Selectively Deleted In Vivo in the Absence of an Intact nef Gene

Transcription

1 JOURNAL OF VIROLOGY, Mar. 1994, p X/94/$ Copyright 1994, American Society for Microbiology Vol. 68, No. 3 Upstream U3 Sequences in Simian Immunodeficiency Virus Are Selectively Deleted In Vivo in the Absence of an Intact nef Gene FRANK KIRCHHOFF, HARRY W. KESTLER III,J AND RONALD C. DESROSIERS- New England Regional Primate Research Center, Harvard Medical School, Soluthborough, Massachusetts Received 12 October 1993/Accepted 9 December 1993 Major transcriptional control elements are located within the U3 region of the long terminal repeats (LTRs) of lentivirus and other retroviral genomes. The nef auxiliary gene of simian immunodeficiency virus (SIV) and human immunodeficiency virus overlaps about 70% of the 450- to 560-bp-long U3 region present in these primate lentiviruses. We analyzed viral DNA sequences present in rhesus monkeys infected with a mutant of SIVmac containing a 182-bp deletion in the region of nef that does not overlap the LTR. Between 50 and 100% of the viral DNA molecules in eight of nine monkeys infected for 16 or more months contained additional deletions of 111 to 302 bp within the 517-bp U3 region. These deletions were contained within a 334-bp region of U3 that is overlapped by the nef reading frame, and they did not affect the polypurine tract, the NF-KB binding site, or other sequence elements in this same region that are important for transcription and replication. Such deletions were not detected in any of 41 PCR amplifications from 8 rhesus monkeys infected with wild-type SIV for 8 to 26 months, nor were they detected in 10 animals infected with vpr, vpx or vpr-vpx deletion mutants. These results indicate that, in the absence of an intact nef gene, these upstream U3 sequences are not advantageous for the virus. The proviral DNA genomes of retroviruses have repetitive sequences at their ends called long terminal repeats (LTRs) (35). A region of the LTRs called U3 contains the major transcriptional regulatory elements. In the case of the primate lentiviruses (simian immunodeficiency virus [SIV] and human immunodeficiency virus [HIV]), these include the TATA box and binding sites for the transcription factors NF-KB and Spl (8-10, 15, 17, 27). The U3 regions of the primate lentiviruses are unusually long, ranging from about 450 to 560 bp in length (26). More primitive lentiviruses such as visna virus, caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and feline immunodeficiency virus (FIV) have U3 regions that are considerably shorter (207 to 287 bp) (26). Since the 330 to 400 bp upstream of the major transcriptional control elements (TATA, NF-KB, Spl) in primate lentiviruses are still part of U3, it has been tacitly assumed that they are involved in subtle regulation of viral expression (4, 5, 9, 11, 12, 18, 19, 21, 23-25, 29, 33, 36). However, these upstream U3 sequences are entirely overlapped by the open reading frame for the auxiliary gene nef, which is present in primate lentiviruses but absent in the more primitive lentiviruses. nef has little or no effect on virus replication in standard cell culture systems (7, 14, 20, 22, 28, 34), but it is dramatically important for efficient SIV replication in rhesus monkeys, for maintenance of high virus burdens, and for disease progression (20). We now report that maintenance of the upstream U3 sequences in the SIV genome is dependent upon the presence of an intact, functional nef gene. * Corresponding author. Mailing address: New England Regional Primate Research Center, Harvard Medical School, One Pine Hill Dr., Box 9102, Southborough, MA Phone: (508) Fax: (508) t Present address: NC-2-146, Research Institute, Cleveland Clinic Foundation, 9500 Euclid Ave., Cleveland, OH Six rhesus monkeys (Macaca mulatta) were previously infected with SIVmac239/nef-deletion (20). This virus has a 182-bp deletion from bp 9251 to 9432 in the viral genome in the nef-unique region between env and the right LTR (20). A seventh rhesus monkey (Mm223-90) was infected by whole blood transfusion from Mm128-89, one of the original animals infected with SIVmac239/nef-deletion. Two additional rhesus monkeys (Mm and Mm269-89) were infected with SIV mac239 envelope variants containing the same deletion in nef (1-3). We also used 8 rhesus monkeys infected with SIV mac239/nef-open (wild type) (Table 1) and 10 animals infected with SIVmac239 containing deletions in the vpx and/or 'pr genes (13). PCR amplification of nef-ltr sequences was performed essentially as described previously (6). First, 2.5 p.g of total genomic DNA from peripheral blood mononuclear cells (PBMC) was subjected to 10 cycles of amplification with 5 pmol of primers 9056 to 9086 (5'-CCTACCTACAATATG GGTGGAGC-3') and to 9983 (5'-TCTGCCAGCC TCTCCGCAGAGCG-3'). Thereafter, 35 additional cycles were performed with 50 pmol of each primer. For the nested reaction, 5 Ill of the 100 [ul from the first reaction was used for 35 rounds of amplification with 50 pmol of primers 9110 to 9135 (5 '-CCGTCTGGAGATCTGCGACAGAGACT-3') and 9983 to 9962 (5'-GACTGAATACAGAGCGAAATGC-3'), yielding an 874-bp fragment (bp to 9983, in reference 32) from nef-open DNA and a 692-bp fragment from nef-deletion DNA. Control experiments indicated that the PCR conditions used could detect 1 to 2 DNA molecules of the SIVmac239/ nef-deletion or nef-open clones diluted in 2.5 jig of genomic DNA from PBMC of uninfected macaques (data not shown). Viral DNA was amplified in 71 of 90 PCR from PBMC DNA prepared at various times from the nine rhesus monkeys that were infected with nef-deleted SIV (Table 1). Approximately 50% of the amplified viral DNA products from these animals

2 2032 NOTES J. VIROL. TABLE 1. Nef-LTR sequences detected in M. mulatta monkeys infected with SIVmac239/nef-open or nef-deletion No. of PCRs that yielded": Rhesus Mo No. of PCRs Estimated % with monkey Infection" postinfection" performed' Nef open Nef open + A-nef Larger A-nef + additional Ae only additional A only A only larger A Mm71-88 A-nef Mm A-nef Mm A-nef Mm A-nef Mm A-nef (9/1) (1/3) 56 Mm A-nef (1/1) 50 Mm A-nef (1/1) 57 Mm A-nef (1/8) 90 Mm A-nef Mm nef-open Mm nef-open Mm nef-open Mm nef-open Mm nef-open Mm nef-open MmI57-90 nef-open Mm nef-open Various Uninfected a SlVmac239/nef-open and a mutant with a constructed 182-bp deletion (A) in the nef gene (A-nef) (20) were used for infections. Mm and Mm received the 1-12 and 8-22 env variants of SIVmac239/nef-deletion, and Mm received the 8-22 variant of SIVmac239/nef-open (1-3). h Animals were infected as described previously (1-3, 20), except animal Mm223-90, which was infected by blood transfusion from animal Mml Mm71-88, Mm255-88, Mm353-88, and Mm resisted challenge by wild-type virus 27 months after infection (6). The PCR analysis was performed as described in the text and in reference 6. "For PCRs which produced multiple amplification products, the ratio was visually estimated. The estimated ratio of A-nef to larger deletions is shown in parentheses. The percentage was calculated by dividing the number of PCRs which yielded larger deletions by the total number of positive PCRs and multiplying by 100; fractional values were used for those reactions which yielded a mixture of products. No values are given if fewer than three PCRs were positive. were smaller than the 692 bp expected from the original nef deletion used for infection (Fig. 1A and IB; Table 1). Sequence analysis of a number of clones derived from these amplifications revealed a variety of additional deletions within the region of U3 that overlaps the nef reading frame (Fig. 2 and 3). From PBMC of one of the rhesus monkeys (Mm7l-88), we detected only a fragment corresponding to the original nef deletion (Fig. 1A and Table 1). However, in the other eight animals, various amounts of the additionally deleted forms were detected (Fig. IA and B and Table 1). After 8 months of infection of Mm223-90, the original nef-deletion form vastly predominated, but by 16 months additionally deleted forms came to predominate (Fig. 1B; Table 1). After 19 weeks of infection of Mm255-88, a form containing a 151-bp deletion was detected (data not shown); after 30 months of infection, forms containing this 151-bp deletion and a second deletion of 111 bp predominated (Fig. IA and Table 1). In animals which were infected for 17 or fewer months, only about 15% of the amplified viral DNA contained additional deletions. In contrast, 50 to 100% of the viral DNA molecules in 8 of 9 monkeys infected for 16 or more months contained additional deletions of bp (Table 1). Numerous amplifications of small amounts of cloned nef-deletion DNA never produced the smaller fragments with these additional deletions in U3 (data not shown). These and other results described below indicate that these additional deletions are not an artifact of PCR. These data suggest that variants with additional deletions in U3 take considerable time to develop and that they accumulate slowly with time. A total of 41 PCRs was performed with PBMC DNA prepared from the eight rhesus monkeys infected with wildtype SIV (Table 1). All 41 reactions yielded viral DNA, and in all cases the only fragment detected was the expected 874-bp fragment (Fig. 1C and Table 1). Fragments smaller than the expected 874 bp were also not detected in any of 30 PCRs from 10 animals infected for 16 months with SIVmac239 containing deletions in vpr, vpx, or vpr and vpx (Fig. 1D). We also amplified a 786-bp fragment spanning the vpr and vpx genes in the nine animals infected with the nef-deletion SIV and four animals infected with nef-open virus. For the amplification, primers 5722 to 5743 (5'-GAGAACAACT GCTGTCTTGCTG-3') and 6586 to 6565 (5'-AGAAGATG TATTAGCCTTAGCC-3') were used for "booster" and primers 5755 to 5776 (5'-GAGCTCATAAGTACCAGGTACC-3') and 6540 to 6520 (5'-CGTGATTGCTCATAACATATC-3') were used for nested reaction as described above. The amplification efficiency with the vpx-vpr primer set was comparable to the efficiency obtained with the nef primer set (data not shown). Smaller than expected vpr-vpx-containing fragments were not detected (Fig. 1E). Thus, additional deletion of sequences appears to be specific for the upstream U3 region in animals infected with nef-deletion virus.

3 VOL. 68, 1994 NOTES 2033 A Mm Mm u Mm Mm u Mm Mm Mm 26"9 Mm 267.Q u I Alol - nef-open (874 bp) A-nsf (692 bp) B Mm a mo.pi. 16mo.pi. C Mm u Mm u IUm u Mm I u Mm u Mm A-nsf (692 bp) - * =*= - nesf-open (874 bp) D Avpx + Avpr Avpx Avpr "-90 u - nef-open (874 bp) E u vpx-vpr (786 bp) FIG. 1. Analysis of nef-ltr sequences in PBMC of rhesus monkeys. DNA was prepared from PBMC of each animal and analyzed by PCR as described in the text. PCR products (25 of 100 p.l) were separated by electrophoresis through 1.5% agarose gels. nef-ltr sequences were detected in DNA from animals infected with nef-deletion virus at 25 (Mm7l-88, Mm353-88, Mm397-88, Mmll8-87), 27 (Mm269-89), 29 (Mm267-89), or 38 (Mm255-88, Mm ) months postinfection (panel A) (the results of six PCRs performed on aliquots of the same genomic DNA preparation are shown for each animal); DNA from animal Mm at 8 and 16 months postinfection with nef-deletion virus (panel B); DNA from animals infected with SIV nef-open virus at 8 to 26 months postinfection (panel C); and DNA from animals infected with SIV with deletions in vpx, vpr, or vpx-vpr at 16 months postinfection (panel D). (E) Amplification of vpx-vpr sequences from animals infected with nef-deletion (left) or nef-open (right) virus. The sizes of the expected fragments in base pairs (bp) are indicated in the right margin. U refers to control DNA prepared from uninfected rhesus monkeys. A variant with an additional deletion of 262 bp in the U3 region was the only form of virus that was reisolated from animal (6). Virus stocks were prepared from CEMx 174 cells infected with this variant and with SIVmac239/nef open and used to infect CEM x 174 cells, rhesus PBMC, and rhesus alveolar macrophages. Infections were normalized by use of equivalent amounts of p27 antigen. Culture medium was changed two or three times weekly, and aliquots of supernatant were used to assay p27 antigen levels with a commercial antigen capture kit (Coulter Co., Hialeah, Fla.). Reisolates from animal Mm and cloned SIVs with deletions in this region of U3 replicated indistinguishably from SIVmac239/nef-open in all three cell types (Fig. 4 and data not shown). The U3 deletions identified in this study did not affect sequence elements in this region that one would expect to be important for viral transcription and replication, specifically the polypurine tract, the NF-KB and Spl binding sites, the TATAA box, and sequences at the extreme 5' end of U3 (Fig. 2 and 3). Deletion of one of the three to four Spl binding sites was observed in some of the clones from one animal, a sequence variation that has been observed previously in SIVmac251 and HIV-2/D194 (26). Two of the deletions in U3 were observed independently in different animals (Fig. 2 and 3). The independent appearance of the same deletion in different animals may be explained by the presence of short direct repeats near the ends of the deletions. The most frequently observed deletion, detected in five different animals (Fig. 2 and 3), contains a short direct repeat of GAGGA at bp 9644 to 9648 and 9797 to 9801 near the limits of the 9650 to 9800 deletion (Fig. 2). Similarly, a short direct repeat of ATTT at bp 9470 to 9473 and 9586 to 9589, which is part of a larger imperfect repeat of AAG(G/A)(G/C)ATYF at bp 9465 to 9573 and 9581 to 9589, is present near the limits of the 9476 to 9586 deletion (Fig. 2). We detected short direct repeats of 5 to 9 bp near the limits of seven of the nine different deletions observed. Such direct repeats have been previously implicated in the appearance of deletions in retroviruses by a mechanism involving misalignment of template in the reverse transcriptase reaction (30, 31). One deleted region (9477 to 9777 in ) was replaced by a short unrelated sequence (Fig. 3) (30, 31). The original 182-bp deletion in nef used for these studies results in very inefficient SIV replication in rhesus monkeys and the lack of disease progression (6, 20). Rhesus monkeys infected with this attenuated variant remain persistently infected by a variety of criteria but the virus loads are extremely low (6, 20). Rhesus monkeys infected with the nef-deleted,

4 2034 NOTES J. VIROL. SIkao239 SIU^aa239 SIUV^a239 BIUkaa239 SIVkac239 SIXVao U * * polypurine tract -> * TGAGGGACAG//GTCTCATTTTATAAAAGAAGAAGQ GGCAGGAA ATTTATTACAGTGCAAGAAGACATAGAATCT TAGACATATACTTAGAAAAGGAAGAAGGCATCATACCAGATTGGCAGGATTACACCTCAGGACCAGGAATTAGATACCCA AAGACATTTGGCTGGCTATGGAAATTAGTCCCTGTAAATGTATCAGATGAGGCACAGGAGGATGAGAGCATTATTTAAT GCATCCAGCTCAAACTTCCCAGTGGGATGACCCTTGGGGAGAGGTTCTAGCATGGAAGTTTGATCCAACTCTGGCCTACA CTTATGAGGCATATGTTAGATACCCAGAAGAGTTTGGAAGCAAGTCAGGCCTGTCAGAGGAAGAGGTTAGAAGAAGGCTA * * * -nf-end -> * * Spil * ACCGCAAGAGGCCTTCTTAACATGGCTGACAAGAAGGAAACTCGCTGAAACAGC AG C CCAAGTGTTAC SIXVao BPI * Sp1* * * * * *U3 nd <- GGG&GG!aoCTGGG CG GGTCGGGAACGCCCAcTTTCTTGATGTA!AAATATcAcTGCATTTCGCTCTGTATTC --_- -_-_-_-_-_-_-_-_-_-_ FIG. 2. Deletions in U3 observed independently in different animals. The frequencies of the 9476 to 9586 and 9650 to 9800 deletions are shown in Fig. 3. Short direct repeats near the limits of the deletions are underlined. The polypurine tract, the NF-KB and Spl binding sites, the end of the nef gene, the TATAA box, and the start and end of U3 are indicated in boldface letters. / indicates the position of the constructed 182-bp deletion; dashes indicate sequence identity. attenuated derivative resist even high-dose challenge by wildtype pathogenic SIV (6). We have shown here that rhesus monkeys persistently infected with this nef-deletion mutant specifically accumulate additional deletions in the region of nef that overlaps U3. Continued low-level viral replication must be occurring in vivo for these additional deletions to accumulate. The preponderance of additionally deleted variants at late time points from most animals suggests that there is some selective advantage to the additional deletions. The selective advantage could be as simple as that resulting from a shorter genome. What do these results mean for understanding the functional role of the 330 to 400 bp of upstream sequences in U3 of primate lentiviruses? The findings strongly indicate some form of linkage between the sequences deleted in nef and these U3 sequences. One simple, straightforward explanation for the nature of this linkage is that the primary function of these upstream U3 sequences may be simply to serve as Nef coding sequence. Analysis of the lengths of lentivirus U3 regions is consistent with this possibility. The lengths of lentivirus U3 regions are directly related to the lengths of open reading frames (ORFs) that overlap them (Table 2). The U3 regions of CAEV, FIV, EIAV, and visna virus, which are overlapped by only up to 56 bp of the env ORFs, are much shorter (207 to 287 bp) than the U3 regions of the primate lentiviruses (450 to 560 bp), which are overlapped by 332 to 407 bp of the nef ORF (Table 2). The bovine immunodeficiency virus (BIV) U3, which is overlapped by 142 bp of the env ORF, shows intermediate length (384 bp), and the EIAV U3, which has no ORF overlapping the LTR, also has the shortest U3 region (207 bp) of all the lentiviruses. The lengths of the U3 regions in non-lenti-retroviruses also correlate with the presence of ORFs within the LTR. Mouse mammary tumor virus, human T-cell leukemia virus, bovine leukemia virus, and foamy viruses which have such overlapping reading frames have longer U3 TABLE 2. Virusa Lengths of lentivirus U3, R, and U5 regions and overlapping ORFs Length (bp) ORFs overlapping LTR U3 R U5 the LTRb SIVmac nef, 407 bp HIV nef, 332 bp HIV nef, 386 bp SIVagm nef, 344 bp SIVmnd nef, 350 bp SIVsyk nef, 365 bp BIV env, 142 bp CAEV env, 28 bp FIV orf4, 51 bp EIAV None Visna env, 56 bp a Sequences were obtained from the Los Alamos HIV data base (26), except the SIVsyk sequence (16). The lengths are representative examples for each lentivirus. b The numbers are for the gene which extends farthest into the U3 region.

5 VOL. 68, 1994 NOTES 2035 envk Sp-1 NFkB > 1 K TATAA U3 R U5 nef No: bp deleted: L Polypurlne tract A B , MU C D E l Remarks: original deletion in SlVmac239 A-nef major form (>90%) observed in animal ; only form which could be reisolated in animals (3/12), (4/7), (1/7), (3/12) and (5/12) in animal (1/7) in animal (1/12) F , G , H , I ~I major form (about 90%) observed in animal minor form (about 33%) detected in animal major form (about 66%) detected in animal additional deletions constructed deletion in U3 after infection in SlVmac239 A-nef of macaques with SlVmac239 A-nef FIG. 3. Schematic representation of the location of U3 deletions in rhesus macaques infected with SIVmac239/nef-deletion. Nucleotide numbers refer to the SIVmac239 sequence (32). Numbers in parentheses refer to the number of reactions positive for the deletions shown, compared to the total number of PCRs performed. Arrows at the top indicate the positions of primers used for PCR amplification. In animal , the deleted sequences were replaced by a short unrelated sequence, CTCAGACAT.

6 /PBMC 239 d3/pbmc 239/CEM-x d3/cem-x NOTES C days post-infection with 10 ng p27 antigen FIG. 4. Cloned SIVmac239/nef-open and an uncloned variant (d3) reisolated from animal Mm containing deletions of bases 9251 to 9432, 9476 to 9586, and 9650 to 9800 (6) replicate with comparable efficiencies in CEM x 174 cells, rhesus PBMC, and rhesus alveolar macrophages (MP). Cells were infected with virus containing 10 ng of p27 antigen. regions than retroviruses that do not. Other possibilities also exist, however, for the nature of the linkage. For example, it is possible that this region of U3 is the direct or indirect target of nef action or that the deletions within U3 compensate for some unknown defect caused by the 182-bp deletion. We thank M. D. Daniel, Sue Czajak, and Dean Regier for help and advice and J. Newton and T. McDonnell for manuscript preparation. This work was supported by Public Health Service grants AI25328 and RR00168 and by a fellowship from the Deutsches Krebsforschungszentrum (F.K.). REFERENCES 1. Burns, D. P. W., and R. C. Desrosiers Selection of genetic variants of simian immunodeficiency virus in persistently infected rhesus monkeys. J. Virol. 65: Burns, D. P. W., and R. C. Desrosiers A caution on the use of SIV/HIV gag antigen detection systems in neutralization assays. AIDS Res. Hum. Retroviruses 8: Burns, D. P. W., C. Collignon, and R. C. Desrosiers Simian immunodeficiency virus mutants resistant to serum neutralization arise during persistent infection of rhesus monkeys. J. Virol. 67: Calvert, I., Z. Q. Peng, and H. F. Kung Cloning and characterization of a novel sequence-specific DNA-binding protein recognizing the negative regulatory element (NRE) region of the HIV-1 long terminal repeat. Gene 101: Cooney, A. J., S. Y. Tsai, B. W. O'Malley, and M.-J. Tsai Chicken ovalbumin upstream promoter transcription factor binds to a negative regulatory region in the human immunodeficiency virus type I long terminal repeat. J. Virol. 65: Daniel, M. D., F. Kirchhoff, S. C. Czajak, P. K. Sehgal, and R. C. Desrosiers Protective effects of a live-attenuated SIV vaccine with a deletion in the nef gene. Science 258: DeRonde, A., B. Klaver, W. Keulen, L. Smit, and J. Goudsmit Natural HIV-1 nef accelerates virus replication in primary J. VIROL. human lymphocytes. Virology 188: Garcia, J. A., D. Harrich, E. Soultanakis, F. K. Wu, R. Mitsuyasu, and R. B. Gaynor Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation. EMBO J. 8: Gaynor, R Cellular transcription factors involved in the regulation of HIV-1 gene expression. AIDS 6: Gaynor, R. B., M. D. Kuwabara, F. K. Wu, J. A. Garcia, D. Harrich, M. Briskin, R. Wall, and D. S. Sigman Repeated B motifs in the human immunodeficiency virus type I long terminal repeat enhancer region do not exhibit cooperative factor binding. Proc. Natl. Acad. Sci. USA 85: Ghosh, D Glucocorticoid receptor-binding site in the human immunodeficiency virus long terminal repeat. J. Virol. 66: Giacca, M., M. I. Gutierrez, S. Menzo, F. D. DiFagagna, and A. Falaschi A human binding site for transcription factor USF/MLTF mimics the negative regulatory element of human immunodeficiency virus type 1. Virology 186: Gibbs, J. S., D. A. Regier, and R. C. Desrosiers. Construction and in vitro properties of SIVmac mutants with deletions in the "nonessential" genes. AIDS Res. Hum. Retroviruses, in press. 14. Hammes, S. R., E. P. Dixon, M. H. Malim, B. R. Cullen, and W. C. Greene Nef protein of human immunodeficiency virus type 1: evidence against its role as a transcriptional inhibitor. Proc. Natl. Acad. Sci. USA 86: Harrich, D., J. Garcia, F. Wu, R. Mitsuyasu, J. Gonzalez, and R. Gaynor Role of Spl-binding domains in the in vivo transcriptional regulation of the human immunodeficiency virus type 1 long terminal repeat. J. Virol. 63: Hirsch, V. M., G. A. Dapolito, S. Goldstein, H. McClure, P. Emau, P. N. Fultz, M. Isahakia, R. Lenroot, G. Myers, and P. R. Johnson A distinct African lentivirus from Sykes' monkeys. J. Virol. 67: Jones, K. A., J. T. Kadonaga, P. A. Luciw, and R. Tjian Activation of the AIDS retrovirus promoter by the cellular transcription factor, Spl. Science 232: Jones, K. A., P. A. Luciw, and N. Duchange Structural arrangements of transcriptional control domains within the 5' untranslated regions of the HIV-l and HIV-2 promoters. Genes Dev. 2: Kato, H., M. Horikoshi, and R. G. Roeder Repression of HIV-1 transcription by a cellular protein. Science 251: Kestler, H. W., III, D. J. Ringler, K. Mori, D. L. Panicali, P. K. Sehgal, M. D. Daniel, and R. C. Desrosiers Importance of the nef gene for maintenance of high virus loads and for the development of AIDS. Cell 65: Kim, J. Y. H., F. Gonzales-Scarano, S. L. Zeichner, and J. C. Alwine Replication of type I human immunodeficiency viruses containing linker substitution mutations in the -201 to region of the long terminal repeat. J. Virol. 67: Kim, S., K. Ikeuchi, R. Byrn, J. Groopman, and D. Baltimore Lack of a negative influence on viral growth by the nief gene of human immunodeficiency virus type 1. Proc. Nati. Acad. Sci. USA 86: Lu, Y., M. Stenzel, J. G. Sodroski, and W. A. Haseltine Effects of long terminal repeat mutations on human immunodeficiency virus type 1 replication. J. Virol. 63: Lu, Y., N. Touzjian, M. Stenzel, T. Dorfman, J. CF. Sodroski, and W. A. Haseltine. 1990). Identification of cis-acting repressive sequences within the negative regulatory element of huiman immunodeficiency virus type 1. J. Virol. 64: Lu, Y., N. Touzjian, M. Stenzel, T. Dorfman, J. G. Sodroski, and W. A. Haseltine The NFKB independent cis-acting sequences in HIV-1 LTR rcsponsive to T-cell activation. J. Acquired Immune Defic. Syndr. 4: Myers, G., B. Korber, J. A. Berzofsky, R. F. Smith, and G. N. Pavlakis Human retroviruscs and AIDS. A compilation and analysis of nucleic acid and amino acid sequences. Los Alamos National Laboratory. Los Alamos, N.Mex. 27. Nabel, G., and D. Baltimore An induciblc transcription factor activates expression of human immunodeficiency virus in T cells. Nature (London) 326: Niederman, T. M. J., B. J. Thielan, and L. Ratner Human

7 VOL. 68, 1994 immunodeficiency virus type 1 negative factor is a transcriptional silencer. Proc. Natl. Acad. Sci. USA 86: Orchard, K., N. Perkins, C. Chapman, J. Harris, V. Emery, G. Goodwin, D. Latchman, and M. Collins A novel T-cell protein which recognizes a palindromic sequence in the negative regulatory element of the human immunodeficiency virus long terminal repeat. J. Virol. 64: Pathak, V. K., and H. M. Temin Broad spectrum of in vivo forward mutations, hypermutations, and mutational hotspots in a retroviral shuttle vector after a single replication cycle: deletions and deletions with insertions. Proc. Natl. Acad. Sci. USA 87: Pulsinelli, G. A., and H. M. Temin Characterization of large deletions occurring during a single round of retrovirus vector replication: novel deletion mechanism involving errors in strand transfer. J. Virol. 65: NOTES Regier, D. A., and R. C. Desrosiers The complete nucleotide sequence of a pathogenic molecular clone of simian immunodeficiency virus. AIDS Res. Hum. Retroviruses 6: Shaw, J.-P., P. J. Utz, D. B. Durand, J. J. Toole, E. A. Emmel, and G. R. Crabtree Identification of a putative regulator of early T cell activation genes. Science 241: Terwilliger, E. F., E. Langhoff, D. Gabuzda, E. Zazopoulos, and W. A. Haseltine Allelic variation in the effects of the nef gene on replication of human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA 88: Varmus, H Retroviruses. Science 240: Zeichner, S. L., J. Y. H. Kim, and J. C. Alwine Linkerscanning mutational analysis of the transcriptional activity of the human immunodeficiency virus type 1 long terminal repeat. J. Virol. 65: