DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED"

Transcription

1 DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED Viv Peut Kent Laboratory, University of Melbourne, Australia

2 WHY ENVELOPE? Env subject to both humoral and cellular immune responses Perhaps multiple rounds of mutation would be required for effective immune escape May result in virus with reduced fitness Lower viral fitness = Lower viral load (VL) - slower progression to disease - reduced transmission rates

3 VERY UNFIT VIRUS

4 HOWEVER... Gag has recently been shown to elicit a more effective CD8 T cell response in humans. Broad Env-specific CTL responses correlated with higher levels of viremia. (Kiepiela et al., Nat Med 2007) Gag-specific CD8 T cell clones more efficient than Envspecific CD8 T cells in limiting viral replication in vitro. (Chen, Walker, 4th IAS Conference, Sydney, 2007) Gag presented much earlier than other HIV proteins. (Sacha et al., J Immunol, 2007)

5 OUTLINE OF TALK What is VL outcome of macaques responding to Env vs those responding to Gag? X4-SHIV trial analyzed What is the pattern of immune escape at Env compared to Gag? Kinetics of escape Diversity of escape motifs What is effect of therapeutic immunization with only Gag vs all SIV proteins? R5-SIVmac251 study Viral load Immunodominance

6 THE SHIVmn229 TRIAL IN 30 PIGTAIL MACAQUES Vaccination SHIV DNA and fowlpoxvirus vaccines expressing Gag and Env (De Rose et al., J Virol, 2007) - HIV-1 Env truncated - no induction of neutralizing antibodies (NAb) Challenge Heterologous X4-utilising SHIV mn229 Env-specific T cell epitope identification Eight Env-specific CD8 T cell epitopes mapped in 10 animals identified by Intracellular cytokine staining (ICS)

7 Viral Load (log 10 copies/ml plasma) CD4 Lymphocytes (%) VL AND CD4 LEVELS - ENV vs GAG A. Env CD8 T Cell Responders vs Non Responders Non responders B. Responders Weeks Post Challenge

8 Viral Load (log 10 copies/ml plasma) CD4 Lymphocytes (%) VL AND CD4 LEVELS - ENV vs GAG A B. Env CD8 T Cell Responders vs Non Responders Non responders Responders C. Gag CD8 T Cell Responders vs Non Responders D. Non responders Responders p = 0.01 p = Weeks Post Challenge

9 Poster #PO8-08

10 KINETICS OF ESCAPE - ENV vs GAG Gag vs Env epitope escape kinetics % Wild Type Virus NL NL SP SP SP RY RY AF KW KP KP9 Env Gag Weeks Post Challenge p = 0.04

11 NUMBER OF MUTANT QUASISPECIES - ENV vs GAG 4 p = 0.03 I7S9 C8 G1R8 I7 Number of Total Mutant Quasispecies at week 8 post infection Epitope KP9 Animal ID 4246 (#) clones (10) R2 R2 2aa R1 H8 del KP (9) AF (28) KW (23) G1 R3 RY (12) G3 R3 T5 RY (23) N1 S9 S9 E8 SP (16) N6 R8 I6 SP (11) GI S9 SP (14) 5aa del G4 N3 NL (15) E4 NL (11) Gag Epitopes Env Epitopes

12 BROAD vs NARROW RESPONSE Compare Gag and Env - specific CD8 T cell responses elicited by a Gag, Env, Pol and accessory proteins combined (OPAL All) vaccination with a Gag-alone vaccination (OPAL Gag). Overlapping Peptide-pulsed Autologous Leukocytes (Kent et al., Poster, #P09-06)

13 OPAL - WHAT IS INVOLVED 18 ml blood draw PBMC Pulse PBMC with Overlapping 15mer peptides (ALL or GAG) 1 h at 37 o C IV infuse PBMC back into same animal Vaccinated or Infected Pigtail Macaque IFNγ BEFORE treatment ABCDEFGHIJKLMNO EFGHIJKLMNOPQRS IJKLMNOPQRSTUV MNOPQRSTUVWXYZ Experimental Design * 36 pigtail macaques * Infected with SIVmac251 * Treated with antiretrovirals (Tenofovir, FTC) * Immunised with - Gag peptide 10 - All SIV peptides (including Gag) 4 - Controls * Recrudescence of VL studied 2 weeks AFTER treatment CD8 CD4 0 CD8 CD Intracellular IFNγ Assay

14 7 6 5 Viral Load (by Treatment Group) ΔVL = 0.93 log 10 (p = 0.01) Control OPAL All OPAL Gag Week post SIV infection

15 GAG-SPECIFIC CD8 T CELL REPONSES IFNγ Gag responses - OPAL Gag Gag responses - OPAL All Animal ID At same dose of Gag in both groups, why are Gag responses reduced in the OPAL All group???

16 NEVER THE TWAIN SHALL MEET - Gag OR Env but rarely both Week 12 post infection in the ALL group SIV Gag-specific CD8 T cell (% IFNγ+ cells) Including 2 extreme Env-specific responses SIV Env-specific CD8 T cell (% IFNγ+ cells) Excluding 2 extreme Env-specific responses

17 DOMINANCE?

18 DOMINANCE? COMPETITION?

19 IN A NUT SHELL Characteristics Maintain lower viremia Gag Env

20 IN A NUT SHELL Characteristics Gag Env Maintain lower viremia Early and rapid CD8 T cell escape (Gag-specific CTL exerts vigorous selection pressure)

21 IN A NUT SHELL Characteristics Gag Env Maintain lower viremia Early and rapid CD8 T cell escape (Gag-specific CTL exerts vigorous selection pressure) Low diversity of escape mutants (Gag more constrained in its mutational manoeuvres )

22 IN A NUT SHELL Characteristics Gag Env Maintain lower viremia Early and rapid CD8 T cell escape (Gag-specific CTL exerts vigorous selection pressure) Low diversity of escape mutants (Gag more constrained in its mutational manoeuvres ) Strong response regardless of other CD8 T cell responses (broadest multi-protein responses may not always be the most useful)

23 FUTURE WORK Are a subset of HIV Env-specific T cell responses helpful? Prevent Env responses dominating Gag responses T cell mapping and escape studies in SIV Env Explore the relationships between CD8 T cell escape, NAb escape and N-linked glycosylation sites. (Peut et al., Poster #P03-06)

24 ACKNOWLEDGEMENTS Stephen Kent and all the lab and macaque facility staff M. Davenport & J. Petravic University of NSW Scholarships AChSHM GlaxoSmithKline Univ Melbourne AIDS Vaccine 07 NHMRC NIH Australian-Thai HIV Vaccine consortium

25

26

Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys

Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys Dan H. Barouch, M.D., Ph.D. Center for Virology and Vaccine Research Beth Israel Deaconess Medical Center Ragon Institute of MGH, MIT,

More information

HIV acute infections and elite controllers- what can we learn?

HIV acute infections and elite controllers- what can we learn? HIV acute infections and elite controllers- what can we learn? Thumbi Ndung u, BVM, PhD KwaZulu-Natal Research Institute for Tuberculosis and HIV (K-RITH) and HIV Pathogenesis Programme (HPP), Doris Duke

More information

Immunization with single-cycle SIV significantly reduces viral loads after an intravenous challenge with SIV(mac)239

Immunization with single-cycle SIV significantly reduces viral loads after an intravenous challenge with SIV(mac)239 University of Massachusetts Medical School escholarship@umms Preventive and Behavioral Medicine Publications and Presentations Preventive and Behavioral Medicine 1-23-2009 Immunization with single-cycle

More information

Control of Viremia and Prevention of AIDS following Immunotherapy of SIV-Infected Macaques with Peptide- Pulsed Blood

Control of Viremia and Prevention of AIDS following Immunotherapy of SIV-Infected Macaques with Peptide- Pulsed Blood Control of Viremia and Prevention of AIDS following Immunotherapy of SIV-Infected Macaques with Peptide- Pulsed Blood Robert De Rose 1, Caroline S. Fernandez 1, Miranda Z. Smith 1, C. Jane Batten 1, Sheilajen

More information

NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2009 July 1.

NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2009 July 1. NIH Public Access Author Manuscript Published in final edited form as: Nature. 2009 January 1; 457(7225): 87 91. doi:10.1038/nature07469. Immune Control of an SIV Challenge by a T Cell-Based Vaccine in

More information

Immunization with Single-Cycle SIV Significantly Reduces Viral Loads After an Intravenous Challenge with SIV mac 239

Immunization with Single-Cycle SIV Significantly Reduces Viral Loads After an Intravenous Challenge with SIV mac 239 Immunization with Single-Cycle SIV Significantly Reduces Viral Loads After an Intravenous Challenge with SIV mac 239 Bin Jia 1, Sharon K. Ng 1, M. Quinn DeGottardi 1, Michael Piatak Jr. 2, Eloísa Yuste

More information

Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a Case Study

Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a Case Study Note: I have added some clarifying comments to the slides -- please click on Comments under View to see them. Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a

More information

2005 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.

2005 LANDES BIOSCIENCE. DO NOT DISTRIBUTE. [Human Vaccines 1:2, 45-60; March/April 2005]; 2005 Landes Bioscience Review Role of Neutralizing Antibodies in Protective Immunity Against HIV Indresh K. Srivastava* Jeffrey B. Ulmer Susan W. Barnett

More information

Anti-SIV Cytolytic Molecules in Pigtail Macaques

Anti-SIV Cytolytic Molecules in Pigtail Macaques AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 24, Number 8, 2008 Mary Ann Liebert, Inc. DOI: 10.1089/aid.2008.0081 Anti-SIV Cytolytic Molecules in Pigtail Macaques Erik Rollman, Stephen J. Turner, Katherine

More information

JAK3 inhibitor administration in vivo in chronically SIV Infected Rhesus Macaques

JAK3 inhibitor administration in vivo in chronically SIV Infected Rhesus Macaques JAK3 inhibitor administration in vivo in chronically SIV Infected Rhesus Macaques preferentially depletes NK Cells Ladawan Kowawisatsut 1 Kovit Pattanapanyasat 1 Aftab A. Ansari 2 1 Department of Immunology

More information

T cell Vaccine Strategies for HIV, the Virus. With a Thousand Faces

T cell Vaccine Strategies for HIV, the Virus. With a Thousand Faces JVI Accepts, published online ahead of print on 13 May 2009 J. Virol. doi:10.1128/jvi.00114-09 Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG

More information

CD8 + T Cells from SIV Elite Controller Macaques Recognize Mamu-B*08-Bound Epitopes and Select for Widespread Viral Variation

CD8 + T Cells from SIV Elite Controller Macaques Recognize Mamu-B*08-Bound Epitopes and Select for Widespread Viral Variation CD8 + T Cells from SIV Elite Controller Macaques Recognize Mamu-B*08-Bound Epitopes and Select for Widespread Viral Variation John T. Loffredo 1. *, Thomas C. Friedrich 1., Enrique J. León 1, Jason J.

More information

Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies

Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies Michael Seaman, Ph.D. Center for Virology and Vaccine Research Beth Israel Deaconess Medical Center Harvard Medical School J. Virol.

More information

Dissecting the Neutralizing Antibody Specificities of Broadly Neutralizing Sera from Human Immunodeficiency Virus Type 1-Infected Donors

Dissecting the Neutralizing Antibody Specificities of Broadly Neutralizing Sera from Human Immunodeficiency Virus Type 1-Infected Donors JOURNAL OF VIROLOGY, June 2007, p. 6548 6562 Vol. 81, No. 12 0022-538X/07/$08.00 0 doi:10.1128/jvi.02749-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Dissecting the Neutralizing

More information

Conserved epitopes on HIV-1, FIV and SIV p24 proteins are recognized by HIV-1 infected subjects

Conserved epitopes on HIV-1, FIV and SIV p24 proteins are recognized by HIV-1 infected subjects Human Vaccines & Immunotherapeutics ISSN: 2164-5515 (Print) 2164-554X (Online) Journal homepage: http://www.tandfonline.com/loi/khvi20 Conserved epitopes on HIV-1, FIV and SIV p24 proteins are recognized

More information

Glycosylation of the ENV Spike of Primate Immunodeficiency Viruses and Antibody Neutralization

Glycosylation of the ENV Spike of Primate Immunodeficiency Viruses and Antibody Neutralization Current HIV Research, 2004, 2, 243-254 243 Glycosylation of the ENV Spike of Primate Immunodeficiency Viruses and Antibody Neutralization Cheryl A. Pikora *1,2 1 Department of Infectious Diseases, Children

More information

A global approach to HIV-1 vaccine development

A global approach to HIV-1 vaccine development A global approach to HIV-1 vaccine development The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published Version Accessed

More information

Materials and Methods

Materials and Methods 1133 Decline of Simian Immunodeficiency Virus (SIV) Specific Cytotoxic T Lymphocytes in the Peripheral Blood of Long-Term Nonprogressing Macaques Infected with SIVmac32H-J5 Anna-Maria Geretti, 1,a Ellen

More information

5. Over the last ten years, the proportion of HIV-infected persons who are women has: a. Increased b. Decreased c. Remained about the same 1

5. Over the last ten years, the proportion of HIV-infected persons who are women has: a. Increased b. Decreased c. Remained about the same 1 Epidemiology 227 April 24, 2009 MID-TERM EXAMINATION Select the best answer for the multiple choice questions. There are 60 questions and 9 pages on the examination. Each question will count one point.

More information

HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES. Elizabeth Susan Russell

HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES. Elizabeth Susan Russell HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES Elizabeth Susan Russell A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial

More information

HVTN Laboratory Program: Immunogenicity and Research Assays

HVTN Laboratory Program: Immunogenicity and Research Assays HVTN Laboratory Program: Immunogenicity and Research Assays Erica Andersen-Nissen, PhD Director, Cape Town HVTN Immunology Laboratory Considerations for a Pan-African HIV Vaccine Development Agenda Kigali,

More information

Professor Vincent Soriano

Professor Vincent Soriano Five Nations Conference on HIV and Hepatitis in partnership with Professor Vincent Soriano Hospital Carlos III, Madrid, Spain Professor Vincent Soriano in partnership with Hospital Carlos III, Madrid,

More information

What are ADCC antibodies? Work on influenza ADCC antibodies Greenberg et al, Hashimoto et al. First describes Fluspecific

What are ADCC antibodies? Work on influenza ADCC antibodies Greenberg et al, Hashimoto et al. First describes Fluspecific 14/7/214 Acknowledgement antibodies against diverse influenza strains: Implications for universal vaccination Sinth Jegaskanda PhD Prof Stephen Kent University of Melbourne What are antibodies? Work on

More information

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Cytotoxicity assays Rory D. de Vries, PhD 1 1 Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Anti-influenza immunity Humoral / CD4+ / CD8+ / NK? Function of CTL Elimination of virus-infected cells?

More information

Specific antibody-dependent cellular cytotoxicity responses associated with slow progression of HIV infection

Specific antibody-dependent cellular cytotoxicity responses associated with slow progression of HIV infection IMMUNOLOGY ORIGINAL ARTICLE Specific antibody-dependent cellular cytotoxicity responses associated with slow progression of HIV infection Leia H. Wren, 1 Amy W. Chung, 1 Gamze Isitman, 1 Anthony D. Kelleher,

More information

HEPATITIS B: are escape mutants of concern?

HEPATITIS B: are escape mutants of concern? VACCINATION: AN EVOLUTIONARY ENGINE FOR SPECIES? Fondation Mérieux Conference Centre Veyrier-du-Lac, France November 25-27, 2013 HEPATITIS B: are escape mutants of concern? Alessandro ZANETTI Department

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

JOURNAL OF VIROLOGY, Sept. 1999, p Vol. 73, No. 9. Copyright 1999, American Society for Microbiology. All Rights Reserved.

JOURNAL OF VIROLOGY, Sept. 1999, p Vol. 73, No. 9. Copyright 1999, American Society for Microbiology. All Rights Reserved. JOURNAL OF VIROLOGY, Sept. 1999, p. 7430 7440 Vol. 73, No. 9 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Factors Associated with Slow Disease Progression

More information

Immunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group

Immunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group report Immunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group John Mascola, C Richter King & Ralph Steinman on behalf of a Working Group convened by the Global HIV

More information

Received 13 July 2000/Accepted 27 January 2001

Received 13 July 2000/Accepted 27 January 2001 JOURNAL OF VIROLOGY, May 2001, p. 4165 4175 Vol. 75, No. 9 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.9.4165 4175.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Vaccine-Elicited

More information

ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3*

ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3* ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3* 1 Department of Microbiology, Li Ka Shing Faculty of Medicine, University

More information

Title: Neutralization resistance of HIV-1 virological synapse-mediated infection is. Running Title: Virological-synapse neutralization resistance

Title: Neutralization resistance of HIV-1 virological synapse-mediated infection is. Running Title: Virological-synapse neutralization resistance JVI Accepts, published online ahead of print on 2 May 2012 J. Virol. doi:10.1128/jvi.00230-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Title: Neutralization resistance

More information

Boosts Following Priming with gp120 DNA

Boosts Following Priming with gp120 DNA Neutralizing Antibody Responses Induced with V3-scaffold Protein Boosts Following Priming with gp120 DNA Susan Zolla-Pazner NYU School of Medicine Problems with Whole Env Immunogens Poor induction of Abs

More information

Towards an HIV Cure. Steven G. Deeks Professor of Medicine University of California, San Francisco

Towards an HIV Cure. Steven G. Deeks Professor of Medicine University of California, San Francisco Towards an HIV Cure Steven G. Deeks Professor of Medicine University of California, San Francisco Why are we now talking about a cure? Emerging recognition that HAART does not fully restore health and/or

More information

Immunology Lecture 4. Clinical Relevance of the Immune System

Immunology Lecture 4. Clinical Relevance of the Immune System Immunology Lecture 4 The Well Patient: How innate and adaptive immune responses maintain health - 13, pg 169-181, 191-195. Immune Deficiency - 15 Autoimmunity - 16 Transplantation - 17, pg 260-270 Tumor

More information

Cleavage site compensatory substitutions partially restore fitness to simian immunodeficiency virus variants

Cleavage site compensatory substitutions partially restore fitness to simian immunodeficiency virus variants Boston University OpenBU Theses & Dissertations http://open.bu.edu Boston University Theses & Dissertations 215 Cleavage site compensatory substitutions partially restore fitness to simian immunodeficiency

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

Use of BONSAI decision trees for the identification of potential MHC Class I peptide epitope motifs.

Use of BONSAI decision trees for the identification of potential MHC Class I peptide epitope motifs. Use of BONSAI decision trees for the identification of potential MHC Class I peptide epitope motifs. C.J. SAVOIE, N. KAMIKAWAJI, T. SASAZUKI Dept. of Genetics, Medical Institute of Bioregulation, Kyushu

More information

Significant Protection against High-Dose Simian Immunodeficiency Virus Challenge Conferred by a New Prime-Boost Vaccine Regimen

Significant Protection against High-Dose Simian Immunodeficiency Virus Challenge Conferred by a New Prime-Boost Vaccine Regimen JOURNAL OF VIROLOGY, June 2011, p. 5764 5772 Vol. 85, No. 12 0022-538X/11/$12.00 doi:10.1128/jvi.00342-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Significant Protection

More information

Application of Reverse Genetics to Influenza Vaccine Development

Application of Reverse Genetics to Influenza Vaccine Development NIAID Application of Reverse Genetics to Influenza Vaccine Development Kanta Subbarao Laboratory of Infectious Diseases NIAID, NIH Licensed Vaccines for Influenza Principle: Induction of a protective

More information

Micropathology Ltd. University of Warwick Science Park, Venture Centre, Sir William Lyons Road, Coventry CV4 7EZ

Micropathology Ltd. University of Warwick Science Park, Venture Centre, Sir William Lyons Road, Coventry CV4 7EZ www.micropathology.com info@micropathology.com Micropathology Ltd Tel 24hrs: +44 (0) 24-76 323222 Fax / Ans: +44 (0) 24-76 - 323333 University of Warwick Science Park, Venture Centre, Sir William Lyons

More information

VACUNAS FELIPE GARCÍA HOSPITAL CLINIC. BARCELONA RESUMEN CROI 2016

VACUNAS FELIPE GARCÍA HOSPITAL CLINIC. BARCELONA RESUMEN CROI 2016 VACUNAS FELIPE GARCÍA HOSPITAL CLINIC. BARCELONA RESUMEN CROI 2016 bnabs Abstract 32LB and 311: infusión VRC01 uso terapéulco y STI Abstract 90: VRC01 uso prevenlvo Abstract 303: bnabs en PHI VACUNAS PREVENTIVAS

More information

X/01/$ DOI: /JVI Copyright 2001, American Society for Microbiology. All Rights Reserved.

X/01/$ DOI: /JVI Copyright 2001, American Society for Microbiology. All Rights Reserved. JOURNAL OF VIROLOGY, Apr. 2001, p. 3753 3765 Vol. 75, No. 8 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.8.3753 3765.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Route of Simian

More information

Pro5 MHC Pentamers. Dr. Jeremy Fry. Copyright ProImmune Limited All Rights Reserved

Pro5 MHC Pentamers. Dr. Jeremy Fry. Copyright ProImmune Limited All Rights Reserved Pro5 MHC Pentamers Dr. Jeremy Fry Pro5 MHC Pentamers The most consistent technology for detecting antigenspecific T cells The most-cited commercially available MHC Multimer Used by most-leading academic

More information

HERV-K specific T cells eliminate diverse HIV-1/2 and SIV primary isolates

HERV-K specific T cells eliminate diverse HIV-1/2 and SIV primary isolates Research article HERV-K specific T cells eliminate diverse HIV-1/2 and SIV primary isolates R. Brad Jones, 1 Keith E. Garrison, 2 Shariq Mujib, 1 Vesna Mihajlovic, 1 Nasra Aidarus, 1 Diana V. Hunter, 1

More information

Van Rompay et al. Retrovirology 2012, 9:57

Van Rompay et al. Retrovirology 2012, 9:57 Van Rompay et al. Retrovirology 2012, 9:57 RESEARCH Open Access Prolonged tenofovir treatment of macaques infected with K65R reverse transcriptase mutants of SIV results in the development of antiviral

More information

Integrative Healthcare Symposium 2010 Using Transfer Factor to Strengthen Cell-Mediated Immunity

Integrative Healthcare Symposium 2010 Using Transfer Factor to Strengthen Cell-Mediated Immunity Using Transfer Factor to Strengthen Cell-Mediated Immunity Presented by 1 Introduction 1949 NYU immunologist Dr. H. Sherwood Lawrence transferred immunity to tuberculosis (TB) Injected filtered leukocyte

More information

Chapter 13 Viruses, Viroids, and Prions. Biology 1009 Microbiology Johnson-Summer 2003

Chapter 13 Viruses, Viroids, and Prions. Biology 1009 Microbiology Johnson-Summer 2003 Chapter 13 Viruses, Viroids, and Prions Biology 1009 Microbiology Johnson-Summer 2003 Viruses Virology-study of viruses Characteristics: acellular obligate intracellular parasites no ribosomes or means

More information

Pathogens and the immune system

Pathogens and the immune system Pathogens and the immune system Veronica Leautaud, Ph.D. vl2@ rice.edu Keck Hall 224 / 232-lab Lecture 8 BIOE 301-Bioengineering and World Health Review of lecture 7 Science Science is the human activity

More information

Genetic and Immunologic Heterogeneity among Persons Who Control HIV Infection in the Absence of Therapy

Genetic and Immunologic Heterogeneity among Persons Who Control HIV Infection in the Absence of Therapy MAJOR ARTICLE Genetic and Immunologic Heterogeneity among Persons Who Control HIV Infection in the Absence of Therapy Florencia Pereyra, 1,2 Marylyn M. Addo, 1 Daniel E. Kaufmann, 1 Yang Liu, 5 Toshiyuki

More information

IL-12 and GM-CSF in DNA/MVA Immunizations against HIV-1 CRF12_BF Nef Induced T-Cell Responses With an Enhanced Magnitude, Breadth and Quality

IL-12 and GM-CSF in DNA/MVA Immunizations against HIV-1 CRF12_BF Nef Induced T-Cell Responses With an Enhanced Magnitude, Breadth and Quality IL-12 and GM-CSF in DNA/MVA Immunizations against HIV-1 CRF12_BF Nef Induced T-Cell Responses With an Enhanced Magnitude, Breadth and Quality Ana María Rodríguez, María Fernanda Pascutti., Cynthia Maeto.,

More information

Mutations in simian immunodeficiency virus protease cleavage sites 2 and12 impair in vitro virus production

Mutations in simian immunodeficiency virus protease cleavage sites 2 and12 impair in vitro virus production Boston University OpenBU Theses & Dissertations http://open.bu.edu Boston University Theses & Dissertations 2016 Mutations in simian immunodeficiency virus protease cleavage sites 2 and12 impair in vitro

More information

7/14/2014. Multiple immune effector mechanisms contribute to protection influenza. What is a correlate of protection?

7/14/2014. Multiple immune effector mechanisms contribute to protection influenza. What is a correlate of protection? What is a correlate of protection? Immunological Assessment of Influenza Vaccines and Correlates of Protection Jacqueline Katz Influenza Division Centers for Disease Control and Prevention Defined immune

More information

Structure of HIV. Virion contains a membrane envelope with a single viral protein= Env protein. Capsid made up of Gag protein

Structure of HIV. Virion contains a membrane envelope with a single viral protein= Env protein. Capsid made up of Gag protein Structure of HIV Virion contains a membrane envelope with a single viral protein= Env protein Important in receptor recognition Capsid made up of Gag protein (group-specific antigen) Icosahedral Interior

More information

Correlates of Protection in Dengue. Stephen J. Thomas, MD Division of Infectious Diseases State University of New York Upstate Medical University

Correlates of Protection in Dengue. Stephen J. Thomas, MD Division of Infectious Diseases State University of New York Upstate Medical University Correlates of Protection in Dengue Stephen J. Thomas, MD Division of Infectious Diseases State University of New York Upstate Medical University May 2017 Discussion of correlates requires clarity and proper

More information

Critical Role for Alpha/Beta and Gamma Interferons in Persistence of Lymphocytic Choriomeningitis Virus by Clonal Exhaustion of Cytotoxic T Cells

Critical Role for Alpha/Beta and Gamma Interferons in Persistence of Lymphocytic Choriomeningitis Virus by Clonal Exhaustion of Cytotoxic T Cells JOURNAL OF VIROLOGY, Sept. 2001, p. 8407 8423 Vol. 75, No. 18 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.18.8407 8423.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Critical

More information

The Adaptive Immune Responses

The Adaptive Immune Responses The Adaptive Immune Responses The two arms of the immune responses are; 1) the cell mediated, and 2) the humoral responses. In this chapter we will discuss the two responses in detail and we will start

More information

Early Induction and Maintenance of Env-Specific T-Helper Cells following Human Immunodeficiency Virus Type 1 Infection

Early Induction and Maintenance of Env-Specific T-Helper Cells following Human Immunodeficiency Virus Type 1 Infection JOURNAL OF VIROLOGY, Feb. 2003, p. 2663 2674 Vol. 77, No. 4 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.4.2663 2674.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Early Induction

More information

National Health & Medical Research Council (NHMRC) Results Fellowships and Australia/European Union Collaborative Grants Scheme 2018

National Health & Medical Research Council (NHMRC) Results Fellowships and Australia/European Union Collaborative Grants Scheme 2018 National Health & Medical Research Council (NHMRC) Results Fellowships and Australia/European Union Collaborative Grants Scheme 2018 The NHMRC has publically released results (embargo lifted on 11 October

More information

DATA SHEET. Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter calf thymus DNA.

DATA SHEET. Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter calf thymus DNA. Viral Load DNA >> Standard PCR standard 0 Copies Catalog Number: 1122 Lot Number: 150298 Release Category: A Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter

More information

HIV-1 DNA levels after antiretroviral therapy in primary infection predict disease progression: the SPARTAC Trial

HIV-1 DNA levels after antiretroviral therapy in primary infection predict disease progression: the SPARTAC Trial HIV-1 DNA levels after antiretroviral therapy in primary infection predict disease progression: the SPARTAC Trial James Williams 1,2,3, Jacob Hurst 1,2,3, Nicola Robinson 1,2,3, Sarah Fidler 4, Jonathan

More information

Chapter 1. Chapter 1 Concepts. MCMP422 Immunology and Biologics Immunology is important personally and professionally!

Chapter 1. Chapter 1 Concepts. MCMP422 Immunology and Biologics Immunology is important personally and professionally! MCMP422 Immunology and Biologics Immunology is important personally and professionally! Learn the language - use the glossary and index RNR - Reading, Note taking, Reviewing All materials in Chapters 1-3

More information

HIV Prophylactic Vaccine Development Program

HIV Prophylactic Vaccine Development Program HIV Prophylactic Vaccine Development Program Maria Grazia Pau Senior Director, Compound Development Team Leader, Janssen AVAC Webinar, 28 April 2017 HIV vaccine R&D programs: Current Collaborators (in

More information

Pharmacology Considerations for HIV Prevention

Pharmacology Considerations for HIV Prevention Pharmacology Considerations for HIV Prevention Peter L. Anderson University of Colorado Anschutz Medical Campus Skaggs School of Pharmacy and Pharmaceutical Sciences Perspectives for next generation studies

More information

WVU Occupational Medicine Program for evaluation and treatment of persons exposed to Lentivirus Vectors

WVU Occupational Medicine Program for evaluation and treatment of persons exposed to Lentivirus Vectors Hazard Description: Lentivirus vector systems are derived from HIV and similar viruses because of being very effective at inserting genetic material into the genome of target cells. While most researchers

More information

Richard S. Kornbluth, M.D., Ph.D.

Richard S. Kornbluth, M.D., Ph.D. Treatment of established tumors with peritumoral injections of CD40 ligand (CD40L), CpG, poly(i:c), and extracellular ATP in murine models Richard S. Kornbluth, M.D., Ph.D. Disclosure: Richard Kornbluth

More information

Vif Proteins of Human and Simian Immunodeficiency Viruses Require Cellular CBFβ to Degrade APOBEC3 Restriction Factors

Vif Proteins of Human and Simian Immunodeficiency Viruses Require Cellular CBFβ to Degrade APOBEC3 Restriction Factors JVI Accepts, published online ahead of print on 28 December 2011 J. Virol. doi:10.1128/jvi.06950-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13

More information

Rapid Seeding of the Viral Reservoir Prior to SIV Viremia in Rhesus Monkeys

Rapid Seeding of the Viral Reservoir Prior to SIV Viremia in Rhesus Monkeys Rapid Seeding of the Viral Reservoir Prior to SIV Viremia in Rhesus Monkeys The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters.

More information

PREventing EMerging Pathogenic Threats (PREEMPT) Proposers Day

PREventing EMerging Pathogenic Threats (PREEMPT) Proposers Day PREventing EMerging Pathogenic Threats (PREEMPT) Proposers Day Dr. Jim Gimlett, Program Manager DARPA Biological Technologies Office (BTO) January 30, 2018 Arlington, VA PREEMPT Agenda Proposers Day Objectives

More information

Broadly Neutralizing Antibodies for HIV Eradication

Broadly Neutralizing Antibodies for HIV Eradication DOI 10.1007/s11904-016-0299-7 HIV PATHOGENESIS AND TREATMENT (AL LANDAY, SECTION EDITOR) Broadly Neutralizing Antibodies for HIV Eradication Kathryn E. Stephenson 1,2 & Dan H. Barouch 1,2 # The Author(s)

More information

Multi-step inhibition explains HIV-1 protease inhibitor pharmacodynamics and resistance

Multi-step inhibition explains HIV-1 protease inhibitor pharmacodynamics and resistance Research article Related article, page 3704 Multi-step inhibition explains HIV-1 protease inhibitor pharmacodynamics and resistance S. Alireza Rabi, 1 Gregory M. Laird, 1 Christine M. Durand, 1 Sarah Laskey,

More information

A Schematic Of The Life Cycle Of The

A Schematic Of The Life Cycle Of The A Schematic Of The Life Cycle Of The Lymphocytes Involved A wonderful and informative website to visit is from Johns Hopkins Medical Center Called "The Body". The ability of these viruses to infect lymphocytes

More information

HIV INFECTION: An Overview

HIV INFECTION: An Overview HIV INFECTION: An Overview UNIVERSITY OF PAPUA NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL MBBS II SEMINAR VJ

More information

Immunization with HIV-1 gp41 Subunit Virosomes Induces Mucosal Antibodies Protecting Nonhuman Primates against Vaginal SHIV Challenges

Immunization with HIV-1 gp41 Subunit Virosomes Induces Mucosal Antibodies Protecting Nonhuman Primates against Vaginal SHIV Challenges Article Immunization with HIV-1 gp41 Subunit Virosomes Induces Mucosal Antibodies Protecting Nonhuman Primates against Vaginal SHIV Challenges Morgane Bomsel, 1,2,3, * Daniela Tudor, 1,2,3 Anne-Sophie

More information

Removal of N-Linked Glycosylation Sites in the V1 Region of Simian Immunodeficiency Virus gp120 Results in Redirection of B-Cell Responses to V3

Removal of N-Linked Glycosylation Sites in the V1 Region of Simian Immunodeficiency Virus gp120 Results in Redirection of B-Cell Responses to V3 JOURNAL OF VIROLOGY, Feb. 2004, p. 1525 1539 Vol. 78, No. 3 0022-538X/04/$08.00 0 DOI: 10.1128/JVI.78.3.1525 1539.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Removal of

More information

Massive infection and loss of memory CD4 + T cells in multiple tissues during acute SIV infection

Massive infection and loss of memory CD4 + T cells in multiple tissues during acute SIV infection Massive infection and loss of memory CD4 + T cells in multiple tissues during acute SIV infection Joseph J. Mattapallil 1, Daniel C. Douek 2, Brenna Hill 2, Yoshiaki Nishimura 3, Malcolm Martin 3 & Mario

More information

The Alphabet Soup of Viral Hepatitis Testing

The Alphabet Soup of Viral Hepatitis Testing The Alphabet Soup of Viral Hepatitis Testing August 18, 2011 Patricia Slev, PhD, DABCC Medical Director, Serologic Hepatitis and Retrovirus Laboratory, ARUP Laboratories Assistant Professor of Pathology,

More information

Variation of Human Immunodeficiency Virus Type-1 Reverse Transcriptase within the Simian Immunodeficiency Virus Genome of RT-SHIV

Variation of Human Immunodeficiency Virus Type-1 Reverse Transcriptase within the Simian Immunodeficiency Virus Genome of RT-SHIV Variation of Human Immunodeficiency Virus Type-1 Reverse Transcriptase within the Simian Immunodeficiency Virus Genome of RT-SHIV Debra A. Wadford, University of California Davis Robert C. Kauffman, University

More information

5/11/2017. HIV Cure Research Questions and a Few Answers

5/11/2017. HIV Cure Research Questions and a Few Answers HIV Cure Research Questions and a Few Answers Steven G. Deeks, MD Professor of Medicine University of California San Francisco San Francisco, California FORMATTED: 04/13/17 Financial Relationships With

More information

Combined IL-21 and IFNα treatment limits inflammation and delay viral rebound in ART-treated, SIV-infected macaques

Combined IL-21 and IFNα treatment limits inflammation and delay viral rebound in ART-treated, SIV-infected macaques Combined and IFNα treatment limits inflammation and delay viral rebound in ART-treated, SIV-infected macaques Mirko Paiardini Associate Professor, Emory University School of Medicine Yerkes National Primate

More information

ABSTRACT. HIV-induced immunodeficiency may be mediated by the activation of

ABSTRACT. HIV-induced immunodeficiency may be mediated by the activation of ABSTRACT MEXAS, ANGELA MARIE. CD4 + CD25 + Regulatory T Cells Are Infected and Activated Phenotypically and Functionally During Acute Infection with Feline Immunodeficiency Virus. (Under the direction

More information

Mechanisms of CD8+ T Cell Mediated Virus Inhibition in HIV-1 Virus Controllers. Tamika L. Payne

Mechanisms of CD8+ T Cell Mediated Virus Inhibition in HIV-1 Virus Controllers. Tamika L. Payne Mechanisms of CD8+ T Cell Mediated Virus Inhibition in HIV-1 Virus Controllers by Tamika L. Payne Department of Molecular Genetics and Microbiology Duke University Date: Approved: Georgia D. Tomaras, Supervisor

More information

La risposta immune all infezione da virus ebola. Chiara Agrati, PhD

La risposta immune all infezione da virus ebola. Chiara Agrati, PhD La risposta immune all infezione da virus ebola Chiara Agrati, PhD Pathogenetic mechanisms This virus infection is able to: - disable the immune system, preventing an effective protective immune response

More information

A Query by HIV. I. A query by HIV. II. Recursion

A Query by HIV. I. A query by HIV. II. Recursion A Query by HIV I. A query by HIV Human immunodeficiency virus (HIV) is a kind of lentivirus (lenti- means "slow") that belongs to the Retroviridae family. HIV is known for slow disease progression. In

More information

Grade Level: Grades 9-12 Estimated Time Allotment Part 1: One 50- minute class period Part 2: One 50- minute class period

Grade Level: Grades 9-12 Estimated Time Allotment Part 1: One 50- minute class period Part 2: One 50- minute class period The History of Vaccines Lesson Plan: Viruses and Evolution Overview and Purpose: The purpose of this lesson is to prepare students for exploring the biological basis of vaccines. Students will explore

More information

Use of Viral Load Testing in Managing CMV Infections in SOTR

Use of Viral Load Testing in Managing CMV Infections in SOTR Use of Viral Load Testing in Managing CMV Infections in SOTR Angela M. Caliendo, MD, PhD, FIDSA Professor and Vice Chair, Medicine Alpert Medical School of Brown University Providence, RI Disclosures Scientific

More information

Irina Maljkovic Berry

Irina Maljkovic Berry Thesis for doctoral degree (Ph.D.) 2008 Thesis for doctoral degree (Ph.D.) 2008 Genetic aspects of HIV-1 evolution and transmission Irina Maljkovic Berry Genetic aspects of HIV-1 evolution and transmission

More information

HIV / AIDS Pathogenesis 2

HIV / AIDS Pathogenesis 2 HIV / AIDS Pathogenesis 2 Henning Drechsler, MD VA North Texas Health Care System UT Southwestern Medical Center Objectives Characterize HIV-1 (classification, structure and life cycle) Describe the clinical

More information

Didactic Series. Archive Genotype Resistance Testing in the Setting of Regimen Switching

Didactic Series. Archive Genotype Resistance Testing in the Setting of Regimen Switching Didactic Series Archive Genotype Resistance Testing in the Setting of Regimen Switching Craig Ballard, Pharm.D., AAHIVP UCSD Medical Center Owen Clinic June 11, 2015 ACCREDITATION STATEMENT: University

More information

Interleukin-21 combined with ART reduces inflammation and viral reservoir in SIV-infected macaques

Interleukin-21 combined with ART reduces inflammation and viral reservoir in SIV-infected macaques Interleukin-21 combined with ART reduces inflammation and viral reservoir in SIV-infected macaques Luca Micci, Emory University Emily S. Ryan, Emory University Rémi Fromentin, Université de Montréal Steven

More information

Immune surveillance hypothesis (Macfarlane Burnet, 1950s)

Immune surveillance hypothesis (Macfarlane Burnet, 1950s) TUMOR-IMMUNITÄT A.K. Abbas, A.H. Lichtman, S. Pillai (6th edition, 2007) Cellular and Molecular Immunology Saunders Elsevier Chapter 17, immunity to tumors Immune surveillance hypothesis (Macfarlane Burnet,

More information

Viral CTL Escape Mutants Are Generated in Lymph Nodes and Subsequently Become Fixed in Plasma and Rectal Mucosa during Acute SIV Infection of Macaques

Viral CTL Escape Mutants Are Generated in Lymph Nodes and Subsequently Become Fixed in Plasma and Rectal Mucosa during Acute SIV Infection of Macaques Viral CTL Escape Mutants Are Generated in Lymph Nodes and Subsequently Become Fixed in Plasma and Rectal Mucosa during Acute SIV Infection of Macaques Thomas Howerton Vanderford, Emory University Chelsea

More information

Design and tests of an HIV vaccine

Design and tests of an HIV vaccine Design and tests of an HIV vaccine Andrew McMichael, Matilu Mwau and Tomas Hanke MRC Human Immunology Unit, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, UK Correspondence

More information

CANCER IMMUNOPATHOLOGY. Eryati Darwin Faculty of Medicine Andalas University

CANCER IMMUNOPATHOLOGY. Eryati Darwin Faculty of Medicine Andalas University CANCER IMMUNOPATHOLOGY Eryati Darwin Faculty of Medicine Andalas University Padang 18 Mei 2013 INTRODUCTION Tumor: cells that continue to replicate, fail to differentiate into specialized cells, and become

More information

Are booster immunisations needed for lifelong hepatitis B immunity?

Are booster immunisations needed for lifelong hepatitis B immunity? Are booster immunisations needed for lifelong hepatitis B immunity? European Consensus Group on Hepatitis B immunity, following meeting in Florence in October 1998 To date there are no data to support

More information

The Discovery of SIV and Development of Monkey Models for the Study of HIV/AIDS. Ronald C Desrosiers University of Miami Miller School of Medicine

The Discovery of SIV and Development of Monkey Models for the Study of HIV/AIDS. Ronald C Desrosiers University of Miami Miller School of Medicine The Discovery of SIV and Development of Monkey Models for the Study of HIV/AIDS Ronald C Desrosiers University of Miami Miller School of Medicine 10 FEBRUARY 1984 Infectious Diseases Branch, National

More information

Human T Cell Lymphotropic Virus (HTLV) Type 1 Specific CD8 + T Cells: Frequency and Immunodominance Hierarchy

Human T Cell Lymphotropic Virus (HTLV) Type 1 Specific CD8 + T Cells: Frequency and Immunodominance Hierarchy MAJOR ARTICLE Human T Cell Lymphotropic Virus (HTLV) Type 1 Specific CD8 + T Cells: Frequency and Immunodominance Hierarchy Peter K. C. Goon, 1,a Alix Biancardi, 1,a Noam Fast, 1 Tadahiko Igakura, 1,b

More information

Development of safe and immunogenic reassortant viruses with 5:3 genotype for live attenuated influenza vaccine

Development of safe and immunogenic reassortant viruses with 5:3 genotype for live attenuated influenza vaccine Development of safe and immunogenic reassortant viruses with 5:3 genotype for live attenuated influenza vaccine Irina Isakova-Sivak, PhD Institute of Experimental Medicine, Saint Petersburg, Russia The

More information