedical Research HHV-8 Discovered in the 1980 s at the
More informationMulti-step inhibition explains HIV-1 protease inhibitor pharmacodynamics and resistance
Research article Related article, page 3704 Multi-step inhibition explains HIV-1 protease inhibitor pharmacodynamics and resistance S. Alireza Rabi, 1 Gregory M. Laird, 1 Christine M. Durand, 1 Sarah Laskey,
More informationINI1/hSNF5-interaction defective HIV-1 IN mutants exhibit impaired particle morphology, reverse transcription and integration in vivo
Mathew et al. Retrovirology 213, 1:66 RESEARCH Open Access INI1/hSNF5-interaction defective HIV-1 IN mutants exhibit impaired particle morphology, reverse transcription and integration in vivo Sheeba Mathew
More informationCURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES
[Frontiers in Bioscience 5, d527-555, May 1, 2000] CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES Betty Lamothe, Sadhna Joshi Department of Medical
More informationHIV fusion in Dendritic cells mainly occurs at the surface and is limited by low CD4 levels.
JVI Accepted Manuscript Posted Online 16 August 2017 J. Virol. doi:10.1128/jvi.01248-17 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationPre-made Lentiviral Particles for Fluorescent Proteins
Pre-made Lentiviral Particles for Fluorescent Proteins Catalog# Product Name Amounts Fluorescent proteins expressed under sucmv promoter: LVP001 LVP001-PBS LVP002 LVP002-PBS LVP011 LVP011-PBS LVP012 LVP012-PBS
More informationThere are approximately 30,000 proteasomes in a typical human cell Each proteasome is approximately 700 kda in size The proteasome is made up of 3
Proteasomes Proteasomes Proteasomes are responsible for degrading proteins that have been damaged, assembled improperly, or that are of no profitable use to the cell. The unwanted protein is literally
More informationMedChem 401~ Retroviridae. Retroviridae
MedChem 401~ Retroviridae Retroviruses plus-sense RNA genome (!8-10 kb) protein capsid lipid envelop envelope glycoproteins reverse transcriptase enzyme integrase enzyme protease enzyme Retroviridae The
More informationJOHN G. JULIAS, ANDREA L. FERRIS, PAUL L. BOYER, AND STEPHEN H. HUGHES* HIV-Drug Resistance Program, NCI-Frederick, Frederick, Maryland
JOURNAL OF VIROLOGY, July 2001, p. 6537 6546 Vol. 75, No. 14 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.14.6537 6546.2001 Replication of Phenotypically Mixed Human Immunodeficiency Virus Type 1 Virions
More informationRetroviruses. ---The name retrovirus comes from the enzyme, reverse transcriptase.
Retroviruses ---The name retrovirus comes from the enzyme, reverse transcriptase. ---Reverse transcriptase (RT) converts the RNA genome present in the virus particle into DNA. ---RT discovered in 1970.
More informationQuantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles
Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Amin Feizpour Reinhard Lab Department of Chemistry and the Photonics Center, Boston University, Boston, MA May 2014
More informationHuman Immunodeficiency Virus
Human Immunodeficiency Virus Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Viruses and hosts Lentivirus from Latin lentis (slow), for slow progression of disease
More informationI m B m. 1 f ub I B. D m B. f u. 1 f ua 1 D I A. I A m. D m A. f a. 1 f u. D m B ) D m A )(I m B. 1 f ua. 1 (I m A. log (I A. log f.
Supplementary Material Appendix 1 Here we show that independent inhibition by a single drug of two distinct steps (A and ) in the viral life cycle results in a non-linear median effect dose-response curve
More informationReceived 19 May 2004/Accepted 13 September 2004
JOURNAL OF VIROLOGY, Feb. 2005, p. 1666 1677 Vol. 79, No. 3 0022-538X/05/$08.00 0 doi:10.1128/jvi.79.3.1666 1677.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. Genetic Recombination
More informationFigure S1! CrFK! DNA Synthesis! Copies viral DNA/ 100 ng DNA (Log 10 ) % Infected (GFP+) cells! 100! 80! 60! 40! 20! 0! 1! 10! 100! 1000!
Figure S1! A! B! % Infected (GFP+) cells! 100! 80! 60! 40! 20! 0! 1! 10! 100! 1000! Dose μl! CrFK! B-MLV! N-MLV! Template:! Water! Ube2V2! Ube2V1! Primers:! V2! V1! V2! V1! V2! V1! bp! 500! 300! 200! 150!
More informationMaterials and Methods , The two-hybrid principle.
The enzymatic activity of an unknown protein which cleaves the phosphodiester bond between the tyrosine residue of a viral protein and the 5 terminus of the picornavirus RNA Introduction Every day there
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected
More informationPre-made Reporter Lentivirus for MAPK/ERK Signal Pathway
Pre-made Reporter for MAPK/ERK Signal Pathway Cat# Product Name Amounts LVP957-P or: LVP957-P-PBS SRE-GFP (Puro) LVP958-P or: LVP958-P-PBS SRE-RFP (Puro) LVP959-P or: LVP959-P-PBS SRE-Luc (Puro) LVP960-P
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing
More informationNBP Protocol. Orders: Support: Web: NBP
NBP2-29541 NBP2-29541 Protocol Orders: orders@novusbio.com Support: technical@novusbio.com Web: www.novusbio.com Protocols, Publications, Related Products, Reviews and more: www.novusbio.com/nbp2-29541
More informationPre-made Reporter Lentivirus for JAK-STAT Signaling Pathway
Pre-made Reporter for JAK-STAT Signaling Pathway Cat# Product Name Amounts LVP937-P or: LVP937-P-PBS ISRE-GFP (Puro) LVP938-P or: LVP938-P-PBS ISRE-RFP (Puro) LVP939-P or: LVP939-P-PBS ISRE-Luc (Puro)
More informationInterferon-Inducible CD169/Siglec1 Attenuates Anti-HIV-1 Effects of IFN-α
JVI Accepted Manuscript Posted Online 9 August 2017 J. Virol. doi:10.1128/jvi.00972-17 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 Interferon-Inducible CD169/Siglec1 Attenuates
More informationNature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
More informationThis training module is required for all personnel listed on an IBC protocol that describes work utilizing viral vectors (both replication competent
This training module is required for all personnel listed on an IBC protocol that describes work utilizing viral vectors (both replication competent and incompetent) regardless of the biosafety level used
More informationHIV INFECTION: An Overview
HIV INFECTION: An Overview UNIVERSITY OF PAPUA NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL MBBS II SEMINAR VJ
More informationInhibition of trna 3 Lys -Primed Reverse Transcription by Human APOBEC3G during Human Immunodeficiency Virus Type 1 Replication
JOURNAL OF VIROLOGY, Dec. 2006, p. 11710 11722 Vol. 80, No. 23 0022-538X/06/$08.00 0 doi:10.1128/jvi.01038-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Inhibition of trna
More informationGamma-interferon-inducible, lysosome/endosome-localized thiolreductase, GILT, has anti-retroviral activity and its expression is counteracted by HIV-1
Gamma-interferon-inducible, lysosome/endosome-localized thiolreductase, GILT, has anti-retroviral activity and its expression is counteracted by HIV-1 The Harvard community has made this article openly
More informationInterplay between HIV Entry and Transportin-SR2 Dependency
Retrovirology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Interplay between HIV Entry
More informationFIG S1 Examination of eif4b expression after virus infection. (A) A549 cells
Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed
More informationSupplementary Information. Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases
Supplementary Information Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases Ulrike Mock 1, Kristoffer Riecken 1, Belinda Berdien 1, Waseem Qasim 2, Emma Chan
More informationPrimate lentiviral Vpx commandeers DDB1 to counteract a macrophage restriction
University of Massachusetts Medical School escholarship@umms Open Access Articles Open Access Publications by UMMS Authors 5-3-2008 Primate lentiviral Vpx commandeers DDB1 to counteract a macrophage restriction
More informationReceived 26 October 2005/Accepted 1 December 2005
JOURNAL OF VIROLOGY, Feb. 2006, p. 1939 1948 Vol. 80, No. 4 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.4.1939 1948.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Human Immunodeficiency
More informationGelsolin activity controls efficient early HIV-1 infection
García-Expósito et al. Retrovirology 2013, 10:39 RESEARCH Open Access Gelsolin activity controls efficient early HIV-1 infection Laura García-Expósito 1, Serena Ziglio 1,2, Jonathan Barroso-González 1,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
More informationare considered to be dead end products of reverse transcription
JOURNAL OF VIROLOGY, Sept. 2001, p. 7944 7955 Vol. 75, No. 17 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.17.7944 7955.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Human Immunodeficiency
More informationDoctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSupplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): Nature Communications manuscript number NCOMMS-16-15882, by Miyakawa et al. presents an intriguing analysis of the effects of the tumor suppressor
More informationHIV/AIDS. Biology of HIV. Research Feature. Related Links. See Also
6/1/2011 Biology of HIV Biology of HIV HIV belongs to a class of viruses known as retroviruses. Retroviruses are viruses that contain RNA (ribonucleic acid) as their genetic material. After infecting a
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/6/e1700338/dc1 Supplementary Materials for HIV virions sense plasma membrane heterogeneity for cell entry Sung-Tae Yang, Alex J. B. Kreutzberger, Volker Kiessling,
More informationModified Cell Entry by Exhibiting of Hemagglutinin from Avian. Influenza Virus on Pseudotyped HIV Particles
ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 4 24 (4) :366 372 HA HIV 1),2), 1),2) 3, 1),2) 1),2), ( 1), 430070 ; 2), 430070) HA HIV, HA ( HIVΠH52HA), RT2PCR H5N1
More informationFeb 11, Gene Therapy. Sam K.P. Kung Immunology Rm 417 Apotex Center
Gene Therapy Sam K.P. Kung Immunology Rm 417 Apotex Center Objectives: The concept of gene therapy, and an introduction of some of the currently used gene therapy vector Undesirable immune responses to
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationJOURNAL OF VIROLOGY, Jan. 1999, p Vol. 73, No. 1. Copyright 1999, American Society for Microbiology. All Rights Reserved.
JOURNAL OF VIROLOGY, Jan. 1999, p. 19 28 Vol. 73, No. 1 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Mutational Analysis of the Hydrophobic Tail of the
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.10/nature10195 NCBI gene: Tagged Subunit(s: HA-Vpx; FLAG-Cul4 HA-DCAF1 FLAG-Cul4 HA-FLAG-Vpx Mock Vpx (SIVmac 100 (a ; 0.159 (b ; 0.05 DCAF1 DDB1 DDA1 Cul4A 1; 0.024591
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationQin Yu and Casey D. Morrow 1. Department of Microbiology, University of Alabama at Birmingham, Birmingham, Alabama 35294
Virology 254, 160 168 (1999) Article ID viro.1998.9542, available online at http://www.idealibrary.com on Complementarity between 3 Terminal Nucleotides of trna and Primer Binding Site Is a Major Determinant
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationSUPPLEMENTARY FIG. S1. MVC inhibition curves in NP2-CD4/CCR5 cells. Luciferase reporter viruses pseudotyped with baseline (black solid lines) and MVC
Supplementary Data SUPPLEMENTARY FIG. S1. MVC inhibition curves in NP2-CD4/CCR5 cells. Luciferase reporter viruses pseudotyped with baseline (black solid lines) and MVC failure Envs (black dotted lines)
More informationMinimum Requirements for Efficient Transduction of Dividing and Nondividing Cells by Feline Immunodeficiency Virus Vectors
JOURNAL OF VIROLOGY, June 1999, p. 4991 5000 Vol. 73, No. 6 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Minimum Requirements for Efficient Transduction
More informationAnalysis of Vif-induced APOBEC3G degradation using an α-complementation assay
Virology 359 (2007) 162 169 www.elsevier.com/locate/yviro Analysis of Vif-induced APOBEC3G degradation using an α-complementation assay Lei Fang, Nathaniel R. Landau Infectious Disease Laboratory, The
More informationA Multicistronic DNA Vaccine Induces Significant Protection against Tuberculosis in Mice and Offers Flexibility in the Expressed Antigen Repertoire.
Company LOGO A Multicistronic DNA Vaccine Induces Significant Protection against Tuberculosis in Mice and Offers Flexibility in the Expressed Antigen Repertoire. Fayaz Ahmad Mir, Stefan H. E. Kaufmann,
More informationSupplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
More informationQuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24)
Product Manual QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24) Catalog Number VPK-107 VPK-107-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction
More informationIFITM proteins are incorporated onto HIV-1 virion particles and negatively imprint their infectivity
Tartour et al. Retrovirology 2014, 11:103 RESEARCH Open Access IFITM proteins are incorporated onto HIV-1 virion particles and negatively imprint their infectivity Kevin Tartour 1,2,3,4,5, Romain Appourchaux
More informationVirology 415 (2011) Contents lists available at ScienceDirect. Virology. journal homepage:
Virology 415 (2011) 95 106 Contents lists available at ScienceDirect Virology journal homepage: www.elsevier.com/locate/yviro Targeting the HIV entry, assembly and release pathways for anti-hiv gene therapy
More informationRole of ESCRT-I in Retroviral Budding
JOURNAL OF VIROLOGY, Apr. 2003, p. 4794 4804 Vol. 77, No. 8 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.8.4794 4804.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Role of ESCRT-I
More informationCertificate of Analysis
Certificate of Analysis plvx-ef1α-ires-puro Vector Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No.
More informationHIV & AIDS: Overview
HIV & AIDS: Overview UNIVERSITY OF PAPUA NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL SEMINAR VJ TEMPLE 1 What
More informationCertificate of Analysis
Certificate of Analysis Catalog No. Amount Lot Number 631987 10 μg Specified on product label. Product Information plvx-ef1α-ires-mcherry is a bicistronic lentiviral expression vector that can be used
More information