Platelet-Derived Growth Factor Producing CD4 1 Foxp3 1 Regulatory T Lymphocytes Promote Lung Fibrosis

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Platelet-Derived Growth Factor Producing CD4 1 Foxp3 1 Regulatory T Lymphocytes Promote Lung Fibrosis"

Transcription

1 Platelet-Derived Growth Factor Producing CD4 1 Foxp3 1 Regulatory T Lymphocytes Promote Lung Fibrosis Sandra Lo Re 1, Marylène Lecocq 1, Francine Uwambayinema 1, Yousof Yakoub 1, Monique Delos 2, Jean-Baptiste Demoulin 3, Sophie Lucas 3, Tim Sparwasser 5, Jean-Christophe Renauld 3,4, Dominique Lison 1, and François Huaux 1 1 Louvain centre for Toxicology and Applied Pharmacology, Institute of Experimental and Clinical Research, Université catholique de Louvain, Brussels, Belgium; 2 University Hospital of Mont-Godinne, Université Catholique de Louvain, Yvoir, Belgium; 3 de Duve Institute, Université Catholique de Louvain, Brussels, Belgium; 4 Ludwig Institute for Cancer Research, Brussels Branch, Brussels, Belgium; and 5 Institute for Infection Immunology, TWINCORE, Centre of Experimental and Clinical Infection Research, Hanover, Germany Rationale: There is evidence that CD4 1 effector T lymphocytes (T eff) participate in the development of lung fibrosis, but the role of their CD4 1 regulatory T-cell (T reg)counterparts remains tobedetermined. Objectives: To elucidate the contribution of T reg cells in a mouse model of lung fibrosis induced by silica (SiO 2 ) particles. Methods: Lung T reg and T eff cells purified from SiO 2 treated Foxp3- GFP transgenic mice were cocultured with naive lung fibroblasts or transferred to the lungs of healthy mice. DEREG mice, which express the diphtheria toxin receptor under the control of the foxp3 gene, were used to deplete T reg cells during fibrogenesis. Measurements and Main Results: CD4 1 Foxp3 1 T reg cells were persistently recruited in the lungs in response to SiO 2. T reg accumulation paralleled the establishment of pulmonary immunosuppression and fibrosis. T reg cells highly expressed platelet-derived growth factor (PDGF)-B via a TGF-b autocrine signaling pathway, directly stimulated fibroblast proliferation in vitro, and increased lung collagen deposition upon transfer in the lung of naive mice. The direct profibrotic effects of T reg cells were abolished by the inhibitor of the PDGF-B/TGF-b signaling pathway, imatinib mesylate. Neutralization of T reg immunosuppressive activity resulted in enhanced accumulation of T eff cells and IL-4 driven pulmonary fibrogenesis, further demonstrating that T reg cells control T eff cell functions during inflammatory fibrosis. Conclusions: Our study indicates that T reg cells contribute to lung fibrosis by stimulating fibroblasts through the secretion of PDGF-B in noninflammatory conditions and regulate detrimental T eff cell activities during inflammation-related fibrosis. Keywords: Foxp3; regulatory T cells; effector T cells; PDGF/TGF-b; fibroblasts The body responds to injury by forming a scar as part of the reaction to trauma, infections, allergens, or xenobiotics. In some circumstances, the scarring is not properly controlled, resulting (Received in original form March 23, 2011; accepted in final form August 14, 2011) Supported by the Fonds de la Recherche Scientifique Médicale, by Actions de Recherche Concertées, Communauté française de Belgique, Direction de la Recherche Scientifique and by the European Commission under FP7-HEALTH- F4 2008, Contract no. 202,047. Author Contributions: S.L.R., J.B.D., S.L., T.S., J.C.R., D.L., and F.H. were involved in the conception and design of the experiments, analyzed the data, and wrote the manuscript. M.L., F.U., Y.Y., and M.D. performed the experiments. Correspondence and requests for reprints should be addressed to François Huaux, Ph.D., Louvain Centre for Toxicology and Applied Pharmacology (LTAP), Institute of Experimental and Clinical Research (IREC), Université Catholique de Louvain, Avenue Mounier 53 Bte B , 1200 Brussels, Belgium. uclouvain.be This article has an online supplement, which is accessible from this issue s table of contents at Am J Respir Crit Care Med Vol 184. pp , 2011 Copyright ª 2011 by the American Thoracic Society Originally Published in Press as DOI: /rccm OC on August 25, 2011 Internet address: AT A GLANCE COMMENTARY Scientific Knowledge on the Subject The role of CD4 T lymphocyte subsets is not fully elucidated despite decades of research in lung fibrosis. In particular, there is an important need to explore the exact functions of immunosuppressive regulatory T lymphocytes (T regs) during fibrogenesis. What This Study Adds to the Field This study determines that T regs represent an important cellular source of the platelet-derived growth factor B and promote fibroblast proliferation and ultimately overproduction of matrix elements in noninflammatory conditions. in fibrosis, organ dysfunction, and, in the worst cases, death. In the lung, vascular exudates and inflammatory cells (macrophages, lymphocytes, and granulocytes) accumulate within the injured alveolar space during the development and progression of pulmonary fibrosis. The influx and proliferation of fibroblasts in exudates induce cellular agglomerations known as fibroblastic foci. Ultimately, connective tissue matrix accumulates, especially collagen, and fibrosis becomes established (1, 2). Inflammation, angiogenesis, and coagulation may contribute to the development of fibrosis (3 5). However, it is unclear which of these mechanisms is fundamental in the development of the fibrotic disease and may represent targets for therapy (1, 2). CD4 1 T helper or CD4 1 T effector (T eff) cell subsets activate or suppress different immune reactions, which influence disease outcomes during infection, autoimmunity, or cancer. Evidence is accumulating that T eff cells also participate in the pathogenesis of fibrosis (6, 7). There is an increased predominance of T eff cells in human and experimental fibrosis in the lung (8). Several authors have demonstrated that depleting CD4 1 T cells reduces the intensity of lung fibrosis in mice (9). In addition, lung-infiltrating T lymphocytes induced by the overexpression of CCL18 resulted in TGF-b activation and collagen deposition (10). The exact involvement of T eff lymphocyte subtypes (T helper [Th]1, Th2, or Th17) and their effector functions (e.g., cytokine production) in pulmonary fibrotic disease has been investigated by exploring fibrotic responses of IFN-g, IL-4, IL-13, or IL-17 deficient or transgenic animals. Based on these studies, it appears that each of these CD4 1 T subpopulations contributes directly or indirectly to the development or the control of experimental lung fibrosis via the production of different cytokine components (11 14).

2 Lo Re, Lecocq, Uwambayinema, et al.: PDGF-B/TGF-b Pathway Mediates Profibrotic Activity of T reg Cells 1271 CD4 1 CD25 1 Foxp3 1 regulatory T (T reg) cells constitute a thymus-derived subpopulation of CD4 1 T lymphocytes that constitutively express the IL-2 receptor a chain, CD25, and the transcription factor Foxp3 (forkhead box P3), required for their development and function (15). These lymphocytes represent only 5 to 10% of CD4 1 T cells in healthy adults but are crucial to maintain tolerance by down-regulating undesired immune responses to self and nonself antigens. The strong immunosuppressive activity of Foxp3 1 T reg cells is related to their capacity to influence the polarization, expansion, and effector function of T eff lymphocytes in vitro and in vivo. Most in vitro studies indicate that T reg cells mediate immunosuppression by an undefined cell contact dependent mechanism, but in vivo the activity of T reg cells is mainly mediated by suppressive cytokines such as TGF-b and IL-10 (16). Despite the many studies investigating effector T-cell subsets in pulmonary fibrosis, the role of regulatory T lymphocytes during fibrogenesis remains debated. It could be postulated that immunosuppressive T reg cells possess profibrotic functions because these lymphocytes secrete high levels of TGF-b, the most potent profibrotic cytokine, but also a powerful immunosuppressive factor. However, given the ability of T reg cells to dampen inflammatory and Th responses, it has been also proposed that T reg cells could interfere with upstream inflammatory events and indirectly contribute to reduce the development of fibrosis (17). These opposite assumptions indicate an important need to explore the exact functions of T reg cells in fibrosis. In this study, we clarified the role of T reg cells in the establishment of lung fibrosis induced by silica (SiO 2 ) particles in mice. We demonstrated that T reg cells are recruited to control inflammatory and T eff fibrotic responses. However, the persistent accumulation of immunosuppressive T reg cells in the lungs contributes to pulmonary fibrosis by stimulating fibroblasts through the secretion of platelet-derived growth factor (PDGF)-B via a TGF-b autocrine signaling pathway. METHODS Animal Treatment NMRI, C57BL/6, DBA/2 mice were purchased from Charles River Laboratory (Brussels, Belgium). Rag2 2/2 mice and their C57BL/6 wild-type (WT) counterparts were purchased from Taconic (Ry, Denmark). Foxp3-GFP transgenic mice (129 background) and Foxp3- egfp/dtr DEREG mice (C57BL/6 background) were provided by Alexander Rudensky (University of Washington, Seattle, WA) (18) and Tim Sparwasser (Institute for Infection Immunology, Hanover, Germany) (19), respectively. A suspension of SiO 2 (DQ12; d 50 ¼ 2.2 mm; 2.5 mg per mouse) in sterile 0.9% saline was introduced directly into the lungs by pharyngeal instillation. This dose is reported in the literature as effective in inducing chronic lung inflammation and fibrosis (20). For T-cell instillation, purified lung T reg or Teffcells(see below) were suspended in sterile PBS (Invitrogen, Merelbeke, Belgium) to obtain cells/ml, and cells/50 ml were instilled per mouse. Isolation of Pulmonary Foxp3 1 Regulatory T Cells Foxp3 1 regulatory T cells obtained from Foxp3-GFP transgenic mice or DEREG mice were separated and isolated using a magnetic cell separation system (MACS; Miltenyi Biotec, Bergisch Gladbach, Germany) and flow cytometry cell sorting. CD4 1 lymphocytes were first isolated from lung digestion by positive selection with anti-cd4 magnetic beads (Miltenyi Biotec). GFP or PE (phycoerythrin) fluorescence measured by FACS was used to select among CD4 1 the Foxp3 1 or Foxp3 2 and CD25 1 or CD25 2 cell population (FACSVantage, BD Biosciences, Erembodegem, Belgium). The purity of the obtained immune cell preparations was routinely greater than 95% as assessed by Diff-Quick staining. MACS protocols were used to directly isolate CD8 1, B220 1, GR1 1, and CD11c 1 cells with antibodies coupled to microbeads (Miltenyi Biotec). Mouse Lung T reg or T eff Cell Culture T reg or T eff cells purified from the lung of SiO 2 treated Foxp3-GFP mice were centrifuged and suspended in ID medium (Gibco-Invitrogen Corp., Paisly, United Kingdom) supplemented with 0.1% FBS (Invitrogen) and antibiotics. Cells were seeded into 96-well plates at cells per well. Recombinant human TGF-b 1 (0.1 and 1 ng/ml) (R&D Systems, Minneapolis, MN) or anti-tgfb (5 mg/ml) (clone 1D11; R&D Systems) were added to the cultures, and PDGF-B expression was measured by RT-qPCR after 3 and 24 hours, respectively. Mouse Lung Fibroblast Culture and Coculture Mouse lung fibroblasts isolated from lung digestion were seeded into 96- well plates at cells per well. Subconfluent cell monolayers were treated with recombinant human PDGF-BB or TGF-b 1 (R&D Systems) or with purified T reg cells, T eff, or CD4 2 CD11c 1 cells (macrophages/dendritic cells) from SiO 2 treated mice (15 d) suspended in medium supplemented with 0.1% FBS. Imatinib (100 nm) (Gleevec; Novartis, Vilvoorde, Belgium), anti TGF-b, IL-4, IL-13, IFN-g (5 mg/ml; R&D Systems), or IL-17A (5 mg/ml; MM17F3, kindly provided by J. Van Snick from the Ludwig Institute for Cancer Research, Brussels, Belgium) (20) were also added to the cocultures. Fibroblast proliferation was estimated by 3 H-thymidine incorporation. One mci per well of thymidine was added directly after the seeding of T cells. The supernatant and the nonadherent cells were removed 48 hours later and discarded. Then, adherent cells were trypsinized before 3 H-thymidine count. Expression of a-smooth muscle actin and collagen I and III was measured by RT-qPCR after 24 hours. Depletion of T reg cells To deplete T reg cells, DEREG mice were treated with diphtheria toxin (DT) (Merck, Darmstad, Germany) diluted in endotoxin-free PBS. DT (1 mg in 100 ml of saline) was injected intraperitoneally before the significant accumulation of T reg cells into the lung (10 and 11 days after SiO 2 administration; Figure 1) (19). Preliminary studies using different time points and administration routes found that this protocol was optimal for depleting short- and long-term accumulation of T reg cells (15 and 60 d) after SiO 2 treatment. RESULTS Foxp3 1 Regulatory T Cells Are Persistently Recruited in the Pulmonary Interstitium during Inflammatory and Fibrotic Lung Responses Pulmonary injection of SiO 2 particles in mice provides an experimental model of fibrosis. To assess the presence of Foxp3 1 regulatory T cells, we used mice containing the knock-in Foxp3 gfp allele, encoding a Foxp3-GFP fusion protein (129 background) (18). Flow cytometry analyses at 3, 15, 30, and 60 days after a pharyngeal instillation of SiO 2 particles or saline solution (NaCl) showed that total CD4 1 T-cell numbers increased significantly over time after SiO 2 treatment (Figures 1A and 1B). By using green fluorescent protein fluorescence, we quantified the numbers of T reg and T eff cells among the CD4 1 population (Figure 1A). The number of lung T reg cells began to increase substantially at Day 15, leveling off at 30 and 60 days after silica instillation (Figure 1C). At Day 15, SiO 2 treated mice exhibited a 6.4-fold increase in pulmonary T reg cell counts compared with saline-treated animals. In comparison to T reg cells, T eff lymphocytes were modestly recruited after SiO 2 treatment (e.g., 2.4-fold increase at 15 d) and mainly accumulated at early time points (Days 3 and 15) (Figure 1D). The influx of Foxp3 1 regulatory T cells after SiO 2 treatment was also examined by measuring the expression of Foxp3 by RT-qPCR in the lungs

3 1272 AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL Figure 1. Foxp3 1 regulatory T (T reg) cells are recruited during the development of silica (SiO 2 )-induced lung inflammation and fibrosis. (A) Flow cytometry analysis of CD4 expression and forward scatter 15 days after SiO 2 treatment in the lung of Foxp3-GFP mice (129 background). R4 region represents the CD4 1 population. Flow cytometry analysis of CD4 and Foxp3-GFP expression 15 days after NaCl or SiO 2 treatment in Foxp3-GFP transgenic mice. FACS plots were gated on CD4 1 cells (R4 region). (B D) Number of CD4 1 (B), T reg (C), and T eff (CD4 1 Foxp3-GFP 2 )(D) cells analyzed by flow cytometry in lung cell suspensions obtained from Foxp3-GFP transgenic mice after silica (d3 to d60) or saline (d0) instillation. Symbols represent means 6 SEM (n ¼ 3 5). (E) Lung fibrosis assessed by hydroxyproline (OH-proline) content in mice after silica (d3 to d60) or saline (d0) instillation. Three independent experiments were performed with similar results. (F) Neutrophil numbers and (G) protein content in the bronchoalveolar lavage fluid of Foxp3-GFP mice treated with silica (d3 to d60) or saline solution (d0). Symbols represent means 6 SEM (n ¼ 3 5). (H) Flow cytometry analysis of BrdU and Foxp3-GFP expression by lung cells of Foxp3-GFP transgenic mice was performed 15 days after NaCl or SiO 2 treatment. FACS plots were gated on CD4 1 cells. (I) Percentage of Foxp3-GFP 1 among the CD4 1 cells assessed by FACS, which are BrdU 1 or BrdU 2 in the lung of Foxp3-GFP mice 1, 3, 8, and 15 days after SiO 2 instillation. Symbols represent means 6 SEM (n ¼ 4 6). These results were treated statistically by a t test. *P, 0.05, **P, 0.01, ***P, indicate statistically significant difference between values measured in silicatreated mice and saline-treated mice.

4 Lo Re, Lecocq, Uwambayinema, et al.: PDGF-B/TGF-b Pathway Mediates Profibrotic Activity of T reg Cells 1273 of NMRI mice. Silica strongly induced the pulmonary expression of Foxp3 with significantly up-regulated levels from Day 15 to Day 60 after SiO 2 treatment (see Figure E1A in the online supplement). We also noted a similar Foxp3 expression profile in C57BL/6 and DBA2 mice, indicating that SiO 2 induced Foxp3 expression is not strain dependent (Figure E1B). Foxp3 expression after SiO 2 treatment was mainly associated with lung CD4 1 CD25 1 T lymphocytes but not with CD4 1 CD25 2 cells, cytotoxic T lymphocytes (CD8 1 ), B lymphocytes (B220 1 ), granulocytes (GR1 1 ) (Figure E1C), macrophages, or fibroblasts (data not shown). The accumulation of pulmonary T reg cells (Figure 1C) was strongly associated with the progressive establishment of lung fibrosis estimated by hydroxyproline (OH-proline) lung content after SiO 2 treatment (Figure 1E). This observation suggested that T reg cells, persistently recruited in the fibrotic organ, might be implicated in the development of lung fibrosis. In contrast, inflammation characterized by the recruitment of T eff cells (Figure 1D), neutrophils (Figure 1F), and protein content (Figure 1G) but not macrophages (Figure E1D) or B cells (not shown) corresponded to an earlier stage of the SiO 2 induced lung responses. Thus, there was an inverse correlation between T reg cells and T eff cell and neutrophil numbers and protein levels in the lungs, suggesting that T reg cell recruitment might contribute to the resolution of the inflammatory stage. Foxp3 1 regulatory T cells are derived from the thymus and can migrate to nonlymphoid tissues to limit inflammation and autoimmunity. They may also differentiate and proliferate from CD4 1 naive T cells in the presence of immunosuppressive cytokines such as TGF-b and IL-10 (16). Thus, the pulmonary accumulation of Foxp3 1 T cells in SiO 2 treated mice could reflect recruitment or proliferation in the lung. To distinguish between these two possibilities, we injected BrdU intraperitoneally into Foxp3-GFP mice after SiO 2 instillation to evaluate T-cell proliferation in the lung and spleen. At Day 15, the majority of CD4 1 Foxp3-GFP 1 (82%) was BrdU 2 in the lung of SiO 2 treated mice, demonstrating a weak proliferation rate of T reg cells (Figure 1H). This fraction of CD4 1 Foxp3-GFP 1 BrdU 2 was already increasedfromday3insio 2 treated mice compared with NaCl control mice (d0) in the lung (Figure 1I) but not in the spleen (Figures E1E and E1F). These results indicate that T reg cell accumulation during lung fibrotic responses is local and not systemic and reflects recruitment and not proliferation. We also noted that T reg cells were mainly present in the lung interstitium because CD4 1 Foxp3-GFP 1 were almost absent in the alveolar compartment and extensive bronchoalveolar lavage (BAL) did not modify T reg cell numbers in lung tissue (Figures E1G and E1H). No modification in the number of circulating CD4 1 Foxp3-GFP 1 cells was noted in SiO 2 treated mice (Figure E1I). Foxp3 1 Regulatory T Cells Stimulate Lung Fibroblast Proliferation In Vitro by Producing PDGF-B and TGF-b 1 To determine the role of T reg cells in fibrosis, we first cocultured mouse lung fibroblasts with lung T reg cells or with T eff cells purified from Foxp3-GFP transgenic mice 15 days after SiO 2 instillation (Figure 2A). Fibroblast proliferation, estimated by 3 H-thymidine incorporation, increased significantly in the presence of increasing numbers of T reg cells (Figure 2B). In contrast, T eff cells failed to induce fibroblast proliferation (Figure 2C). T reg or T eff cells cultured alone did not incorporate 3 H-thymidine (data not shown). T reg cells preferentially activated undifferentiated fibroblasts because they were unable to stimulate the proliferation of silicotic fibroblasts (data not shown) and were unable to induce myofibroblast differentiation (a-smooth muscle actin expression; Figure E2A) and collagen I (Figure E2B) or III (not shown) expression. To identify the mechanism of T reg cell effects on fibroblasts, expression of growth factors known to activate fibroblast proliferation was determined in purified T reg and T eff cells. PDGF-B (Figure 2D) and TGF-b 1 (Figure 2E) mrna transcripts were up-regulated in T reg cells but not in T eff cells after SiO 2 treatment. Moreover, after SiO 2, up-regulation of PDGF-B and TGF-b 1 expression in T reg cells was higher than in purified lung CD11c 1 DC/macrophages, known to robustly produce growth factors during fibrogenesis (6) (Figures E2C and E2D). No difference was noted when assessing other relevant fibrogenic genes, such as PDGF-A, -C and -D; TGFb 2 and -b 3 ;andosteopontin (data not shown). To selectively block PDGF-B or TGF-b 1 biological activity, imatinib mesylate (Gleevec) or TGF-b neutralizing antibodies were added to the cocultures, respectively. Gleevec (100 nm) reduced PDGF-B but not TGF-b 1 activity, and, conversely, anti TGF-b antibodies inhibited TGF-b 1 but not PDGF-B fibroproliferative effects (Figure 2F). Gleevec or anti TGF-b treatment alone had no impact on unstimulated fibroblast proliferation (Figure 2F). In cocultures, we observed that fibroblast proliferation induced by T reg cells was completely abrogated by the addition of Gleevec or anti TGF-b (Figure 2G). CD11c 1 cells also stimulated fibroblast proliferation in coculture, but Gleevec or anti TGF-b antibodies failed to reduce increased fibroblast proliferation, indicating a T reg cell specific mechanism (Figure 2G). To further understand how PDGF-B and TGF-b neutralization abrogated T reg cell stimulatory effects on fibroblasts, we next tested whether TGF-b 1 could enhance PDGF-B expression by T reg cells. Purified T reg or T eff cells from SiO 2 treated mice were thus treated with recombinant TGF-b 1 or TGF-b blocking antibodies. Under these conditions, PDGF-B expression was increased by recombinant TGF-b 1 (Figure 2H) and reduced by TGF-b neutralizing antibodies (Figure 2I) in T reg but not in T eff cells. We thus concluded that autocrine TGF-b 1 secretion significantly induced PDGF-B expression in T reg cells. All these in vitro observations supported the hypothesis that Foxp3 1 regulatory T cells recruited in the lung during fibrosis produce PDGF-B and TGF-b 1, which are able to induce fibroblast proliferation. T reg Cells Induce Lung Collagen Deposition In Vivo via PDGF-B/TGF-b To assess the potential role of T reg cells and their production of PDGF-B/TGF-b 1 in the establishment of lung fibrosis in vivo, we instilled lung T reg or T eff cells purified from the lungs of SiO 2 treated 129 Foxp3-GFP mice (Day 15) directly into the lungs of healthy mice (Figure 3A). Lung collagen accumulation reflected by increased OH-proline levels was observed when naive mice received T reg cells but not after instillation of T eff cells (Figure 3B). Histological analyses revealed that T reg but not T eff cells induced fibrotic lesions in alveolar and bronchial regions (Figures 3E and 3G). The profibrotic effect of T reg cells was also noted in C57BL/6 Foxp3-eGFP DEREG animals (Figures E3B and E3E). The importance of T reg cells in the production of growth factors was highlighted by the fact that BAL fluid levels of PDGF-B and TGF-b 1 were enhanced in mice treated with T reg cells (Figures E3G and E3H). To determine the activity of PDGF-B and TGF-b 1, naive mice receiving T reg cells were treated with a dosage of Gleevec known to block PDGF-B and TGF-b 1 signaling pathways (100 mg/kg/d) (21). The profibrotic effect of purified T reg cells in the lungs of healthy mice was abolished by Gleevec (Figures 3B and 3F). These in vivo observations demonstrated that T reg cells accumulated during the

5 1274 AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL Figure 2. Foxp3 1 regulatory T (T reg) cells stimulate lung fibroblast proliferation by producing PDGF-B and TGF-b 1. (A) Schematic representation of the cocultures of naive lung fibroblasts with T reg or CD4 1 Foxp3-GFP 2 (T eff) cells purified from the lung of 15-day silica-treated Foxp3-GFP transgenic mice. (B and C) Fibroblast proliferation assessed by 3 H-thymidine incorporation after 48 hours of coculture with increasing numbers ( ) of T reg cells (B) or T eff cells (C) purified from the lung of Foxp3-GFP mice treated with silica. Recombinant human PDGF-BB (10 ng/ml) was used as a positive control for fibroblast proliferation. Four independent experiments were performed with similar results. (D) Expression of PDGF-B and (E) TGF-b 1 assessed by RT-qPCR in T reg and T eff cells purified from the lung of Foxp3-GFP mice 15 days after silica (SiO 2 ) or saline (NaCl) treatment. The expression of genes was normalized on that of 18S RNA. Bars represent means 6 SEM (n ¼ 2 3). (F) Fibroblast proliferation after treatment with recombinant human PDGF-BB (10 ng/ml) or human TGF-b 1 (5 ng/ml) alone or combined with imatinib (Gleevec, 100 nm) or anti-tgfb antibodies (5 mg/ml). Two independent experiments were performed with similar results. (G) Lung fibroblast proliferation in cocultures with T reg cells or CD11c 1 cells purified from the lung of silica-treated Foxp3- GFP mice. T reg or CD11c 1 cells were added onto fibroblasts alone or combined with imatinib (Gleevec, 100 nm) or anti-tgfb antibodies (5 mg/ml). Recombinant human PDGF-BB (10 ng/ml) was used as a positive control for fibroblast proliferation. Two independent experiments were performed with similar results. Bars represent means 6 SEM (n ¼ 3). (H and I) Expression of PDGF-B assessed by RT-qPCR in T reg and T eff cells purified from the lung of silica-treated Foxp3-GFP mice and exposed in vitro to rtgf-b 1 (0.1 or 1 ng/ml) for 3 hours (I) or anti-tgfb antibodies (5 mg/ml) for 24 hours (H). The expression of PDGF-B was normalized on that of 18S RNA. Bars represent means 6 SEM (n ¼ 3). Two independent experiments were performed with similar results. These results were statistically analyzed using the t test. *P, 0.05, **P, 0.01, and ***P, indicate a statistically significant difference with medium alone conditions (white column) or between indicated bars in the graphs.

6 Lo Re, Lecocq, Uwambayinema, et al.: PDGF-B/TGF-b Pathway Mediates Profibrotic Activity of T reg Cells 1275 Figure 3. Gleevec abrogates Foxp31 regulatory T (T reg) cell induced lung collagen deposition after transfer into naive mice. (A) Schematic representation of T reg or CD41 Foxp32 effector T (T eff) cells instillation protocol. (B) Hydroxyproline (OH-proline) content measured by HPLC in lung homogenates of naive Foxp3-GFP mice 15 days after instillation of T reg or T eff cells purified from the lung of 15 daysilicotic Foxp3-GFP mice. Saline solution (PBS) and silica (SiO2) were used as controls. Gleevec was given to T reg cell instilled mice (100 mg/kg/d). Bars represent means 6 SEM (n ¼ 3 5). Two independent experiments were performed with similar results. These results were treated statistically by a t test. *P, 0.05 and **P, 0.01 indicate a statistically significant difference with the saline-treated group or between indicated columns in the graphs. (C G) Sections (5-mm) of paraffin-embedded lung tissue of a PBS- (C), SiO2- (D), T reg cell (E), T reg cell and Gleevec- (F), or T eff cell instilled (G) mouse stained with hematoxylin and eosin (C G, left) or Masson s trichrome (C G, right). Sections are representative of five mice examined. Original magnification: 350 (C G left) and 3200 (C G, right). pathogenic process contribute to the development of lung fibrosis through a PDGF-B/TGF-b1 dependent axis. Foxp31 Regulatory T Cells Repress Pulmonary Influx of T eff Cells and Neutrophils To delineate the potential antiinflammatory functions of Foxp31 regulatory T cells during lung tissue responses to SiO2 (see Figures 1C, 1D, 1F, and 1G), we used DEREG mice, which express the DT receptor (DTR) under the control of the foxp3 gene locus (19), allowing selective depletion of T reg cells after DT treatment (Figure 4A). DT intraperitoneal injections at Days 10 and 11 significantly reduced the fraction of Foxp3-GFP expressing cells among the CD41 cells in the lung and thymus 15 days after SiO2 treatment (Figures 4B and 4C; Figure E4A and E4B, respectively). DT treatment had no impact on other cell populations, such as CD11c1 or B2201 (not shown), emphasizing the specific and efficient T reg cell depletion in DT-treated DEREG mice. Influx of CD41 and effector T cells was significantly increased in T reg cell depleted (with DT) mice 15 days after SiO2 instillation

7 1276 AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL Figure 4. Depletion of regulatory T cells enhances lung accumulation of polarized-effector T cells and neutrophils after silica (SiO 2 ). (A) Schematic representation of CD4 1 Foxp3 1 regulatory T (T reg) cell short-term depletion protocol. (B) Percentage of CD4 1 cells that expressed Foxp3-GFP in the lung of Foxp3-eGFP/DTR DEREG mice treated or not with an intraperitoneal administration of diphtheria toxin (DT) 15 days after NaCl or SiO 2 instillation. Three independent experiments were performed with similar results. Bars represent means 6 SEM (n ¼ 3 7). (C) FACS analysis of CD4, forward scatter, and Foxp3-GFP expression among the CD4 1 performed 15 days after SiO 2 treatment in the lung of DEREG mice treated with or without DT. FACS plots were gated on CD4 1 cells (R3 region). (D) Number of T eff cells in the lung of T reg cell depleted (with DT) or Treg cell competent mice (without DT) 15 days after NaCl or SiO 2 instillation. (E) Number of neutrophils assessed in the bronchoalveolar lavage fluid of T reg cell depleted or T reg cell competent DEREG mice 15 days after NaCl or SiO 2 instillation. (F I) Quantification of IL-13 (F), IL-4 (G), IFN-g (H), and IL- 17A (I) by ELISA in the bronchoalveolar lavage fluid of T reg cell depleted and T reg cell competent DEREG mice 15 days after NaCl or SiO 2 instillation. Bars represent means 6 SEM (n ¼ 3 8). These results were treated statistically by a t test. *P, 0.05 and ***P, indicate a statistically significant difference between values measured in silica-treated mice and saline-treated mice or between indicated bars in the graphs.

8 Lo Re, Lecocq, Uwambayinema, et al.: PDGF-B/TGF-b Pathway Mediates Profibrotic Activity of T reg Cells 1277 in comparison with T reg cell competent (without DT) mice (Figures E5C and 4D, respectively). An increase of inflammation, measured by neutrophil influx (Figure 4E), lactate dehydrogenase activity, and protein content (Figures E5A and E5B) in BAL fluid, was also observed after SiO 2 treatment in T reg cell depleted mice compared with T reg cell competent mice. Enhanced CD4 1 T cell accumulation and inflammation was not observed in DT-treated WT mice compared with WT mice without DT (Figures E5A E5D). The signatures of Th2, Th1, and Th17 polarization estimated by elevated BAL levels of IL-13, IL-4, IFN-g, and IL-17A (Figures 4F 4I) were exacerbated after SiO 2 treatment in T reg cell depleted mice. Finally, enhanced Th cytokine levels were not observed in DT-treated WT mice in comparison to WT mice without DT (Figures E5E and E5F). Altogether, these data indicated that chronic recruitment of T reg cells limited T eff cell accumulation and neutrophilic inflammation in SiO 2 treated mice. Absence of T reg Cells Reduces PDGF-B and TGF-b 1 Expression but Not Collagen Deposition Pulmonary (Figures 5B and 5C) and thymic (Figure E4C and E4D) T reg cell depletion in DEREG mice (Figure 5A) was observed during the long-term lung responses to SiO 2 particles (until 60 d). Thus, DT-treated DEREG mice also represented an appropriate model to further document the contribution of T reg cells in the establishment of experimental lung fibrosis. We first assessed whether long-term T reg cell depletion was associated with a reduced production of PDGF-B and TGF-b 1, which accounted for their in vitro and in vivo fibrogenic activity (see Figures 2 and 3). The BAL fluid levels of PDGF-B (Figure 5D) and TGF-b 1 (Figure 5E) were reduced in T reg cell depleted mice 60 days after SiO 2 instillation in comparison with T reg cell competent mice. We next compared the intensity of lung fibrosis in T reg cell depleted and T reg cell competent mice. The reduction of PDGF-B and TGF-b 1 production in depleted mice was not accompanied with a concomitant reduction of collagen deposition because pulmonary OH-proline contents were not modified in T reg cell depleted mice compared with T reg cell competent animals (Figure 5F). These observations suggested that an alternate fibrotic mechanism was operative after T reg cell depletion. T eff cells and neutrophils are known to play a role during fibrogenesis (6, 17). We thus hypothesized that their exacerbated accumulation in Figure 5. Depletion of regulatory T cells decreases PDGF-B and TGF-b 1 production but not collagen deposition. (A) Schematic representation of CD4 1 Foxp3 1 regulatory T (T reg) cell long-term depletion protocol. (B) Percentage of CD4 1 cells that expressed Foxp3-GFP in the lung of Foxp3-eGFP/DTR DEREG mice treated or not with an intraperitoneal administration of diphtheria toxin (DT) 60 days after NaCl or silica (SiO 2 ) instillation. Three independent experiments were performed with similar results. Bars represent means 6 SEM (n ¼ 3 7). (C) FACS analysis of CD4, forward scatter, and Foxp3-GFP expression performed 60 days after SiO 2 treatment in the lung of DEREG mice treated with or without DT. FACS plots were gated on CD4 1 cells (R3 region). (D) Quantification of PDGF-BB and (E) active TGF-b 1 by ELISA in the bronchoalveolar fluid of T reg cell depleted (with DT) or T reg cell competent mice (without DT) 60 days after NaCl or SiO 2 instillation. Similar results were obtained in two independent experiments. Bars represent means 6 SEM (n ¼ 3 9). (F) Hydroxyproline (OH-proline) content assessed in the lung homogenate of T reg cell depleted and T reg cell competent mice 60 days after NaCl or SiO 2 instillation. Bars represent means 6 SEM (n ¼ 3 9). Two independent experiments were performed with similar results. These results were statistically analyzed using the t test. **P, 0.01 and ***P, indicate a statistically significant difference between values measured in silica-treated mice and saline-treated mice or between indicated bars in the graphs.

9 1278 AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL Figure 6. Persistent lung fibrosis in the absence of CD4 1 Foxp3 1 regulatory T (T reg) cells is driven by CD4 1 Foxp3 2 effector T (T eff) cells. (A) Hydroxyproline (OHproline) content assessed in the lung homogenates of T reg cell depleted DEREG mice 60 days after NaCl or silica (SiO 2 ) instillation. Mice were treated with anti-cd4 antibody (AbCD4) or dexamethasone (DEXA). Bars represent means 6 SEM (n ¼ 3 5). These results were treated statistically by a t test. * P, 0.05 indicates a statistically significant difference between indicated bars in the graphs. (B) Schematic representation of T eff cell instillation protocol. (C) OH-proline content measured by HPLC in lung homogenates of naive wild-type (C57BL/6) or Rag2 2/2 mice 15 days after instillation of T eff cells purified from the lung of 15 day-silicotic T reg cell depleted mice. Saline solution (PBS) and SiO 2 were used as controls. Bars represent means 6 SEM (n ¼ 3 5). These results were treated statistically by a t test. *P, 0.05 indicates a statistically significant difference with the saline-treated group or between indicated columns in the graphs. (D) Sections (5 mm) of paraffin-embedded lung tissue of T eff cell instilled WT naive mouse and (E) Rag2 2/2 naive mouse stained with Masson s trichrome. Sections are representative of five mice examined. Original magnification: (F) Schematic representation of naive lung fibroblasts and T eff cell cocultures. (G) Fibroblast proliferation assessed by 3 H-thymidine incorporation after addition of increasing numbers ( ) of T eff cells purified from the lung of T reg depleted mice treated with silica. The effect of T eff cells ( ) on fibroblast proliferation was assessed with neutralizing antibodies directed against IL-4, IL-13, IFN-g, or IL-17 (5 mg/ml). Recombinant human PDGF-BB (10 ng/ml) was used as a positive control for fibroblast proliferation. Bars represent means 6 SEM (n ¼ 3). Similar results were obtained in two independent experiments. These results were statistically analyzed using the t test. *P, 0.05 and **P, 0.01 indicate a statistically significant difference with medium alone conditions (white column) or between indicated bars in the graphs. the absence of T reg cells could account for the persistence of fibrosis in these animals. Effector T Cells Possess Profibrotic Effects by Producing IL-4 in the Absence of T reg Cells To evaluate the possibility that CD4 1 effector T cell influx or neutrophilic inflammation induced the fibrotic reaction in T reg cell depleted mice, we combined T reg cell depletion with anti-cd4 antibody treatment or steroids (dexamethasone) (22, 23). CD4 1 cell depletion obtained by the injection of anti-cd4 antibodies in T reg cell depleted mice abolished SiO 2 induced lung fibrosis (estimated by OH-proline levels) in comparison with mice without antibody treatment (Figure 6A). In contrast, dexamethasone, known to abrogate lung inflammation, failed to decrease the OH-proline content (Figure 6A). These observations demonstrated that accumulated CD4 1 effector T cells induced lung fibrosis when T reg cells were eliminated. In SiO 2 treated T reg cell competent animals, anti-cd4 antibody treatment completely depleted T reg and T eff cell populations and reduced lung fibrosis (OH-proline content for SiO 2 treated T reg cell competent mice: without anti-cd4 ¼ mg per lung; with anti-cd4 ¼ mg per lung). To determine the profibrotic functions of effector T cells when T reg cells are absent, we purified T eff cells from T reg cell depleted silicotic mice and administered them into naive WT animals or Rag2 2/2 mice, which are completely deficient in T reg cells (Figure 6B). Lung collagen accumulation reflected by increased OH-proline levels and by histological analyses was observed when T eff cells were injected into naive

10 Lo Re, Lecocq, Uwambayinema, et al.: PDGF-B/TGF-b Pathway Mediates Profibrotic Activity of T reg Cells 1279 Figure 7. Mutual roles of regulatory and effector T lymphocytes in experimental lung fibrosis. (A) Persistent recruitment of immunosuppressive CD4 1 Foxp3 1 regulatory T (T reg) cells (blue curve) to limit the establishment of chronic inflammation (green curve) participates in the development of lung fibrosis (red line). TGF-b secreted in an autocrine manner by T reg cells induces PDGF-B production, resulting in fibroblast proliferation and ultimately lung fibrosis. (B) Insufficient T reg cell immunosuppressive activity (blue curve) results in accumulation of CD4 1 Foxp3 2 effector T (T eff) cells (green curve). Sustained expression of profibrotic cytokines (IL-4, IL-13, IFN-g, IL-17) by these effector T cells is implicated in chronic inflammation (green line), fibroblast activation and fibrosis (red line). Rag2 2/2 mice (Figures 6C and 6E) but not into WT mice (Figures 6C and 6D), indicating that T eff cells from T reg cell depleted mice possess profibrotic activities. The lack of effect of T eff cell instillation into WT mice can be explained by the presence of an immunosuppressive environment that controls the injected T eff cells. To clarify the profibrotic mechanism of the T eff cells and the importance of their cytokine products when T reg cells are insufficient, we used a coculture system using mouse lung fibroblasts and lung T eff cells purified from T reg cell depleted mice 15 days after silica instillation (Figure 6F). Fibroblast proliferation was evaluated in cocultures with increasing numbers of lung T eff cells in the presence of neutralizing antibodies directed against the respective T eff cell secreted cytokines IL-4, IL-13, IFN-g, or IL-17A (Figure 6G). T eff cells purified from SiO 2 treated T reg cell depleted mice increased fibroblast proliferation in a T eff cell dose-dependent manner, and IL-4 neutralization reduced this activity (Figure 6G). T eff cells cultured alone did not incorporate 3 H- thymidine (data not shown). Altogether, these results indicate that lung fibrosis observed in the absence of T reg cells results from CD4 1 effector T cells and their production of fibrogenic cytokines, in particular IL-4. DISCUSSION Several studies strongly support a link between the development of lung fibrosis and the inflammatory process coexisting with the disease and suggest that inflammation and its mediators drive the fibrotic process (6). However, antiinflammatory treatments are not effective at mitigating pulmonary fibrosis in humans or animals. Thus, the paradigm that pulmonary inflammation drives fibrogenesis has been challenged, and it has been proposed that, in some cases, the pathological process is mediated by alternative mechanisms (2, 24). In this context, our previous studies have shown that experimental lung fibrosis in mice results from the action of the immunosuppressive cytokines TGF-b and IL-10 produced to limit the development of chronic inflammation (25). Indeed, TGF-b and IL-10 induce lung collagen deposition when overexpressed in transgenic or SiO 2 treated mice (22, 26 29). It is also generally accepted that TGF-b and IL-10 are essential for regulatory T lymphocyte (T reg cell) expansion and immunosuppressive activity (16), but the role of this CD4 1 T population in fibrogenesis remains elusive. In this study, we first discovered that lung tissue accumulation of T reg cells accompanied the development of pulmonary fibrosis. The lack of significant local proliferation of these cells suggested that T reg cells were recruited to the fibrotic lung. A similar mechanism of recruitment has been proposed to explain pulmonary T reg accumulation in experimental asthma and pneumonia (30, 31). The presence of T reg cells during fibrogenesis has been reported in recent human studies. Cellular infiltrates in fibrotic skin, lymphatic, liver, and renal tissue were shown to include high proportions of T reg cells as estimated in biopsies (32 35). T reg cell counts have been shown to be slightly reduced in the BAL fluid or blood of patients developing idiopathic pulmonary fibrosis or silicosis (36, 37), but the lung tissue T reg cell content was not assessed in these studies. Recently, some authors have proposed that immunosuppressive T reg cells could promote fibrosis because these lymphocytes secrete the profibrotic cytokine TGF-b (17). We demonstrated

11 1280 AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL for the first time that, besides TGF-b expression, Foxp3 1 regulatory T cells expressed PDGF-B, another crucial growth factor for fibrogenesis. Several studies have implicated macrophage-derived PDGF working in concert with TGF-b in the development of lung, liver, and renal fibrosis (38). Although PDGF induces fibroblast recruitment and proliferation (39), TGF-b stimulates extracellular matrix synthesis and fibroblast morphologic transformation (40). In this study, we found that, in addition to macrophages, T reg cells represent a new and important source of PDGF-B and demonstrated that TGF-b induced, in an autocrine manner, the expression of PDGF-B by T reg cells. The direct effects of T reg cells on fibroblast proliferation recapitulate the main function of PDGF as a primary mitogen for fibroblasts during lung fibrosis (39). Recent studies have demonstrated that resident pulmonary fibroblasts are essential for pulmonary fibrosis to develop and represent key cells in determining fibrocyte recruitment and myofibroblast differentiation (41, 42). It is thus likely that the role of T reg cells is to increase tissue fibroblast numbers and, consequently, to amplify the subsequent fibroblast activation and collagen deposition. The importance of T eff cell polarized immune responses in the development of pulmonary fibrosis has been investigated in several models (6). Studies using transgenic and deficient mice or blocking antibodies demonstrated that the Th2 cytokines (IL-4 and IL-13) are important in the establishment of experimental lung fibrosis induced by bleomycin, infection, and allergens (12, 43). In vitro, recombinant Th2 cytokines directly affect fibroblast functions by inducing proliferation, differentiation, and collagen production (13, 44). Similarly, in mouse models, Th1 cells and their related cytokines (TNF-a and IFN-g) participate in the establishment of bleomycin-induced lung fibrosis by promoting chronic lung inflammation and fibroblast proliferation (14, 44). However, in vitro evidence indicates that the Th1 cytokine IFN-g also possesses antifibrotic activities by down-regulating collagen production in fibroblasts (45, 46). Recently, experimental studies clarified the role of Th17 lymphocytes, another proinflammatory T eff lymphocyte subset, and showed that the Th17 cytokine IL-17A plays a crucial role in IL-1b-, infection-, and bleomycin-induced lung fibrosis in mice (11, 47). A cooperative role for IL-17A and TGF-b is involved in this pathological pathway. Altogether, these data suggest that Th2, Th17, and (to a lesser extent) Th1 cells can contribute to pathological collagen deposition and lead to experimental pulmonary fibrosis. However, it remains unclear whether IL-4R a, IL-17R, or IFN-g deficiency strongly disrupts chronic fibrosis induced by SiO 2 particles in vivo (20, 48 50). We observed here a heightened production of IL-4, IL-13, IFNg, and IL-17A in T reg cell deficient mice, and blocking these T effector cells abolished lung fibrosis. We thus conclude that the role of effector T lymphocytes in fibrogenesis induced by SiO 2 is particularly evident when T reg cell activity is restricted. Our in vitro findings further indicated that, among the T eff cell derived fibrogenic cytokines, IL-4 appeared to be a key mediator and accounted for the proliferative activity of T eff cells on fibroblasts. In vivo, it is likely that Th2 and Th17 cytokines produced by T eff cells also contribute to silicotic fibrosis development by activating other lung cells, such as macrophages and epithelial cells. In conclusion, PDGF-producing T reg cells persistently accumulated in the silicotic lung to control inflammation have the capacity to trigger the development of lung fibrosis (Figure 7A). When their immunosuppressive activities are insufficient, fibrogenic and inflammatory effects of T eff cell responses (Th2, Th17, and Th1) are predominant and lead to fibrosis (Figure 7B). The mutual roles of T reg and T eff cells and their profibrotic activities lead to the concept of immunosuppressionand inflammation-related fibrosis, respectively. Our findings may be relevant to human pathology. Strategies for treating lung fibrosis have been proposed based on the assumption that the fibroproliferative disease is due to a single T eff lymphocyte subset emerging during the establishment of the disease. Based on our animal findings, we need to consider the possibility that diverse T cell pathways may drive fibroproliferative wound healing. Consequently, CD4 1 regulatory and effector T lymphocytes and their cytokine products could become therapeutic targets in patients developing fibrotic diseases. Particularly, our study identified the production of PDGF-B and TGF-b by T reg cells as a potentially important therapeutic target when inflammation is controlled or absent. Finally, the fact that T reg cells represent an abundant source of PDGF-B could be of interest in other disorders involving this growth factor, such as atherosclerosis and cancer. Author disclosures are available with the text of this article at Acknowledgment: The authors thank Sem H. Phan (Department of Pathology, University of Michigan) for helpful discussions and critical reading of the manuscript and Alexander Rudensky for providing us the Foxp3-GFP transgenic mice. References 1. du Bois RM. Strategies for treating idiopathic pulmonary fibrosis. Nat Rev Drug Discov 2010;9: Eickelberg O, Selman M. Update in diffuse parenchymal lung disease Am J Respir Crit Care Med 2010;181: Riteau N, Gasse P, Fauconnier L, Gombault A, Couegnat M, Fick L, Kanellopoulos J, Quesniaux VF, Marchand-Adam S, Crestani B, et al. Extracellular ATP is a danger signal activating P2X7 receptor in lung inflammation and fibrosis. Am J Respir Crit Care Med 2010;182: Burdick MD, Murray LA, Keane MP, Xue YY, Zisman DA, Belperio JA, Strieter RM. CXCL11 attenuates bleomycin-induced pulmonary fibrosis via inhibition of vascular remodeling. Am J Respir Crit Care Med 2005;171: Mercer PF, Johns RH, Scotton CJ, Krupiczojc MA, Konigshoff M, Howell DC, McAnulty RJ, Das A, Thorley AJ, Tetley TD, et al. Pulmonary epithelium is a prominent source of proteinase-activated receptor-1-inducible CCL2 in pulmonary fibrosis. Am J Respir Crit Care Med 2009;179: Wynn TA. Integrating mechanisms of pulmonary fibrosis. J Exp Med 2011;208: Luzina IG, Todd NW, Iacono AT, Atamas SP. Roles of T lymphocytes in pulmonary fibrosis. J Leukoc Biol 2008;83: Rom WN, Travis WD. Lymphocyte-macrophage alveolitis in nonsmoking individuals occupationally exposed to asbestos. Chest 1992; 101: Piguet PF, Collart MA, Grau GE, Kapanci Y, Vassalli P. Tumor necrosis factor/cachectin plays a key role in bleomycin-induced pneumopathy and fibrosis. J Exp Med 1989;170: Luzina IG, Todd NW, Nacu N, Lockatell V, Choi J, Hummers LK, Atamas SP. Regulation of pulmonary inflammation and fibrosis through expression of integrins alphavbeta3 and alphavbeta5 on pulmonary T lymphocytes. Arthritis Rheum 2009;60: Wilson MS, Madala SK, Ramalingam TR, Gochuico BR, Rosas IO, Cheever AW, Wynn TA. Bleomycin and IL-1beta-mediated pulmonary fibrosis is IL-17A dependent. J Exp Med 2010;207: Fichtner-Feigl S, Strober W, Kawakami K, Puri RK, Kitani A. IL-13 signaling through the IL-13alpha2 receptor is involved in induction of TGF-beta1 production and fibrosis. Nat Med 2006;12: Huaux F, Liu T, McGarry B, Ullenbruch M, Phan SH. Dual roles of IL-4 in lung injury and fibrosis. J Immunol 2003;170: Chen ES, Greenlee BM, Wills-Karp M, Moller DR. Attenuation of lung inflammation and fibrosis in interferon-gamma-deficient mice after intratracheal bleomycin. Am J Respir Cell Mol Biol 2001;24:

CD4 T lymphocytes in lung fibrosis: diverse subsets, diverse functions

CD4 T lymphocytes in lung fibrosis: diverse subsets, diverse functions Review CD4 T lymphocytes in lung fibrosis: diverse subsets, diverse functions Sandra Lo Re, Dominique Lison, and François Huaux 1 Louvain Centre for Toxicology and Applied Pharmacology, Institut de Recherche

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Optimizing Intracellular Flow Cytometry:

Optimizing Intracellular Flow Cytometry: Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Examples of questions for Cellular Immunology/Cellular Biology and Immunology

Examples of questions for Cellular Immunology/Cellular Biology and Immunology Examples of questions for Cellular Immunology/Cellular Biology and Immunology Each student gets a set of 6 questions, so that each set contains different types of questions and that the set of questions

More information

Interleukin-20 is associated with delayed healing in diabetic wounds

Interleukin-20 is associated with delayed healing in diabetic wounds Interleukin-20 is associated with delayed healing in diabetic wounds Phillip Finley, PhD Integrated and Applied Sciences Program Biology and Statistics/Research Methodology Normal Healing Body s natural

More information

Supporting Information

Supporting Information Supporting Information Rock et al. 10.1073/pnas.1117988108 Fig. S1. Heterogeneity of stromal cells in normal and fibrotic mouse lungs. Sections of normal mouse lungs (A and D) and fibrotic lungs collected

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

Dioscin Exerts Protective Effects Against Crystalline Silica-induced Pulmonary Fibrosis in Mice

Dioscin Exerts Protective Effects Against Crystalline Silica-induced Pulmonary Fibrosis in Mice Ivyspring International Publisher 4255 Theranostics Research Paper 2017; 7(17): 4255-4275. doi: 10.7150/thno.20270 Dioscin Exerts Protective Effects Against Crystalline Silica-induced Pulmonary Fibrosis

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity

More information

Following T-cell activation and differentiation with HTRF reagents: IL-2, IFN-γ and IL-17

Following T-cell activation and differentiation with HTRF reagents: IL-2, IFN-γ and IL-17 Following T-cell activation and differentiation with HTRF reagents: IL-2, IFN-γ and IL-17 4 th HTRF Symposium for Drug Discovery Avignon, Sept. 24-26, 28 Introduction: T-cells have effector and helper

More information

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through

More information

Small Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment

Small Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment Small Molecule Inhibitor of the Wnt Pathway (SM755) as a Potential Topical Scleroderma Treatment Vishal Deshmukh, PhD, Allison Hood, Yusuf Yazici, MD Disclosures Vishal Deshmukh, Ph.D. o Financial disclosure:

More information

Cell-mediated Immunity

Cell-mediated Immunity Cellular & Molecular Immunology Cell-mediated Immunity Nicholas M. Ponzio, Ph.D. Department of Pathology & Laboratory Medicine April 6, 2009 Today s Presentation: Overview Cellular Interactions In Humoral

More information

Uncovering the mechanisms of wound healing and fibrosis

Uncovering the mechanisms of wound healing and fibrosis Any Questions??? Ask now or contact support support@sabiosciences.com 1-888-503-3187 International customers: SABio@Qiagen.com Uncovering the mechanisms of wound healing and fibrosis Webinar related questions:

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

An autoimmune perspective on neuromuscular diseases

An autoimmune perspective on neuromuscular diseases An autoimmune perspective on neuromuscular diseases Colin Chalk MD,CM FRCPC Montreal General Hospital McGill University Schlomchik 2001 The proportion of neuromuscular patients who have an autoimmune cause

More information

MEK/ERK INHIBITORS: A PROOF-OF-CONCEPT STUDY IN LUNG FIBROSIS

MEK/ERK INHIBITORS: A PROOF-OF-CONCEPT STUDY IN LUNG FIBROSIS MEK/ERK INHIBITORS: A PROOF-OF-CONCEPT STUDY IN LUNG FIBROSIS Andrew Leask Departments of Dentistry and Physiology and Pharmacology University of Western Ontario Dental Sciences Building London ON Canada

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Hsp90 regulation of fibroblast activation in pulmonary fibrosis

Hsp90 regulation of fibroblast activation in pulmonary fibrosis Downloaded from http:// on January 22, 2018. Hsp90 regulation of fibroblast activation in pulmonary fibrosis Vishwaraj Sontake, 1,4 Yunguan Wang, 2 Rajesh K. Kasam, 1,4 Debora Sinner, 3 Geereddy B. Reddy,

More information

Virginia A. Folcik, Ph.D. and Gerard J. Nuovo, M.D. The Ohio State University at Marion, and Phylogeny, Inc.

Virginia A. Folcik, Ph.D. and Gerard J. Nuovo, M.D. The Ohio State University at Marion, and Phylogeny, Inc. As close as you can get to finding the cause of disease with Agent-Based Modeling Virginia A. Folcik, Ph.D. and Gerard J. Nuovo, M.D. The Ohio State University at Marion, and Phylogeny, Inc. Koch s Postulates

More information

Acquired Immunity 2. - Vaccines & Immunological Memory - Wataru Ise. WPI Immunology Frontier Research Center (IFReC) Osaka University.

Acquired Immunity 2. - Vaccines & Immunological Memory - Wataru Ise. WPI Immunology Frontier Research Center (IFReC) Osaka University. Acquired Immunity 2 - Vaccines & Immunological Memory - Wataru Ise WPI Immunology Frontier Research Center (IFReC) Osaka University Outline 1. What is vaccine (vaccination)? 2. What is immunological memory?

More information

The Adaptive Immune Responses

The Adaptive Immune Responses The Adaptive Immune Responses The two arms of the immune responses are; 1) the cell mediated, and 2) the humoral responses. In this chapter we will discuss the two responses in detail and we will start

More information

1. The scavenger receptor, CD36, functions as a coreceptor for which TLR? a. TLR ½ b. TLR 3 c. TLR 4 d. TLR 2/6

1. The scavenger receptor, CD36, functions as a coreceptor for which TLR? a. TLR ½ b. TLR 3 c. TLR 4 d. TLR 2/6 Allergy and Immunology Review Corner: Cellular and Molecular Immunology, 8th Edition By Abul K. Abbas, MBBS, Andrew H. H. Lichtman, MD, PhD and Shiv Pillai, MBBS, PhD. Chapter 4 (pages 62-74): Innate Immunity

More information

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest

More information

LAMPvax DNA Vaccines as Immunotherapy for Cancer - Three Case Studies

LAMPvax DNA Vaccines as Immunotherapy for Cancer - Three Case Studies LAMPvax DNA Vaccines as Immunotherapy for Cancer - Three Case Studies Cancer immunotherapy has emerged as a clinically validated tool for fighting certain kinds of cancers. These therapeutic cancer vaccines

More information

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation IMMUNOLOGICAL MEMORY CD4 T Follicular Helper Cells Memory CD8 T Cell Differentiation CD4 T Cell Differentiation Bcl-6 T-bet GATA-3 ROR t Foxp3 CD4 T follicular helper (Tfh) cells FUNCTION Provide essential

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmunity Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmune disease can be caused to primary defects in B cells, T cells and possibly

More information

Antigen-specific peripheral shaping of the natural regulatory T cell population

Antigen-specific peripheral shaping of the natural regulatory T cell population ARTICLE Antigen-specific peripheral shaping of the natural regulatory T cell population Stephanie K. Lathrop, 1 Nicole A. Santacruz, 1 Dominic Pham, 1 Jingqin Luo, 2 and Chyi-Song Hsieh 1 1 Department

More information

Microbiology 204: Cellular and Molecular Immunology

Microbiology 204: Cellular and Molecular Immunology Microbiology 204: Cellular and Molecular Immunology Class meets MWF 1:00-2:30PM (*exceptions: no class Fri Sept 23, Fri Oct 14, Nov 11, or Wed Nov 23) Lectures are open to auditors and will be live-streamed

More information

Additional file 6. Summary of experiments characterizing development of adaptive immune response

Additional file 6. Summary of experiments characterizing development of adaptive immune response Additional file 6. Summary of experiments characterizing development of adaptive immune response Tests performed to evaluate the development of adaptive immunity in patients are summarized in Table 1.

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Regulatory T cells (Treg)

Regulatory T cells (Treg) Incomplete Depletion and Rapid Regeneration of Foxp3 Regulatory T Cells Following Anti-CD25 Treatment in Malaria-Infected Mice 1 Kevin N. Couper,* Daniel G. Blount,* J. Brian de Souza,* Isabelle Suffia,

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Naive, memory and regulatory T lymphocytes populations analysis

Naive, memory and regulatory T lymphocytes populations analysis Naive, memory and regulatory T lymphocytes populations analysis Jaen Olivier, PhD ojaen@beckmancoulter.com Cellular Analysis application specialist Beckman Coulter France Introduction Flow cytometric analysis

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Induction of antigenspecific. peptide epitopes. University of Bristol

Induction of antigenspecific. peptide epitopes. University of Bristol Induction of antigenspecific tolerance with peptide epitopes d.c.wraith@bris.ac.uk University of Bristol Antigen-directed therapy of hypersensitivity diseases In 1911, Drs John Freeman and Leonard Noon

More information

Properties & Overview of IRs Dr. Nasser M. Kaplan JUST, Jordan. 10-Jul-16 NM Kaplan 1

Properties & Overview of IRs Dr. Nasser M. Kaplan JUST, Jordan. 10-Jul-16 NM Kaplan 1 Properties & Overview of IRs Dr. Nasser M. Kaplan JUST, Jordan 10-Jul-16 NM Kaplan 1 Major components of IS & their properties Definitions IS = cells & molecules responsible for: 1- Physiologic; protective

More information

Simultaneous correlation of cytokine production with Treg and Th17 cell proliferation

Simultaneous correlation of cytokine production with Treg and Th17 cell proliferation Simultaneous correlation of cytokine production with Treg and Th17 cell proliferation Jurg Rohrer, PhD Director, R&D BD Biosciences 23-11773-00 For Research Use Only. Not for use in diagnostic or therapeutic

More information

ParActin For Cold & Flu

ParActin For Cold & Flu ParActin For Cold & Flu Colds and flu can reach epidemic proportions during the winter months. There are more than 95 million flu cases in the U.S. annually, according to the Centers for Disease Control,

More information

Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells

Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells Research article Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells Chen Wang, 1 Tai Yi, 1 Lingfeng Qin, 2 Roberto A. Maldonado, 3 Ulrich H. von Andrian, 3

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

HTRF MEASUREMENT OF CYTOKINE RELEASE FROM FRESH BLOOD SAMPLES

HTRF MEASUREMENT OF CYTOKINE RELEASE FROM FRESH BLOOD SAMPLES HTRF MEASUREMENT OF CYTOKINE RELEASE FROM FRESH BLOOD SAMPLES APPLICATION NOTE ABSTRACT Cisbio offers a comprehensive line of HTRF cytokine assays to investigate the functional response of immune cells.

More information

Foxp3-positive Macrophages Display Immunosuppressive Properties and Promote Tumor Growth

Foxp3-positive Macrophages Display Immunosuppressive Properties and Promote Tumor Growth Foxp3-positive Macrophages Display Immunosuppressive Properties and Promote Tumor Growth The Harvard community has made this article openly available. Please share how this access benefits you. Your story

More information

The Bcl-2 regulated apoptotic pathway is critical for the

The Bcl-2 regulated apoptotic pathway is critical for the The Journal of Immunology Defects in the Bcl-2 Regulated Apoptotic Pathway Lead to Preferential Increase of CD25 low Foxp3 + Anergic CD4 + T Cells Yifan Zhan,*, Yuxia Zhang,* Daniel Gray,* Emma M. Carrington,*

More information

General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center

General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center General Overview of Immunology Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center Objectives Describe differences between innate and adaptive immune responses

More information

REGULATORY PROTEINS FOR CS:

REGULATORY PROTEINS FOR CS: C S FUNCTIONS: Inflammation: histamine like, anphylatoxins (C5a). Opsonization & phagocytosis: enhance phagocytosis (C3b) Cell lysis: Membrane Attack Complex (MAC), C9 multiples. Makes small holes in thin

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

T Cell Receptor & T Cell Development

T Cell Receptor & T Cell Development T Cell Receptor & T Cell Development Questions for the next 2 lectures: How do you generate a diverse T cell population with functional TCR rearrangements? How do you generate a T cell population that

More information

Chapter 21: Innate and Adaptive Body Defenses

Chapter 21: Innate and Adaptive Body Defenses Chapter 21: Innate and Adaptive Body Defenses I. 2 main types of body defenses A. Innate (nonspecific) defense: not to a specific microorganism or substance B. Adaptive (specific) defense: immunity to

More information

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens

More information

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis

Understanding Root Cause: Pathogenesis of Hepatic Fibrosis 10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis

More information

I. Lines of Defense Pathogen: Table 1: Types of Immune Mechanisms. Table 2: Innate Immunity: First Lines of Defense

I. Lines of Defense Pathogen: Table 1: Types of Immune Mechanisms. Table 2: Innate Immunity: First Lines of Defense I. Lines of Defense Pathogen: Table 1: Types of Immune Mechanisms Table 2: Innate Immunity: First Lines of Defense Innate Immunity involves nonspecific physical & chemical barriers that are adapted for

More information

WHY IS THIS IMPORTANT?

WHY IS THIS IMPORTANT? CHAPTER 16 THE ADAPTIVE IMMUNE RESPONSE WHY IS THIS IMPORTANT? The adaptive immune system protects us from many infections The adaptive immune system has memory so we are not infected by the same pathogen

More information

Clinical Review Criteria

Clinical Review Criteria Clinical Review Criteria Autologous Platelet Derived Wound Healing Factors for Treatment of: Non Healing Cutaneous Wounds (Procuren) Non-Healing Fractures and the Associated GEM 21STM Device Platelet Rich

More information

Macrophages: the overlooked target for pulmonary fibrosis and COPD Boorsma, Carian Eline

Macrophages: the overlooked target for pulmonary fibrosis and COPD Boorsma, Carian Eline University of Groningen Macrophages: the overlooked target for pulmonary fibrosis and COPD Boorsma, Carian Eline IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if

More information

T Cell Effector Mechanisms I: B cell Help & DTH

T Cell Effector Mechanisms I: B cell Help & DTH T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide

More information

Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells

Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard

More information

The Skinny of the Immune System

The Skinny of the Immune System The Skinny of the Immune System Robert Hostoffer, DO, FACOP, FAAP Associate Professor of Pediatrics Case Western Reserve University, Cleveland, Ohio Overview 1. Immune system of the skin 2. Immune Players

More information

The Role of CD4 T Cells in the Pathogenesis of Murine AIDS

The Role of CD4 T Cells in the Pathogenesis of Murine AIDS JOURNAL OF VIROLOGY, June 2006, p. 5777 5789 Vol. 80, No. 12 0022-538X/06/$08.00 0 doi:10.1128/jvi.02711-05 Copyright 2006, American Society for Microbiology. All Rights Reserved. The Role of CD4 T Cells

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

The lysophosphatidic acid receptor LPA 1 links pulmonary fibrosis to lung injury by mediating fibroblast recruitment and vascular leak

The lysophosphatidic acid receptor LPA 1 links pulmonary fibrosis to lung injury by mediating fibroblast recruitment and vascular leak 8 Nature Publishing Group http://www.nature.com/naturemedicine The lysophosphatidic acid receptor LPA links pulmonary fibrosis to lung injury by mediating fibroblast recruitment and vascular leak Andrew

More information

Optimizing Intracellular Flow Cytometry

Optimizing Intracellular Flow Cytometry Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles

More information

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD) Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

More information

Chapter 13 Lymphatic and Immune Systems

Chapter 13 Lymphatic and Immune Systems The Chapter 13 Lymphatic and Immune Systems 1 The Lymphatic Vessels Lymphoid Organs Three functions contribute to homeostasis 1. Return excess tissue fluid to the bloodstream 2. Help defend the body against

More information

Allergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.

Allergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Allergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 19: Tolerance, Autoimmunity, and Autoinflammation Prepared

More information

Significance of the MHC

Significance of the MHC CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation Research article Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation C. Andrew Stewart, 1 Hannah Metheny, 1 Noriho Iida, 1 Loretta Smith, 1 Miranda Hanson, 1 Folkert Steinhagen,

More information

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze.

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze. This document is available at www.stemcell.com/pis Catalog #18765 EasySep Mouse CD4+CD62L+ T Cell Isolation Kit For processing 1x 10^9 cells Description Isolate highly purified naïve CD4+ T cells (CD4+CD62L+)

More information

Physiology Unit 3. ADAPTIVE IMMUNITY The Specific Immune Response

Physiology Unit 3. ADAPTIVE IMMUNITY The Specific Immune Response Physiology Unit 3 ADAPTIVE IMMUNITY The Specific Immune Response In Physiology Today The Adaptive Arm of the Immune System Specific Immune Response Internal defense against a specific pathogen Acquired

More information

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Maia Tato, Santhosh V. Kumar, Yajuan Liu, Shrikant R. Mulay, Solange Moll, Bastian Popper,

More information

The Immune System: Innate and Adaptive Body Defenses Outline PART 1: INNATE DEFENSES 21.1 Surface barriers act as the first line of defense to keep

The Immune System: Innate and Adaptive Body Defenses Outline PART 1: INNATE DEFENSES 21.1 Surface barriers act as the first line of defense to keep The Immune System: Innate and Adaptive Body Defenses Outline PART 1: INNATE DEFENSES 21.1 Surface barriers act as the first line of defense to keep invaders out of the body (pp. 772 773; Fig. 21.1; Table

More information

METHODS. participated in the study. Each subject had a normal physical examination, chest

METHODS. participated in the study. Each subject had a normal physical examination, chest METHODS Subjects Thirty-four subjects (20 men and 14 women, mean age 28.5 ± 1.2 yr) participated in the study. Each subject had a normal physical examination, chest radiograph, electrocardiogram, and laboratory

More information

There are 2 major lines of defense: Non-specific (Innate Immunity) and. Specific. (Adaptive Immunity) Photo of macrophage cell

There are 2 major lines of defense: Non-specific (Innate Immunity) and. Specific. (Adaptive Immunity) Photo of macrophage cell There are 2 major lines of defense: Non-specific (Innate Immunity) and Specific (Adaptive Immunity) Photo of macrophage cell Development of the Immune System ery pl neu mφ nk CD8 + CTL CD4 + thy TH1 mye

More information

Granulocyte and lymphocyte proteins

Granulocyte and lymphocyte proteins Granulocyte and lymphocyte proteins Hycult Biotech is a leading world-class manufacturer of research reagents in the field of innate immunity. We are a specialized partner in the development and manufacturing

More information

ARDS during Neutropenia. D Mokart DAR IPC GRRRRROH 2010

ARDS during Neutropenia. D Mokart DAR IPC GRRRRROH 2010 ARDS during Neutropenia D Mokart DAR IPC GRRRRROH 2010 Definitions Neutropenia is a decrease in circulating neutrophil white cells in the peripheral blood. neutrophil count of 1,000 1,500 cells/ml = mild

More information

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze.

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze. This document is available at www.stemcell.com/pis Catalog #18765 EasySep Mouse CD4+CD62L+ T Cell Isolation Kit For processing 1x 10^9 cells Description Isolate highly purified naïve CD4+ T cells (CD4+CD62L+)

More information

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214, Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development

More information

T cell development October 28, Dan Stetson

T cell development October 28, Dan Stetson T cell development October 28, 2016 Dan Stetson stetson@uw.edu 441 Lecture #13 Slide 1 of 29 Three lectures on T cells (Chapters 8, 9) Part 1 (Today): T cell development in the thymus Chapter 8, pages

More information