Supplemental Information

Size: px
Start display at page:

Download "Supplemental Information"

Transcription

1 Cell Host & Microbe, Volume 14 Supplemental Information HIV-1 Induces the Formation of Stable Microtubules to Enhance Early Infection Yosef Sabo, Derek Walsh, Denis S. Barry, Sedef Tinaztepe, Kenia de los Santos, Stephen P. Goff, Gregg G. Gundersen, and Mojgan H. Naghavi

2 A. Supplemental Data Supplemental Figure Legends Figure S1, related to Figure 1. HIV-1 infection induces stable MT formation in human cells. (A) 293A cells were infected with either mock virus preparation (mock) or HIV-1-VSV at m.o.i. 3. Mock infected or HIV-1-VSV infected cells were fixed at the indicated h.p.i. and stained using anti-tyr-tubulin and anti-ac-tubulin antibodies. Scale bar, 10µm. (B-E) Quantification of the fluorescence signal intensity from IF images in Figure 1 and S1A; (B) HIV-1 infected U87.CD4.CCR5 (from Figure 1A), (C) NHDFs (from Figure 1B), (D) 293A (from S1A), or (E) CHME3 cells (from Figure 1C) normalized to that of uninfected cells. n 250 cells. (F) Quantification of the number of HIV-1 infected primary human macrophages (from Figure 1D) containing increased levels of AC-MTs. n 100 cells. (G-K) Heat-inactivated and nonenveloped viruses do not increase stable MT levels. 293A cells were infected with either mock virus preparation (mock), heat inactivated HIV-1-VSV (H.I.), HIV-1 carrying no envelope glycoproteins (No Env) or HIV-1-VSV. (G) Cells infected with heat-inactivated virus (H.I.) or HIV-1-VSV were fixed at the indicated h.p.i. and stained using anti-tyr-tubulin and anti-ac-tubulin antibodies. (H) Quantification of the fluorescence signal intensity in samples shown in G. normalized to that of the uninfected cells. n>250 cells. (I) Cells were infected with mock virus preparation (mock), No Env virus or HIV-1-VSV and processed as described in G. (J) Quantification of the fluorescence signal intensity in samples shown in I. normalized to that of the uninfected cells. n>250 cells. Scale bar, 10 µm. (K) WB analysis of HIV-1 Gag polyprotein p55 and capsid p24 levels using anti- HIV-1 p24 antibody in stock preparations of mock virus, No Env virus or HIV-1-VSV. This illustrates that viral particles lacking envelope were present in virus preparations used to infect

3 samples in C. and D. (L-N) HIV-1 infection increases stable Glu-MT levels in human cells. (L) 293A cells infected with mock virus preparation (mock) or HIV-1-VSV were fixed at the indicated h.p.i. then stained using anti-tyrosinated tubulin (Tyr-MTs) and anti-detyrosinated tubulin (Glu-MTs) antibodies. Scale bar, 10 µm. (M-N) WB analysis of the levels of acetylated (top panels) or detyrosinated (middle panels) MTs in mock infected and infected 293A (M) and CHME3 (N) cells using anti-acetylated (AC-MTs) and anti-detyrosinated (Glu-MTs) tubulin antibodies, respectively. eif4e (lower panels) was used as loading control. (O-T) HIV-1 infection increases stable MT levels in human cells regardless of the route of viral entry. 293A cells (O and R), CHME3 cells (P and S) or primary NHDFs (Q and T) were infected with mock virus preparation (mock) or HIV-1 carrying a MuLV amphotropic (HIV-1-Ampho) envelope. (O-Q) Cells were fixed at the indicated h.p.i. then stained using antityrosinated tubulin (Tyr-MTs) and anti-acelytated tubulin (AC-MTs) antibodies. Scale bar, 10 µm. (R-T) Quantification of the fluorescence signal intensity in samples in A- C normalized to that of uninfected cells. n>250 cells. Figure S2, related to Figure 4. EB1 is required for HIV-1 mediated MT stabilization. Quantification of the fluorescence (Alexafluor 488) signal intensity in IF images of mock infected and HIV-1-VSV infected cells treated with control GFP or EB1 sirnas (shown in Figures 4A and 4B, respectively) normalized to that of uninfected cells. n 250 cells. Data are represented as mean +/- SEM. Figure S3, related to Figure 6. EB1 depletion suppresses AC-MT induction by HIV-1. NHDFs were treated with control GFP or EB1 sirnas then infected with HIV-1-VSV-GFP-Vpr at m.o.i. 1 for 1h, 2h or 4h. Fixed samples were stained for (A)

4 Try-MTs (red) and EB1 (green) or (B) AC-MTs (green) and Tyr-MTs (red). Nuclei were stained with DAPI. Representative images are shown. Scale bar, 10µm. Figure S4, related to Figure 7. Expression of retroviral MA induces MT acetylation in human cells. (A) NHDF cells were transfected with control pcdna plasmid or pcdna plasmids encoding HA-tagged forms of HIV-1 MA or SIV MA. Whole cell extracts were analyzed by WB using anti-ha (to detect MA) and antiacelytated tubulin (AC-MTs) antibodies. eif4e served as loading control. (B) Kif4 is required for HIV-1-induced MT stabilization. CHME3 cells were transfected with control or Kif4 sirnas then infected with HIV-1-VSV for 6h. Fixed samples were stained for AC-MTs (green) and Tyr-MTs (red). Nuclei were stained with Hoechst. B. Supplemental Experimental Procedures Generation of viral vectors and expression constructs pnl4-3.zsgreen.r -.E - was created by replacing the luciferase gene in the pnl4-3.luc.r -.E - (AIDS Reagent Repository number 3418) (Connor et al., 1995) with the ZsGreen gene. Briefly, the ZsGreen ORF was amplified from plvx-zsgreen-n1 (Clontech) using primers 1 and 11 in Table S1 and ligated into pjet1.2. pjet1.2- zsgreen and pnl4-3.luc.r -.E - were digested with NotI and XhoI and the ZsGreen fragment was ligated into pnl4-3 to create pnl4-3.zsgreen.r -.E -. To generate HIV- 1 carrying a luciferase reporter or ZsGreen marker, pnl4-3.luc.r -.E - or pnl4-3.zsgreen.r -.E - were transfected into 293T cells together with plasmids expressing VSV-G (PMDG), MuLV amphotropic (phit456) or HIV-1 CCR5 tropic (pci-env) envelope glycoprotein (Naldini et al., 1996; Pugach et al., 2007; Soneoka et al.,

5 1995). Pseudotyped HIV-1-zsGreen virus was quantified as described (Sabo et al. 2011). Expression constructs encoding C-terminally HA-tagged HIV-1 Gag and MA were generated by PCR amplification from Rev-independent pgag-egfp (Hermida- Matsumoto and Resh, 2000), using primers 2 and 12 or 2 and 13 in Table S1, respectively, cloned into pcdna3.1-. The pcdna3.1 Gag-HA construct was then used as PCR template to generate constructs lacking 20 amino acids at the C terminus (-20) or the N terminus (-100) in the MA domain using the primers indicated in Table S1 (primers 8, 18 and 9,19, respectively). PCR products were sequenced and used to replace the wt sequence using the AgeI and XbaI restriction sites. Gag-HA with a single point mutation (N-Myr) MA G1A was created by annealing primers 7 and 17 (Table S1) and replacing the wt MA sequence using ClaI and XbaI in the pcdna3.1gag-ha construct. C-terminally HA-tagged SIV mac239 MA was generated by PCR amplification from VI-SIVmc(FL) (Zhang et al., 2009) plasmid, using primers 10 and 20 (Table S1), cloned into pcdna3.1- using XbaI and EcoRI. C-terminal and Full-length C-terminally Flag-tagged EB1 was amplified using cdna from 293T cells as template using the primers 4 and 10 in Table S1. This construct was then used as template to produce N-terminally truncated EB1 containing a C terminal Flag-tag using the primers 5 and 10 in Table S1. The restriction enzyme sites are in italics, and the Flag peptide sequence is underlined. EB1-Flag (full-length EB1) or EB1-C-Flag (truncated EB1) PCR products were then cloned into a MuLV based retroviral vector pqcxin (Clontech), and the inserts were confirmed by sequencing. VSV-G pseudotyped viral vectors (MuLV-VSV-neo) encoding EB1-Flag and EB1-C- Flag were produced by co-transfection of HEK239T cells with these pqcxin

6 plasmids together with MoMuLV Gag-Pol expressing vector (pcmvinteron) and VSV-G (PMDG) constructs (Naldini et al., 1996). HIV-1 fusion measurement Cells were infected for 2h with ZsGreen-HIV-1-VSV containing the BlaM-Vpr fusion protein (Addgene plasmid 21950; (Cavrois et al., 2002)) then washed with CO 2 independent medium and loaded with the CCF2/AM substrate together with 2.5mM probenecid for 2h according to the manufacturers instructions (Invitrogen). Samples were washed and incubated with CO 2 independent medium supplemented with 10% FBS for 16h at RT then washed with PBS and fixed with 1.2% paraformaldehyde overnight. CCF2 cleavage was monitored using a five-laser BD LSRII (Becton Dickinson, San Jose, CA). C. Supplemental References Cavrois, M., De Noronha, C., and Greene, W. C. (2002). A sensitive and specific enzyme-based assay detecting HIV-1 virion fusion in primary T lymphocytes. Nat Biotechnol 20, Connor, R. I., Chen, B. K., Choe, S., and Landau, N. R. (1995). Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology 206, Hermida-Matsumoto, L., and Resh, M. D. (2000). Localization of human immunodeficiency virus type 1 Gag and Env at the plasma membrane by confocal imaging. J Virol 74,

7 Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M., and Trono, D. (1996). In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272, Pugach, P., Marozsan, A. J., Ketas, T. J., Landes, E. L., Moore, J. P., and Kuhmann, S. E. (2007). HIV-1 clones resistant to a small molecule CCR5 inhibitor use the inhibitor-bound form of CCR5 for entry. Virology 361, Sabo, Y., Ehrlich, M., and Bacharach, E. (2011). The conserved YAGL motif in human metapneumovirus is required for higher-order cellular assemblies of the matrix protein and for virion production. Journal of virology 85, Soneoka, Y., Cannon, P. M., Ramsdale, E. E., Griffiths, J. C., Romano, G., Kingsman, S. M., and Kingsman, A. J. (1995). A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res 23, Zhang, F., Wilson, S. J., Landford, W. C., Virgen, B., Gregory, D., Johnson, M. C., Munch, J., Kirchhoff, F., Bieniasz, P. D., and Hatziioannou, T. (2009). Nef proteins from simian immunodeficiency viruses are tetherin antagonists. Cell Host Microbe 6,

8

9

10 Fold change intensity normalized to N.I GFP Mock GFP HIV-1 EB1 Mock EB1 HIV-1 H.P.I. 2 6

11

12

13 Table S1. Primer sequences Forward Primers Number and Name Sequence (5' 3') * 1. ZsGreen ORF-S ACGAATAGCGCGGCCGCATGGCCCAGTCCAAGCACGGCCTGACC 2. XbaI-Kozak-Gag/MA GAGCGTCTAGAACCATGGGTGCGAGAGCGTCAGTA 3. heb1-s CTGTATGCCACAGATGAAGG 4. heb1-s-noti GCAACTGCGGCCGCCATGGCAGTGAACGTATACTCAAC 5. heb1-c-s-noti GCAACTGCGGCCGCCATGTCAACACAGAGAACCGCTGC 6. MA fw TCTAGAACCATGGGTGCGAGAGCGTCAGTATTAAGCGGG 7. MA no myr fw CTAGAACCATGGCTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGAT 8. MA del 20c fw GATAGAGGAAGAGCAAAACAAGTCCAAGAAGCCTATAGTGCAGAACATCCAGGGGC 9. MA del100c fw GGGAAAGAAGAAGTACAAGCTAAAGCACATCGAAGGCTGTAGACAAATACTGGGACAG 10. SIV MA fw CTCTAGAACCATGGGCGTGAGAAACTCCGTCTTGTCAGGG Reverse Primers 11. ZsGreen ORF-A AAACTCGAGTTAGGGCAAGGCGGAGCCGGAGG 12. Gag-HA-TAA-EcoRI TTGCCGAATTCTTAAGCGTAATCTGGAACATCGTATGGGTATTGTGACGAGGGGTCGTTG 13. MA-HA-TAA-EcoRI TTCTGGAATTCTTAAGCGTAATCTGGAACATCGTATGGGTAGTAATTTTGGCTGACCTG 14. heb1-a CCAGACACAATGTCAAACGC 15. heb1-a-flag-bamhi GCAACGGGATCCTTACTTGTCGTCATCGTCTTTGTAGTCATACTCTTCTTGCTCCTCCTG 16. MA rev ACCGGTCTACATAGTCTCTAAAGGGTTCTTTTGGTCC 17. MA no myr rev CGATCTAATTCTCCCCCGCTTAATACTGACGCTCTCGCAGCCATGGTT 18. MA del 20c rev GCCCCTGGATGTTCTGCACTATAGGCTTCTTGGACTTGTTTTGCTCTTCCTCTATC 19. MA del100 rev CTGTCCCAGTATTTGTCTACAGCCTTCGATGTGCTTTAGCTTGTACTTCTTCTTTCCC 20. SIV MA-HA rev GGAATTCTTAAGCGTAATCTGGAACATCGTATGGGTAGTAATTTCCTCCTCTGCCGC *: Restriction sites are shown in bold; tag sequences (HA or Flag) are underlined.

VIROLOGY. Engineering Viral Genomes: Retrovirus Vectors

VIROLOGY. Engineering Viral Genomes: Retrovirus Vectors VIROLOGY Engineering Viral Genomes: Retrovirus Vectors Viral vectors Retrovirus replicative cycle Most mammalian retroviruses use trna PRO, trna Lys3, trna Lys1,2 The partially unfolded trna is annealed

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

The intracellular transport and subcellular localization of

The intracellular transport and subcellular localization of Distinct functions of diaphanous-related formins regulate HIV-1 uncoating and transport Michael Keegan Delaney a, Viacheslav Malikov a, Qingqing Chai a, Guangyuan Zhao a, and Mojgan H. Naghavi a,1 a Department

More information

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4

More information

Supporting Information

Supporting Information Supporting Information Zhu et al. 1.173/pnas.11167618 SI Materials and Methods DNA Construction. The plasmid pcdna4to/myc-rzap, which expresses myc-tagged full-length rat ZAP, has been described previously

More information

DNA context and promoter activity affect gene expression in lentiviral vectors

DNA context and promoter activity affect gene expression in lentiviral vectors ACTA BIOMED 2008; 79: 192-196 Mattioli 1885 O R I G I N A L A R T I C L E DNA context and promoter activity affect gene expression in lentiviral vectors Gensheng Mao 1, Francesco Marotta 2, Jia Yu 3, Liang

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing

More information

QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24)

QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24) Product Manual QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24) Catalog Number VPK-107 VPK-107-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction

More information

Supplementary Material

Supplementary Material Supplementary Material Nuclear import of purified HIV-1 Integrase. Integrase remains associated to the RTC throughout the infection process until provirus integration occurs and is therefore one likely

More information

VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer

VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer VIRAL TITER COUNTS The best methods of measuring infectious lentiviral titer FLUORESCENCE CYCLES qpcr of Viral RNA SUMMARY Viral vectors are now routinely used for gene transduction in a wide variety of

More information

Viral Vectors In The Research Laboratory: Just How Safe Are They? Dawn P. Wooley, Ph.D., SM(NRM), RBP, CBSP

Viral Vectors In The Research Laboratory: Just How Safe Are They? Dawn P. Wooley, Ph.D., SM(NRM), RBP, CBSP Viral Vectors In The Research Laboratory: Just How Safe Are They? Dawn P. Wooley, Ph.D., SM(NRM), RBP, CBSP 1 Learning Objectives Recognize hazards associated with viral vectors in research and animal

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

QuickTiter Lentivirus Quantitation Kit (HIV p24 ELISA)

QuickTiter Lentivirus Quantitation Kit (HIV p24 ELISA) New and Improved Product Manual QuickTiter Lentivirus Quantitation Kit (HIV p24 ELISA) Catalog Numbers VPK-108-HIV-p24 96 tests VPK-108-HIV-p24-5 5 x 96 tests FOR RESEARCH USE ONLY Not for use in diagnostic

More information

Vif Proteins of Human and Simian Immunodeficiency Viruses Require Cellular CBFβ to Degrade APOBEC3 Restriction Factors

Vif Proteins of Human and Simian Immunodeficiency Viruses Require Cellular CBFβ to Degrade APOBEC3 Restriction Factors JVI Accepts, published online ahead of print on 28 December 2011 J. Virol. doi:10.1128/jvi.06950-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13

More information

Figure S1. Schematic presentation of genomic replication of idsiv after transfection and infection. After transfection of idsiv plasmid DNA into 293T

Figure S1. Schematic presentation of genomic replication of idsiv after transfection and infection. After transfection of idsiv plasmid DNA into 293T Figure S1. Schematic presentation of genomic replication of idsiv after transfection and infection. After transfection of idsiv plasmid DNA into 293T cells, the RNA genomes with all modifications are generated

More information

Gene transfer into stimulated and unstimulated T lymphocytes by HIV-1-derived lentiviral vectors

Gene transfer into stimulated and unstimulated T lymphocytes by HIV-1-derived lentiviral vectors (2000) 7, 596 604 2000 Macmillan Publishers Ltd All rights reserved 0969-7128/00 $15.00 www.nature.com/gt VIRAL TRANSFER TECHNOLOGY RESEARCH ARTICLE Gene transfer into stimulated and unstimulated T lymphocytes

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

Recombinant Protein Expression Retroviral system

Recombinant Protein Expression Retroviral system Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential

More information

~Lentivirus production~

~Lentivirus production~ ~Lentivirus production~ May 30, 2008 RNAi core R&D group member Lentivirus Production Session Lentivirus!!! Is it health threatening to lab technician? What s so good about this RNAi library? How to produce

More information

Identification of Mutation(s) in. Associated with Neutralization Resistance. Miah Blomquist

Identification of Mutation(s) in. Associated with Neutralization Resistance. Miah Blomquist Identification of Mutation(s) in the HIV 1 gp41 Subunit Associated with Neutralization Resistance Miah Blomquist What is HIV 1? HIV-1 is an epidemic that affects over 34 million people worldwide. HIV-1

More information

Choosing Between Lentivirus and Adeno-associated Virus For DNA Delivery

Choosing Between Lentivirus and Adeno-associated Virus For DNA Delivery Choosing Between Lentivirus and Adeno-associated Virus For DNA Delivery Presenter: April 12, 2017 Ed Davis, Ph.D. Senior Application Scientist GeneCopoeia, Inc. Outline Introduction to GeneCopoeia Lentiviral

More information

Clinical Significance of Human Immunodeficiency Virus Type 1 Replication Fitness

Clinical Significance of Human Immunodeficiency Virus Type 1 Replication Fitness CLINICAL MICROBIOLOGY REVIEWS, Oct. 2007, p. 550 578 Vol. 20, No. 4 0893-8512/07/$08.00 0 doi:10.1128/cmr.00017-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Clinical Significance

More information

Rabies virus-like particles expressed in HEK293 cells

Rabies virus-like particles expressed in HEK293 cells Engineering Conferences International ECI Digital Archives Vaccine Technology IV Proceedings Spring 5-21-2012 Rabies virus-like particles expressed in HEK293 cells Diego Fontana Cell Culture Laboratory

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD

More information

Role of Matrix in an Early Postentry Step in the Human Immunodeficiency Virus Type 1 Life Cycle

Role of Matrix in an Early Postentry Step in the Human Immunodeficiency Virus Type 1 Life Cycle JOURNAL OF VIROLOGY, May 1998, p. 4116 4126 Vol. 72, No. 5 0022-538X/98/$04.00 0 Copyright 1998, American Society for Microbiology Role of Matrix in an Early Postentry Step in the Human Immunodeficiency

More information

Choosing Optimal Viral Vector for T-cell Transduction. Viral vectors for blood cells

Choosing Optimal Viral Vector for T-cell Transduction. Viral vectors for blood cells Choosing Optimal Viral Vector for T-cell Transduction Max Mamonkin, PhD Center for Cell and Gene Therapy Baylor College of Medicine PACT Webinar Nov 08, 2018 Viral for blood cells Short/long term gene

More information

Fayth K. Yoshimura, Ph.D. September 7, of 7 RETROVIRUSES. 2. HTLV-II causes hairy T-cell leukemia

Fayth K. Yoshimura, Ph.D. September 7, of 7 RETROVIRUSES. 2. HTLV-II causes hairy T-cell leukemia 1 of 7 I. Diseases Caused by Retroviruses RETROVIRUSES A. Human retroviruses that cause cancers 1. HTLV-I causes adult T-cell leukemia and tropical spastic paraparesis 2. HTLV-II causes hairy T-cell leukemia

More information

Received 30 January 2002/Accepted 18 December 2002

Received 30 January 2002/Accepted 18 December 2002 JOURNAL OF VIROLOGY, Mar. 2003, p. 3634 3646 Vol. 77, No. 6 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.6.3634 3646.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Rational Site-Directed

More information

Fayth K. Yoshimura, Ph.D. September 7, of 7 HIV - BASIC PROPERTIES

Fayth K. Yoshimura, Ph.D. September 7, of 7 HIV - BASIC PROPERTIES 1 of 7 I. Viral Origin. A. Retrovirus - animal lentiviruses. HIV - BASIC PROPERTIES 1. HIV is a member of the Retrovirus family and more specifically it is a member of the Lentivirus genus of this family.

More information

Constitutive Reporter Lentiviral Vectors Expressing Fluorescent Proteins

Constitutive Reporter Lentiviral Vectors Expressing Fluorescent Proteins Constitutive Reporter Lentiviral Vectors Expressing Fluorescent Proteins www.vectalys.com/products/ Constitutive Reporter Lentiviral Vectors Catalog Number referring to this User Manual: 0008VCT; 0009VCT;

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

33VASTVNGATSANNHGEPPS51PADARPR58

33VASTVNGATSANNHGEPPS51PADARPR58 Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation

More information

Development of Multigene and Regulated Lentivirus Vectors

Development of Multigene and Regulated Lentivirus Vectors JOURNAL OF VIROLOGY, Nov. 2000, p. 10589 10599 Vol. 74, No. 22 0022-538X/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Development of Multigene and Regulated Lentivirus

More information

Subcellular Localization of Feline Immunodeficiency Virus Integrase and Mapping of Its Karyophilic Determinant

Subcellular Localization of Feline Immunodeficiency Virus Integrase and Mapping of Its Karyophilic Determinant JOURNAL OF VIROLOGY, Apr. 2003, p. 4516 4527 Vol. 77, No. 8 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.8.4516 4527.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Subcellular

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Under the Radar Screen: How Bugs Trick Our Immune Defenses

Under the Radar Screen: How Bugs Trick Our Immune Defenses Under the Radar Screen: How Bugs Trick Our Immune Defenses Session 7: Cytokines Marie-Eve Paquet and Gijsbert Grotenbreg Whitehead Institute for Biomedical Research HHV-8 Discovered in the 1980 s at the

More information

Multi-step inhibition explains HIV-1 protease inhibitor pharmacodynamics and resistance

Multi-step inhibition explains HIV-1 protease inhibitor pharmacodynamics and resistance Research article Related article, page 3704 Multi-step inhibition explains HIV-1 protease inhibitor pharmacodynamics and resistance S. Alireza Rabi, 1 Gregory M. Laird, 1 Christine M. Durand, 1 Sarah Laskey,

More information

INI1/hSNF5-interaction defective HIV-1 IN mutants exhibit impaired particle morphology, reverse transcription and integration in vivo

INI1/hSNF5-interaction defective HIV-1 IN mutants exhibit impaired particle morphology, reverse transcription and integration in vivo Mathew et al. Retrovirology 213, 1:66 RESEARCH Open Access INI1/hSNF5-interaction defective HIV-1 IN mutants exhibit impaired particle morphology, reverse transcription and integration in vivo Sheeba Mathew

More information

CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES

CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES [Frontiers in Bioscience 5, d527-555, May 1, 2000] CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES Betty Lamothe, Sadhna Joshi Department of Medical

More information

HIV fusion in Dendritic cells mainly occurs at the surface and is limited by low CD4 levels.

HIV fusion in Dendritic cells mainly occurs at the surface and is limited by low CD4 levels. JVI Accepted Manuscript Posted Online 16 August 2017 J. Virol. doi:10.1128/jvi.01248-17 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

Pre-made Lentiviral Particles for Fluorescent Proteins

Pre-made Lentiviral Particles for Fluorescent Proteins Pre-made Lentiviral Particles for Fluorescent Proteins Catalog# Product Name Amounts Fluorescent proteins expressed under sucmv promoter: LVP001 LVP001-PBS LVP002 LVP002-PBS LVP011 LVP011-PBS LVP012 LVP012-PBS

More information

There are approximately 30,000 proteasomes in a typical human cell Each proteasome is approximately 700 kda in size The proteasome is made up of 3

There are approximately 30,000 proteasomes in a typical human cell Each proteasome is approximately 700 kda in size The proteasome is made up of 3 Proteasomes Proteasomes Proteasomes are responsible for degrading proteins that have been damaged, assembled improperly, or that are of no profitable use to the cell. The unwanted protein is literally

More information

MedChem 401~ Retroviridae. Retroviridae

MedChem 401~ Retroviridae. Retroviridae MedChem 401~ Retroviridae Retroviruses plus-sense RNA genome (!8-10 kb) protein capsid lipid envelop envelope glycoproteins reverse transcriptase enzyme integrase enzyme protease enzyme Retroviridae The

More information

JOHN G. JULIAS, ANDREA L. FERRIS, PAUL L. BOYER, AND STEPHEN H. HUGHES* HIV-Drug Resistance Program, NCI-Frederick, Frederick, Maryland

JOHN G. JULIAS, ANDREA L. FERRIS, PAUL L. BOYER, AND STEPHEN H. HUGHES* HIV-Drug Resistance Program, NCI-Frederick, Frederick, Maryland JOURNAL OF VIROLOGY, July 2001, p. 6537 6546 Vol. 75, No. 14 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.14.6537 6546.2001 Replication of Phenotypically Mixed Human Immunodeficiency Virus Type 1 Virions

More information

Retroviruses. ---The name retrovirus comes from the enzyme, reverse transcriptase.

Retroviruses. ---The name retrovirus comes from the enzyme, reverse transcriptase. Retroviruses ---The name retrovirus comes from the enzyme, reverse transcriptase. ---Reverse transcriptase (RT) converts the RNA genome present in the virus particle into DNA. ---RT discovered in 1970.

More information

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Amin Feizpour Reinhard Lab Department of Chemistry and the Photonics Center, Boston University, Boston, MA May 2014

More information

Human Immunodeficiency Virus

Human Immunodeficiency Virus Human Immunodeficiency Virus Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Viruses and hosts Lentivirus from Latin lentis (slow), for slow progression of disease

More information

I m B m. 1 f ub I B. D m B. f u. 1 f ua 1 D I A. I A m. D m A. f a. 1 f u. D m B ) D m A )(I m B. 1 f ua. 1 (I m A. log (I A. log f.

I m B m. 1 f ub I B. D m B. f u. 1 f ua 1 D I A. I A m. D m A. f a. 1 f u. D m B ) D m A )(I m B. 1 f ua. 1 (I m A. log (I A. log f. Supplementary Material Appendix 1 Here we show that independent inhibition by a single drug of two distinct steps (A and ) in the viral life cycle results in a non-linear median effect dose-response curve

More information

Received 19 May 2004/Accepted 13 September 2004

Received 19 May 2004/Accepted 13 September 2004 JOURNAL OF VIROLOGY, Feb. 2005, p. 1666 1677 Vol. 79, No. 3 0022-538X/05/$08.00 0 doi:10.1128/jvi.79.3.1666 1677.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. Genetic Recombination

More information

Figure S1! CrFK! DNA Synthesis! Copies viral DNA/ 100 ng DNA (Log 10 ) % Infected (GFP+) cells! 100! 80! 60! 40! 20! 0! 1! 10! 100! 1000!

Figure S1! CrFK! DNA Synthesis! Copies viral DNA/ 100 ng DNA (Log 10 ) % Infected (GFP+) cells! 100! 80! 60! 40! 20! 0! 1! 10! 100! 1000! Figure S1! A! B! % Infected (GFP+) cells! 100! 80! 60! 40! 20! 0! 1! 10! 100! 1000! Dose μl! CrFK! B-MLV! N-MLV! Template:! Water! Ube2V2! Ube2V1! Primers:! V2! V1! V2! V1! V2! V1! bp! 500! 300! 200! 150!

More information

Materials and Methods , The two-hybrid principle.

Materials and Methods , The two-hybrid principle. The enzymatic activity of an unknown protein which cleaves the phosphodiester bond between the tyrosine residue of a viral protein and the 5 terminus of the picornavirus RNA Introduction Every day there

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected

More information

Pre-made Reporter Lentivirus for MAPK/ERK Signal Pathway

Pre-made Reporter Lentivirus for MAPK/ERK Signal Pathway Pre-made Reporter for MAPK/ERK Signal Pathway Cat# Product Name Amounts LVP957-P or: LVP957-P-PBS SRE-GFP (Puro) LVP958-P or: LVP958-P-PBS SRE-RFP (Puro) LVP959-P or: LVP959-P-PBS SRE-Luc (Puro) LVP960-P

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing

More information

NBP Protocol. Orders: Support: Web: NBP

NBP Protocol. Orders: Support: Web:   NBP NBP2-29541 NBP2-29541 Protocol Orders: orders@novusbio.com Support: technical@novusbio.com Web: www.novusbio.com Protocols, Publications, Related Products, Reviews and more: www.novusbio.com/nbp2-29541

More information

Pre-made Reporter Lentivirus for JAK-STAT Signaling Pathway

Pre-made Reporter Lentivirus for JAK-STAT Signaling Pathway Pre-made Reporter for JAK-STAT Signaling Pathway Cat# Product Name Amounts LVP937-P or: LVP937-P-PBS ISRE-GFP (Puro) LVP938-P or: LVP938-P-PBS ISRE-RFP (Puro) LVP939-P or: LVP939-P-PBS ISRE-Luc (Puro)

More information

Interferon-Inducible CD169/Siglec1 Attenuates Anti-HIV-1 Effects of IFN-α

Interferon-Inducible CD169/Siglec1 Attenuates Anti-HIV-1 Effects of IFN-α JVI Accepted Manuscript Posted Online 9 August 2017 J. Virol. doi:10.1128/jvi.00972-17 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 Interferon-Inducible CD169/Siglec1 Attenuates

More information

Nature Medicine: doi: /nm.4322

Nature Medicine: doi: /nm.4322 1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure

More information

This training module is required for all personnel listed on an IBC protocol that describes work utilizing viral vectors (both replication competent

This training module is required for all personnel listed on an IBC protocol that describes work utilizing viral vectors (both replication competent This training module is required for all personnel listed on an IBC protocol that describes work utilizing viral vectors (both replication competent and incompetent) regardless of the biosafety level used

More information

HIV INFECTION: An Overview

HIV INFECTION: An Overview HIV INFECTION: An Overview UNIVERSITY OF PAPUA NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL MBBS II SEMINAR VJ

More information

Inhibition of trna 3 Lys -Primed Reverse Transcription by Human APOBEC3G during Human Immunodeficiency Virus Type 1 Replication

Inhibition of trna 3 Lys -Primed Reverse Transcription by Human APOBEC3G during Human Immunodeficiency Virus Type 1 Replication JOURNAL OF VIROLOGY, Dec. 2006, p. 11710 11722 Vol. 80, No. 23 0022-538X/06/$08.00 0 doi:10.1128/jvi.01038-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Inhibition of trna

More information

Gamma-interferon-inducible, lysosome/endosome-localized thiolreductase, GILT, has anti-retroviral activity and its expression is counteracted by HIV-1

Gamma-interferon-inducible, lysosome/endosome-localized thiolreductase, GILT, has anti-retroviral activity and its expression is counteracted by HIV-1 Gamma-interferon-inducible, lysosome/endosome-localized thiolreductase, GILT, has anti-retroviral activity and its expression is counteracted by HIV-1 The Harvard community has made this article openly

More information

Interplay between HIV Entry and Transportin-SR2 Dependency

Interplay between HIV Entry and Transportin-SR2 Dependency Retrovirology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Interplay between HIV Entry

More information

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed

More information

Supplementary Information. Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases

Supplementary Information. Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases Supplementary Information Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases Ulrike Mock 1, Kristoffer Riecken 1, Belinda Berdien 1, Waseem Qasim 2, Emma Chan

More information

Primate lentiviral Vpx commandeers DDB1 to counteract a macrophage restriction

Primate lentiviral Vpx commandeers DDB1 to counteract a macrophage restriction University of Massachusetts Medical School escholarship@umms Open Access Articles Open Access Publications by UMMS Authors 5-3-2008 Primate lentiviral Vpx commandeers DDB1 to counteract a macrophage restriction

More information

Received 26 October 2005/Accepted 1 December 2005

Received 26 October 2005/Accepted 1 December 2005 JOURNAL OF VIROLOGY, Feb. 2006, p. 1939 1948 Vol. 80, No. 4 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.4.1939 1948.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Human Immunodeficiency

More information

Gelsolin activity controls efficient early HIV-1 infection

Gelsolin activity controls efficient early HIV-1 infection García-Expósito et al. Retrovirology 2013, 10:39 RESEARCH Open Access Gelsolin activity controls efficient early HIV-1 infection Laura García-Expósito 1, Serena Ziglio 1,2, Jonathan Barroso-González 1,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7

More information

are considered to be dead end products of reverse transcription

are considered to be dead end products of reverse transcription JOURNAL OF VIROLOGY, Sept. 2001, p. 7944 7955 Vol. 75, No. 17 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.17.7944 7955.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Human Immunodeficiency

More information

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei, Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Supplementary Information. Supplementary Figure 1

Supplementary Information. Supplementary Figure 1 Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): Nature Communications manuscript number NCOMMS-16-15882, by Miyakawa et al. presents an intriguing analysis of the effects of the tumor suppressor

More information

HIV/AIDS. Biology of HIV. Research Feature. Related Links. See Also

HIV/AIDS. Biology of HIV. Research Feature. Related Links. See Also 6/1/2011 Biology of HIV Biology of HIV HIV belongs to a class of viruses known as retroviruses. Retroviruses are viruses that contain RNA (ribonucleic acid) as their genetic material. After infecting a

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/6/e1700338/dc1 Supplementary Materials for HIV virions sense plasma membrane heterogeneity for cell entry Sung-Tae Yang, Alex J. B. Kreutzberger, Volker Kiessling,

More information

Modified Cell Entry by Exhibiting of Hemagglutinin from Avian. Influenza Virus on Pseudotyped HIV Particles

Modified Cell Entry by Exhibiting of Hemagglutinin from Avian. Influenza Virus on Pseudotyped HIV Particles ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 4 24 (4) :366 372 HA HIV 1),2), 1),2) 3, 1),2) 1),2), ( 1), 430070 ; 2), 430070) HA HIV, HA ( HIVΠH52HA), RT2PCR H5N1

More information

Feb 11, Gene Therapy. Sam K.P. Kung Immunology Rm 417 Apotex Center

Feb 11, Gene Therapy. Sam K.P. Kung Immunology Rm 417 Apotex Center Gene Therapy Sam K.P. Kung Immunology Rm 417 Apotex Center Objectives: The concept of gene therapy, and an introduction of some of the currently used gene therapy vector Undesirable immune responses to

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

JOURNAL OF VIROLOGY, Jan. 1999, p Vol. 73, No. 1. Copyright 1999, American Society for Microbiology. All Rights Reserved.

JOURNAL OF VIROLOGY, Jan. 1999, p Vol. 73, No. 1. Copyright 1999, American Society for Microbiology. All Rights Reserved. JOURNAL OF VIROLOGY, Jan. 1999, p. 19 28 Vol. 73, No. 1 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Mutational Analysis of the Hydrophobic Tail of the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.10/nature10195 NCBI gene: Tagged Subunit(s: HA-Vpx; FLAG-Cul4 HA-DCAF1 FLAG-Cul4 HA-FLAG-Vpx Mock Vpx (SIVmac 100 (a ; 0.159 (b ; 0.05 DCAF1 DDB1 DDA1 Cul4A 1; 0.024591

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Qin Yu and Casey D. Morrow 1. Department of Microbiology, University of Alabama at Birmingham, Birmingham, Alabama 35294

Qin Yu and Casey D. Morrow 1. Department of Microbiology, University of Alabama at Birmingham, Birmingham, Alabama 35294 Virology 254, 160 168 (1999) Article ID viro.1998.9542, available online at http://www.idealibrary.com on Complementarity between 3 Terminal Nucleotides of trna and Primer Binding Site Is a Major Determinant

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)

More information

SUPPLEMENTARY FIG. S1. MVC inhibition curves in NP2-CD4/CCR5 cells. Luciferase reporter viruses pseudotyped with baseline (black solid lines) and MVC

SUPPLEMENTARY FIG. S1. MVC inhibition curves in NP2-CD4/CCR5 cells. Luciferase reporter viruses pseudotyped with baseline (black solid lines) and MVC Supplementary Data SUPPLEMENTARY FIG. S1. MVC inhibition curves in NP2-CD4/CCR5 cells. Luciferase reporter viruses pseudotyped with baseline (black solid lines) and MVC failure Envs (black dotted lines)

More information

Minimum Requirements for Efficient Transduction of Dividing and Nondividing Cells by Feline Immunodeficiency Virus Vectors

Minimum Requirements for Efficient Transduction of Dividing and Nondividing Cells by Feline Immunodeficiency Virus Vectors JOURNAL OF VIROLOGY, June 1999, p. 4991 5000 Vol. 73, No. 6 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Minimum Requirements for Efficient Transduction

More information

Analysis of Vif-induced APOBEC3G degradation using an α-complementation assay

Analysis of Vif-induced APOBEC3G degradation using an α-complementation assay Virology 359 (2007) 162 169 www.elsevier.com/locate/yviro Analysis of Vif-induced APOBEC3G degradation using an α-complementation assay Lei Fang, Nathaniel R. Landau Infectious Disease Laboratory, The

More information

A Multicistronic DNA Vaccine Induces Significant Protection against Tuberculosis in Mice and Offers Flexibility in the Expressed Antigen Repertoire.

A Multicistronic DNA Vaccine Induces Significant Protection against Tuberculosis in Mice and Offers Flexibility in the Expressed Antigen Repertoire. Company LOGO A Multicistronic DNA Vaccine Induces Significant Protection against Tuberculosis in Mice and Offers Flexibility in the Expressed Antigen Repertoire. Fayaz Ahmad Mir, Stefan H. E. Kaufmann,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression

More information

QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24)

QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24) Product Manual QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24) Catalog Number VPK-107 VPK-107-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction

More information

IFITM proteins are incorporated onto HIV-1 virion particles and negatively imprint their infectivity

IFITM proteins are incorporated onto HIV-1 virion particles and negatively imprint their infectivity Tartour et al. Retrovirology 2014, 11:103 RESEARCH Open Access IFITM proteins are incorporated onto HIV-1 virion particles and negatively imprint their infectivity Kevin Tartour 1,2,3,4,5, Romain Appourchaux

More information

Virology 415 (2011) Contents lists available at ScienceDirect. Virology. journal homepage:

Virology 415 (2011) Contents lists available at ScienceDirect. Virology. journal homepage: Virology 415 (2011) 95 106 Contents lists available at ScienceDirect Virology journal homepage: www.elsevier.com/locate/yviro Targeting the HIV entry, assembly and release pathways for anti-hiv gene therapy

More information

Role of ESCRT-I in Retroviral Budding

Role of ESCRT-I in Retroviral Budding JOURNAL OF VIROLOGY, Apr. 2003, p. 4794 4804 Vol. 77, No. 8 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.8.4794 4804.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Role of ESCRT-I

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis plvx-ef1α-ires-puro Vector Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No.

More information

HIV & AIDS: Overview

HIV & AIDS: Overview HIV & AIDS: Overview UNIVERSITY OF PAPUA NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL SEMINAR VJ TEMPLE 1 What

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Catalog No. Amount Lot Number 631987 10 μg Specified on product label. Product Information plvx-ef1α-ires-mcherry is a bicistronic lentiviral expression vector that can be used

More information