THE ANTIFILARIAL EFFECTS OF DIETHYLCARBAMAZINE AND IVERMECTIN MARY JEANNE MACLEAN. (Under the direction of Adrian Wolstenholme) ABSTRACT

Transcription

1 THE ANTIFILARIAL EFFECTS OF DIETHYLCARBAMAZINE AND IVERMECTIN by MARY JEANNE MACLEAN (Under the direction of Adrian Wolstenholme) ABSTRACT Filarial infections caused by Wuchereria bancrofti, Brugia malayi, and Brugia timori threatens nearly one billion people worldwide with lymphatic filariasis, and millions of dogs are at risk for contracting heartworm (Dirofilaria immitis). Control of these infections relies on very few drugs; ivermectin, albendazole, and diethylcarbamazine are distributed in mass drug administration programs to prevent lymphatic filariasis, and heartworm is controlled by macrocyclic lactone drugs, which include ivermectin. The mode of action of diethylcarbamazine and ivermectin in filarial nematodes is unclear, with in vitro assays using the Worminator system confirming that treated parasites are alive at drug concentrations much greater than those that kill them in vivo. These findings suggest that the clearance of microfilariae from the blood of infected people and dogs is a complex process that might involve host factors. Aiming to gain further insight into this possibility, we carried out a transcriptomic analysis of Brugia malayi males, females, and microfilariae treated with ivermectin, diethylcarbamazine, or albendazole in vivo. Ivermectin treatment produced the majority of differentially expressed genes, with a total of 113 transcripts in males and microfilariae at 24 hours, and in females and males at 7 days post-treatment. Diethylcarbamazine treatment yielded

2 61 total differentially expressed transcripts in males at 24 hours and in females and microfilariae at 7 days post-treatment. In total, nearly two hundred differentially expressed genes were identified with little overlap between treatment groups, suggesting that these drugs may interfere with processes important for parasite survival, development, and reproduction. INDEX WORDS: Filarial parasites, Lymphatic filariasis, Diethylcarbamazine, Ivermectin, Albendazole, In vivo, In vitro, Brugia malayi, Dirofilaria immitis

3 THE ANTIFILARIAL EFFECTS OF DIETHYLCARBMAZINE AND IVERMECTIN by MARY JEANNE MACLEAN B.S., Virginia Polytechnic Institute and State University, 2012 A Dissertation Submitted to the Graduate Faculty of The University of Georgia in Partial Fulfillment of the Requirement for the Degree DOCTOR OF PHILOSOPHY ATHENS, GEORGIA 2017

4 2017 MARY JEANNE MACLEAN All Rights Reserved

5 THE ANTIFILARIAL EFFECTS OF DIETHYLCARBAMAZINE AND IVERMECTIN by MARY JEANNE MACLEAN Major Professor: Adrian Wolstenholme Committee: Barbara Reaves Kaori Sakamoto Daniel Colley Ray Kaplan Electronic Version Approved: Suzanne Barbour Dean of the Graduate School The University of Georgia August 2017

6 DEDICATION I would like to dedicate my Ph.D. dissertation to the memory of my grandfather, Dr. Joseph P. Ciaudelli, and to my grandmother Rosemary Ciaudelli Grace. Although his time in my life was short, his impact was great. My grandmother has ceaselessly championed Grandpa Joe s dedication to scientific advancement and brightening the lives of others, while also pursuing a career in science that complemented her devotion to family and service to others. As I start my scientific career, I want to acknowledge that there were several doors closed to you and Grandpa Joe that are no longer closed to me, and I thank both of you for fostering my curiosity and exemplifying what can be achieved through hard work and tenacity, especially with the love and support of a partner by your side. iv

7 ACKNOWLEDGEMENTS Over the past five years, I have grown as a student and scientist in large part to the superb guidance of my mentors, Dr. Adrian Wolstenholme and Dr. Barbara Reaves. I have been supremely privileged to be a part of a laboratory where I have been able to learn and grow through both failure and success and always be secure in knowing that I am among excellent scientists who are also excellent people. I am also so grateful for the guidance of Sue Howell, Bob Storey, and Erica Burkman, who taught me many of the basic skills and methods I use daily. I have had many lab mates over the years, and they have all helped tremendously with everything from developing and troubleshooting experiments to cups of tea to lift spirits. I would especially like to thank Ciaran McCoy, Ruby Coates, Hetty Swan, and Connor Wallis for all their help and motivation during our time together, and for always making the lab a fun environment. I would also like to thank my family for their support, especially my mom and dad who have always been my most vocal cheerleaders, and to my sisters Margaret and Maureen for their encouragement from afar. Last, but certainly not least, I would like to thank Chris Anna for all of his love, patience, and support- both emotional and technical. It has been hard to be apart for so long, but knowing that I have you as my partner for life has made this time so much more fun and fulfilling than I thought possible, and I look forward to starting our lives together. v

8 TABLE OF CONTENTS Page ACKNOWLEDGEMENTS.....v LIST OF TABLES...x LIST OF FIGURES...xii ABBREVIATIONS..xiv CHAPTERS 1. INTRODUCTION AND LITERATURE REVIEW... 1 Infections caused by filarial parasites... 1 Lymphatic filariasis... 2 Wuchereria bancrofti, Brugia malayi, and Brugia timori cause lymphatic filariasis... 5 Pathophysiology of lymphatic filariasis... 7 Control of lymphatic filariasis Diethylcarbamazine (DEC) Albendazole (ALB) Ivermectin (IVM) Glutamate-gated chloride channels (GluCls): popular targets of anthelmintic drugs Filariae-induced immune response in humans Filarial manipulation: immune evasion and modulation Canine heartworm vi

9 Pathophysiology of heartworm Control of heartworm Macrocyclic lactone-resistant heartworm The health and economic impact of heartworm disease RNA sequencing as an approach to better understand anthelmintic mechanisms of action Conclusion MATERIALS AND METHODS Drug preparation Worminator assays In vivo drug preparation Gerbil infection and treatment Media preparation Parasite extraction and purification RNA extraction RNA Sequencing (RNAseq) RNAseq analysis TaqMan primer and probe design PCR primer design Reverse transcription of RNA to cdna PCR Gel electrophoresis Quantitative real-time PCR (qpcr) vii

10 3. RESULTS Development and validation of the Worminator system Characterization of motility in C. elegans expressing nicotinic acetylcholine receptor subunits from parasitic nematodes B. malayi and B. pahangi treated with emodepside B. malayi Mf assayed with anthelmintics used in human MDA programs In vivo Brugia malayi drug treatment RNAseq sample preparation Transcript analysis GeneID and ortholog matching Differentially expressed gene sequences Gel electrophoresis of qpcr target transcripts PCR results qpcr standard curves qpcr Dysregulation by drug treatment: PANTHER analysis IVM 24 hour Mf IVM 24 hour males IVM 7 day males IVM 7 day females DEC 7 day Mf DEC 24 hour males DEC 7 day females viii

11 4. DISCUSSION Differentially expressed genes identified in previous studies In contrast to previous transcriptomic studies: Patterns of differential gene expression and putative transcript function Molting Proteolysis Cadherins: cell adhesion proteins and more Glycosylation and phosphorylcholine Host immune evasion and manipulation Genes potentially involved in circadian entrainment Gcy FUTURE DIRECTIONS Examine the impact of drug treatment on selected E/S products in vitro Utilize known inhibitors of GPCR activation and protein trafficking in the presence of IVM and DEC Explore the role of cadherins in the interaction of adult filarial parasites with lymphatic tissues and in nematode development Investigate circadian rhythm in Mf and utilize C. elegans to study nematode behavior altered by drug treatment Bioinformatic future directions: ix

12 6. DOES EVALUATION OF IN VITRO MICROFILARIAL MOTILITY REFLECT THE RESISTANCE STATUS OF DIROFILARIA IMMITIS ISOLATES TO MACROCYCLIC LACTONES? Abstract: Background Methods Results Discussion REFERENCES x

13 LIST OF TABLES Table 1:1 Characterization of species causing lymphatic filariasis... 6 Table 2.1: Primer sets used for qpcr Table 2.2: Primer sequences for PCR Table 3.1: IC50 values for B. malayi and D. immitis Mf Table 3.2: IC 50 values for B. malayi & B. pahangi Mf treated with emodepside Table 3.3: B. malayi adult collection Table 3.4: B. malayi Mf collection (in millions) Table 3.5: Samples submitted for B. malayi female sequencing run Table 3.6: Samples submitted for B. malayi male sequencing run Table 3.7: Samples submitted for B. malayi Mf sequencing run Table 3.8: Sequencing data summary Table 3.9: Read coverage by sequencing run and B. malayi genome release Table 3.10: Summary of differentially expressed genes (DEG) Table 3.11: Differentially expressed genes in IVM-treated Mf at 24 hours Table 3.12: Differentially expressed genes in IVM-treated males at 24 hours Table 3.13: Differentially expressed genes in IVM-treated females at 7 days Table 3.14: Differentially expressed genes in IVM-treated males at 7 days Table 3.15: Differentially expressed genes in DEC-treated males at 24 hours Table 3.16: Differentially expressed genes in DEC-treated females at 7 days xi

14 Table 3.17: Differentially expressed genes in DEC-treated Mf at 7 days Table 3.18: Differentially expressed genes in ALB-treated females at 7 days Table 3.19: Amplification efficiencies of qpcr targets Table 3.20: Expression of qpcr target genes according to DESeq Table 3.21: ΔΔCt values and fold changes of gene targets Table 3.22: Fold change of qpcr target genes: comparison of results from RNAseq and qpcr Table 4.1: Differentially expressed genes identified from the secretome of B. malayi Table 4.2: Differentially expressed genes identified as potential drug targets based on the C. elegans orthologs Table 4.3: B. malayi genes with orthologs involved in molting Table 4.4: B. malayi genes with orthologs involved in proteolysis Table 4.5: B. malayi gene hits with cadherin or cell-adhesion orthologs Table 4.6: B. malayi gene hits with orthologs involved in glycosylation or whose products are PC-conjugated Table 4.7: B. malayi gene hits with orthologs involved in circadian entrainment Table 5.1: Secreted protein products for further study Table 5.2: Potential B. malayi receptor activation or protein trafficking genes Table 5.3: B. malayi cadherin and cell-adhesion related genes Table 5.4: B. malayi genes that could be involved in circadian rhythm and behavior Table 6.1: Blood microfilaremia associated with experimental infections with two suspected ML-resistant isolates of D. immitis Table 6.2: Inhibition of Mf motility by ivermectin in vitro xii

15 LIST OF FIGURES Figure 1.1: Map of LF-endemic countries and the status of MDA in Figure 1.2: The life cycle of B. malayi, one of the three causative agents of LF... 7 Figure 1.3: Chemical structure of diethylcarbamazine Figure 1.4: Chemical structure of albendazole Figure 1.5: Chemical structure of ivermectin Figure 1.6: Regulation of immune responses in filarial infections Figure 1.7: The life cycle D. immitis, the causative agent of canine heartworm Figure 3.1: D. immitis Mf mean motility unit (mmu) and dose response curves for macrocyclic lactone class anthelmintics Figure 3.2: B. malayi Mf mean motility unit (mmu) and dose response curves for macrocyclic lactone (ML) class anthelmintics Figure 3.3: Motility of C. elegans lines determined using the Worminator Figure 3.4: B. malayi and B. pahangi Mf treated with emodepside Figure 3.5: Worminator assays for B. malayi Mf treated with ALB, its secondary metabolite ALB sulfoxide, DEC, or IVM in vitro Figure 3.6: Agilent 2100 Bioanalyzer report for B. malayi females Figure 3.7: Venn diagram generated with Venny 2.1 of differentially expressed genes organized by drug Figure 3.8: Differentially expressed genes in Mf xiii

16 Figure 3.9: Differentially expressed genes in adults Figure 3.10: Genes differentially expressed by IVM treatment by gender, life stage and time point Figure 3.11: Genes differentially expressed by DEC treatment Figure 3.12: Gel electrophoresis of qpcr products Figure 3.13: Gel electrophoresis of Bm6109, Bm1811, and Bm17689 PCR products Figure 3.14: Amplification plot and standard curve of Bm4605 primer/probe set Figure 3.15: qpcr curve of Bm7847 expression in IVM, ALB, and untreated females worms from the 7 day time point Figure 3.16: qpcr curve of Bm1750 expression in DEC-treated Mf and untreated Mf from the 7 day time point Figure 3.17: PANTHER pathway chart of DEG upregulated by IVM and overrepresented pathways Figure 5.1: Schematic of transwell assay systems, Corning Labs Figure 6.1: Baseline motility of D. immitis isolate Mf 146 Figure 6.2: Dose-response curves for the effect of ivermectin on Mf motility Figure 6.3: Effects of purification method on dose-response curves xiv

17 ABBREVIATIONS ALB: albendazole BZ: benzimidazole DC: dendritic cells DEC: diethylcarbamazine DEG: differentially expressed gene(s) EC: endothelial cells ELISA: enzyme-linked immunosorbent assay E/S: excretory/secretory ET-1: endothelin 1 GCPRs: G-protein-coupled receptors GluCls: glutamate-gated chloride channels IL-8: interleukin-8 IL-10: interleukin-10 IVM: ivermectin LF: lymphatic filariasis MDA: mass drug administration ML: macrocyclic lactones Mf: microfilaria/ microfilariae PBMC: peripheral blood mononuclear cells (lymphocyte and monocyte cell populations) xv

18 PC: phosphorylcholine PCR: polymerase chain reaction PMN: polymorphonuclear cells, specifically neutrophils TGF-β: transforming growth factor-beta VEC: vascular endothelial cells VEGF: vascular endothelial growth factor VSMC: vascular smooth muscle cells xvi

19 CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW Infections caused by filarial parasites Filariae, from the Latin filum, are nematodes named for their thread-like appearance. These worms are often grouped in Clade III of nematodes, according to the most common organization of nematode phylogeny (Blaxter et al. 1998), and are members of the Onchocercidae family (Chabaud & Choquet 1953). These parasites infect humans and animals and are transmitted by arthropod vectors. In terms of the number of infections and their impact on global health, the species causing lymphatic filariasis (LF), river blindness, and loiasis are most important for human health, while heartworm is the most important filarial parasite of dogs. Approximately 160 million people have infections caused by filarial parasites, and these parasites are responsible for the second leading causes of long-term disability (LF) and infectious blindness (river blindness) worldwide (Taylor et al. 2010; WHO 2014). In addition to physical impairment and disfigurement, these infections can lead to social stigmatization and loss of productivity that extends from the patient to their family and community, hindering economic development (WHO 2016a). Like many parasitic infections, those caused by filarial parasites have followed man longer than recorded history. Some of the first descriptions of LF are in Egyptian funerary art dated to 1500 B.C., with the princess of Punt depicted with enlarged and disfigured lower limbs compared to those of her servants (Otsuji 2011). The first written descriptions of LF, heartworm, and river blindness were recorded in the 16 th, 17 th, and 1

20 19 th centuries, respectively (Burnell 1885; Birago 1626; Mongin 1770). LF was the first disease determined to be transmitted by arthropods, with Sir Patrick Manson elucidating the W. bancrofti life cycle in 1877 (Manson 1878). By the early 20 th century, the life cycle and vector of all filarial parasites had been determined, providing a framework to begin combatting the diseases they cause. Early attempts at treatments to cure patients showed some success in killing parasites, but they were also very toxic and far too dangerous for widespread use (Crump et al. 2012). The development of diethylcarbamazine (DEC) following the Second World War (Hewitt et al. 1947; Hawking et al. 1950) marked the beginning of the modern era of filarial parasite control and the development of the drug classes used to combat these infections (Grove 1990). Seventy years later and with two additional drugs (albendazole and ivermectin), we have made great strides in controlling filarial parasites, but more research, funding, and implementation will be required to eliminate them as a public health threat. Lymphatic filariasis Lymphatic filariasis is distributed throughout the world in tropical and subtropical regions (Figure 1.1) and is considered a neglected tropical disease (NTD), as it disproportionally affects people living in poverty in close contact with infectious vectors and without adequate sanitation. Of the 38 least developed countries, 32 are LF endemic (Chandy et al. 2011). There are an estimated 120 million people in 73 countries currently infected with LF, and an additional 947 million are at risk (WHO 2016a). The most commonly recognized manifestation of LF is known as elephantiasis, in which the legs of patients are enlarged, and the skin is rough and leathery in appearance. The enlargement 2

21 of the lower trunk and legs is caused by the disruption and gradual destruction of the lymphatic system, which leads to edema. The enlargement of legs caused by edema stretches and damages skin, causing it to thicken and loose elasticity. The effect of skin disruption is two-fold, it takes on a weathered appearance and is now a less effective barrier, leaving patients vulnerable to secondary bacterial and fungal infections. Lymphedema and elephantiasis affect 15 million people, and represent the manifestation of LF pathologies seen in women. Hydrocele, which is edema of the scrotum, affects 25 million men and is the single most common severe symptom of LF. It occurs in men more frequently than women (Sahoo et al. 2000). Hydrocele is a leading factor in the loss of productivity caused by LF (Murray et al. 2012), as this condition can be very painful and prevent patients from leading normal lives, potentially resulting in social and sexual stigmatization. Both elephantiasis and hydrocele present most commonly in middle-aged adults. They have been infected for years, but adult parasites are now dying or dead, possibly triggering these symptoms (Partono 1987; Dreyer et al. 2000). These patients rarely exhibit microfilariae (Mf) in their blood, as their infections are usually no longer active. While the manifestations of LF are often very pronounced, these patients only represent about one-third of those infected. 3

22 Figure 1.1: Map of LF-endemic countries and the status of MDA in 2015 (WHO 2016a) 4

23 Wuchereria bancrofti, Brugia malayi, and Brugia timori cause lymphatic filariasis LF is caused by three species of filarial parasites: Wuchereria bancrofti, Brugia malayi, and Brugia timori, which are distributed in different parts of the world. W. bancrofti causes about 90% of LF, and is found in Africa, Asia, and South America, while most of the remaining cases are caused by B. malayi, in South East Asia and Indonesia (WHO 1992). B. timori is restricted to Timor and Flores in the southern islands of Indonesia and is responsible for the fewest cases. In addition to varied distribution, each filarial species has a specific group of competent mosquito vectors (Bockarie et al. 2009). W. bancrofti is the most cosmopolitan, with competent vectors in the Culex, Anopheles, Mansonia, and Coquillettidia genera. B. malayi is commonly found in Aedes and Mansonia spp. (Bockarie et al. 2009), while B. timori is seemingly restricted to a single species, Anopheles barbirostris (Atmosoedjono et al. 1977). They also display varied forms of periodicity, or time frame, when Mf can be found in the blood. The observation of Mf periodicity quickly followed determination of the parasite life cycle (Manson 1881), and is still not completely understood, but is thought to align with the time-specific feeding behaviors of competent mosquito vectors (Manson 1899; Hawking & Thurston 1951) (Table 1.1). The Mf of nocturnally periodic and subperiodic strains circulate in the blood during the night increasing their chances of being taken up by a mosquito and return to the lungs, where they sequester themselves during the day (Hawking & Gammage 1968). The opposite is true for diurnally periodic parasites, which circulate during the day and sequester themselves during the night. Given that the Mf of most parasites are nocturnally periodic or subperiodic, blood drawn at night is used to look for Mf to determine if a person is infected with LF. 5

24 Mosquito vector Geographic distribution Periodicity Reservoirs Adult Size Mf Size (thick blood smear) Table 1:1 Characterization of species causing lymphatic filariasis B. malayi B. timori W. bancrofti Aedes, Mansonia South East Asia Nocturnally periodic Nocturnally subperiodic (zoonotic form) humans, leaf monkeys, possibly domestic cats and other carnivores cm (females) cm (males) µm sheathed Anopheles barbirostris Lesser Sunda Islands of Indonesia (Timor, Flores) Nocturnally periodic humans cm (females) cm (males) µm sheathed Culex, Anopheles, Mansonia, Coquillettidia Old and New World Tropics of Africa, South America, and Asia Nocturnally periodic: Africa, South America, Asia Nocturnally subperiodic: Thailand Diurnally subperiodic: South Pacific humans 8-10 cm (females) cm (males) µm sheathed The parasites that cause LF have a relatively complex life cycle, with multiple morphological changes occurring in the mosquito, which is the intermediate host and vector, and in the definitive human host, where worms mature and reproduce (Figure 1.2). The cycle begins when a mosquito takes a blood meal from an infected human containing Mf. Upon being taken up, Mf develop into larvae within the mosquito for days (Scott 2000). Mf shed their sheaths and breach the mosquito midgut and migrate to the thoracic muscles, where they molt into L1. They molt twice more into L3 and migrate to the head and proboscis. L3 emerge from the cuticle of the labium and crawl into the bite hole made by the mosquito during the blood meal, entering the human host. Inside a human, L3 molt twice more before migrating to the lymphatics, where they mature into adults over 6-12 months. Adult worms mate and produce Mf that circulate in the blood to be taken up by another mosquito to continue transmission. The estimated 6

25 time between infection and adults producing Mf is roughly 12 months (Mahoney & Kessel 1971). These parasites can live for up to twenty years, and can produce more than 50,000 Mf per day during the 5-8 years they are reproductively active (Hoerauf et al. 2005; Bennuru et al. 2009). Figure 1.2: The life cycle of B. malayi, one of the three causative agents of LF Pathophysiology of lymphatic filariasis LF manifests in both acute and chronic forms, but the most recognized constellation of symptoms are those of the chronic form and include lymphedema, elephantiasis, and hydrocele. These symptoms are caused by the destruction of the lymphatic system and an inflammatory immune response. The spectrum of LF 7

26 symptomology has long been recognized (Bancroft 1879), and those living in endemic areas are now grouped based on infection status and symptomology. There are: (1) people who have been exposed to the parasite but not infected, (2) those who are infected but show no symptoms, (3) individuals who exhibit acute symptoms with or without Mf, (4) those with well-established chronic infections and the resulting pathological conditions, and (5) those with tropical pulmonary eosinophilia (TPE) (WHO 1992). In areas that are endemic for LF, a proportion of the individuals do not become infected despite repeated exposure, and are called endemic normals. These individuals are thought to be immune to infection due to circulating antibodies against L3 antigens (Day 1991). The frequency of these individuals varies greatly (0-90%) based on the endemic area (WHO 1992). Those who show no symptoms of LF, but present with Mf in the blood are carriers for the infection and act as a reservoir for transmission. These patients make up a majority of those (two-thirds) infected with LF, and nearly all of them exhibit subclinical lymphatic dysfunction to some extent (Freedman et al. 1994). Patients with acute presentation often suffer from filarial fever (adenolymphangitis), characterized by fever, pain, and inflammation at the affected lymph nodes, often in the lower limbs (Partono 1987). These episodes tend to last for a week before resolving but may occur several times per year. Acute LF also causes acute dermatolymphangioadenitis (ADLA), which is thought to be the result of secondary infections caused by adult worms blocking and damaging lymphatics (Dreyer, Medeiros, et al. 1999). ADLA presents as subcutaneous swelling of the leg, with or without lymphangitis that ascends toward the trunk. ADLA is the common mark of the progression to chronic disease, and is believed to be the cause of lymphedema and 8

27 elephantiasis. Another form of acute disease is caused by the death of adult worms and is known as acute filarial lymphangitis (AFL) (Dreyer, Medeiros, et al. 1999). The death of the worms elicits an inflammatory host response, prompting the formation of granulomatous nodules. These nodules block the flow of lymph and cause lymphangitis that moves downward from the source. The tendency of nodules to form in the inguinal lymph nodes is thought to play a role in the development of hydrocele (Simonsen 2008). The classic mark of chronic LF is lymphedema, which is brought on by adult worms blocking and damaging the lymph nodes, causing them to retain lymph and swell. They also induce endothelial cell proliferation, causing lymphangiectasia (dilation), particularly in the vicinity of worm nests (Dreyer et al. 2000). However, dilatation is not restricted to locations where adult worms are present, suggesting that endothelial cell proliferation and lymphangiectasia are mediated by soluble products released by parasites (Amaral et al. 1994; Dreyer, Norões, et al. 1999). It is believed that Wolbachia, the bacterial endosymbiont of many filarial worms releases toxins that contribute to this process. Wolbachia and its products are strong activators of the innate immune response, recruiting neutrophils and activating macrophages that cause inflammation and dilatation of lymphatic vessels (Taylor et al. 2005; Saint André et al. 2002; Turner et al. 2006). Dilatation further impairs lymphatic function and favors the development of secondary microbial infections. Elephantiasis may present following lymphedema and is named for the rough and leathery appearance of the skin that has occurred due to thickening, folding, and nodulation. Elephantiasis most commonly occurs in the legs but may also occur in the arms, breasts, and genital areas. Repeated acute attacks and edema cause the skin to lose elasticity. Fibrosis and dermatosclerosis occur, and dermal ulcers may form. 9

28 Secondary infections caused by bacteria and fungi often occur in these areas, as they are difficult to keep clean (Olszewski et al. 1997; Dreyer et al. 2006). Hydrocele is the most common symptom of LF (Partono 1987; Gyapong et al. 1998) and results from edema in the cavity of the tunica vaginalis testis. It is often accompanied by thickening of the spermatic cord and alteration in the skin and subcutaneous tissue surrounding the scrotum (WHO 2002). Accumulation of fluid of the scrotal sac can be very painful and may to lead scrotal distension. How fluid builds up in this area is not totally understood, but ultrasound data indicate that the scrotal lymphatics may be a preferred site for worms to concentrate (Dreyer et al. 1998). Hydrocele is most common in infections caused by W. bancrofti and is a rare occurrence in infections caused by Brugia (Simonsen 2008). Rarely, patients present with tropical pulmonary eosinophilia (TPE) caused by a heightened immune response to Mf in the lungs. This condition is marked by blood eosinophilia exceeding 3000 cells/mm 3 and fits of coughing and wheezing (Ottesen & Nutman 1992). Paroxysms tend to occur during the night, likely due to the periodicity of Mf. TPE affects more men than women and, if left untreated, may result in loss of lung function (Ong & Doyle 1998). Like hydrocele, TPE is more common in infections caused by W. bancrofti (Simonsen 2008). Chyluria is another rare symptom of LF and is the result of dilated lymphatics that have ruptured and deposited chyle (lymph, free fatty acids) into the urinary excretory system (Diamond & Schapira 1985). Symptoms of LF, particularly those of the chronic form, tend to begin to present around the onset of puberty or early adult life, years after initial infection (Witt & Ottesen 2001). The most common early symptom is adenolymphangitis. It should also be noted 10

29 that the transmission efficiency of LF is low, and studies have indicated that it may take thousands or tens of thousands of infective mosquito bites to produce a case of microfilaremia in a person (Hairston & de Meillon 1968; Southgate 1984). Diagnosis of LF is usually made based on the presentation of the classical symptoms described above in people living in endemic areas. A definitive diagnosis can be made through the demonstration of Mf in blood smears at appropriate times for parasite periodicity (Chandy et al. 2011). Tests to measure circulating filarial antigen (CFA) in blood plasma are available for W. bancrofti (Weil & Ramzy 2007), and ultrasonography can be implemented to visualize worms and monitor their viability (Mand et al. 2003). Neither CFA nor ultrasonography are useful for detecting B. malayi infections in the absence of microfilaremia (Mand et al. 2006), but enzyme-linked immunosorbent assays (ELISA) and polymerase chain reaction (PCR) can be used to detect and differentiate these infections (Rahmah, Lim, et al. 2001; Rahmah, Taniawati, et al. 2001; Weil et al. 2011) Control of lymphatic filariasis In 1997, the World Health Organization (WHO) identified LF as potentially eradicable and called for a multinational effort to reduce the incidence and effects of the disease (WHO 1997). This effort spurred the formation of the Global Programme for the Elimination of Lymphatic Filariasis (GPELF) in 2000 with the goals of stopping the spread of LF by interrupting transmission and reducing the morbidity and suffering in affected populations. This two-pronged approach was conceived with the goal of eliminating LF as a public health problem by 2020 (WHO 2010). LF control is managed by three drugs administered in combination via mass drug administration (MDA) 11

30 programs (WHO 2006). Diethylcarbamazine (DEC) is currently the preferred drug to treat active LF and kills Mf and some adult worms (Figueredo-Silva et al. 1996; Norões et al. 1997). It is usually given combined with the anthelmintic albendazole (ALB) and given annually as a single dose containing 6 mg/kg body weight DEC mg ALB. Ivermectin (IVM) is a broad-spectrum anthelmintic used in both human and veterinary medicine. Distributed under the brand name Mectizan, the drug kills Mf but not adults (Dreyer et al. 1996). It is combined with ALB and also given yearly as a single dose of 150 µg/kg body weight IVM mg ALB in areas that are co-endemic for onchocerciasis but not for loiasis. Recently, small studies on the administration of IVM + ALB + DEC have yielded promising results that suggest triple drug treatment could hasten LF elimination (Thomsen et al. 2016; Fischer et al. 2017). Larger trials are currently underway to further ascertain efficacy and safety and to investigate if and how this regimen could be safely implemented in areas co-endemic with onchocerciasis or loaisis. By clearing Mf for up to a year, these drugs disrupt transmission by preventing mosquitoes from taking them up and allowing them to develop into the infectious L3 to be passed on to another person. Vector control is employed in some endemic areas, but chemotherapy is the single most important intervention. GPELF also promotes community education efforts to teach proper hygienic care to people with edema to reduce morbidity and prevent secondary infections. Initial studies predicted it would take between 4 and 6 years of MDA to eliminate transmission, but recent reports indicate that several more rounds of MDA may be required to end transmission (Bockarie & Deb 2010). MDA has yet to reach 100% coverage in endemic regions. It is estimated that at 12

31 least 65% of the at-risk population needs to be treated for five years or more (WHO 2006). Compounding this, 26.3% of people needing preventive chemotherapy live in areas that did not implement MDA in 2015 (WHO 2016a) is an ambitious deadline, and several more years of MDA on a greater and more coordinated scale with subsequent surveillance will be required to eliminate LF as a public health threat (WHO 2016b). Diethylcarbamazine (DEC) Figure 1.3: Chemical structure of diethylcarbamazine DEC (N, N-Diethyl-4-methyl-1-piperazinecarboxamide citrate salt) is a piperazine derivative first used to treat filariasis in Nearly 40,000 American soldiers returning from the Pacific theater had been exposed to LF (Coggeshall 1945; Wartman 1947), providing a greater drive for researchers to development a treatment. Piperazine drugs had been known for decades and used for treating conditions such as gout and arthritis with little effect. Initial studies in the 1940s showed that many of these drugs had an anthelmintic effect, but DEC was singled out due to its especially rapid clearance of Mf in experimentally infected dogs and rats (Hewitt et al. 1947; Stewart et al. 1947). In humans, treatment with DEC can reduce microfilaremia by 80% within a few hours and near total clearance within 48 hours (Hawking 1950). The rapid effect and low toxicity 13

32 aided in the quick adoption of this drug, despite little understanding of how it worked. We now know that DEC exerts an anti-inflammatory effect and is an antagonist of arachidonic acid metabolism (Maizels, R.M., Denham 1992). Arachidonic acid is a polyunsaturated fatty acid that can be found in cell phospholipid membranes. The eicosanoid products of this pathway have numerous effects, including vasodilatation, inhibiting platelet aggregation, and inducing the activation and deployment of granulocytes and leukocytes (Needleman et al. 1986). What is still unclear is how impeding this metabolic pathway gets rid of Mf. In vivo studies show that the drug acts in minutes, but those performed in vitro showed no effect on parasites (Hawking et al. 1950). Studies on immune-deficient (athymic) mice infected with B. pahangi and treated with DEC showed reduced microfilaremia, suggesting that the innate immune response is responsible (Babu & Nutman 2012). One proposed hypothesis is that by blocking arachidonic acid metabolism, DEC prevents Mf and endothelial cells from producing prostaglandins that induce vasodilation. Vasoconstriction occurs, bringing platelets and granulocytes that take up and clear immobilized Mf (Martin 1997). Other studies examining the protective effect of DEC against chronic inflammation suggest that the drug may block the NF-κB signaling pathway, which regulates many of the genes responsible for eliciting chronic inflammatory responses (Alves Peixoto & Santos Silva 2014). It has also been suggested that the effect of this drug may be due to the piperazine ring structure itself, which remains intact in all metabolites and excreted forms and may act as a neurohormone analog or disrupt neurotransmission (Hawking 1978). In vitro, treatment of Ascaris with DEC prevented the breakdown of acetylcholine, suggesting it may act as an analog of acetylcholine (Ach), mimicking gamma-aminobutyric acid 14

33 (GABA), and bringing about hyperpolarization of muscle cells, leading to relaxation (Martin 1982) Studies on human blood samples showed that DEC treatment reduced the levels of acetylcholinesterase (AChE), the protein responsible for breaking down Ach, contributing to the speculation that this drug interferes with neuronal transmission (Bhattacharya et al. 1997). Compared to other anthelmintics, little is known about this drug, and there is very limited ongoing research into its mechanism of action. Albendazole (ALB) Figure 1.4: Chemical structure of albendazole Albendazole (Methyl [5-(propylthio)-1H-benzoimidazol-2-yl] carbamate) is a benzimidazole (BZ) drug first produced in 1972 by the SmithKline Health Lab from a plant-infecting fungus (Theodorides et al. 1976). BZs were initially used as fungicides and were first introduced as veterinary anthelmintics in 1961 with thiabendazole, whose safe, broad-spectrum use stimulated further development of the drug class (Brown et al. 1961). ALB and other drugs in this class are so named for their structure of a benzene ring fused to imidazole. The first intermediate metabolite, albendazole sulfoxide (ALB- SO) was considered to be the primary form acting against parasites, while the final metabolite albendazole sulfone (ALB-SO2) was considered to be inactive (Gottschall et al. 1990), but all three forms of the drug exhibit microfilaricidal effects (Fernando et al. 15

34 2011). ALB stands apart from other BZs due to its metabolic intermediates retaining anthelmintic properties, causing it to be more effective (Dayan 2003). Early studies on the mode of BZ action showed disintegrated microtubules in the intestinal cells of A. suum (Borgers et al. 1975), implying that tubulin played an important role in the drug s efficacy. Within a few more years the complete mechanism of action was revealed, and today, we know that these drugs act by binding to β-tubulin (Lacey 1990). This prevents tubule polymerization and the subsequent formation of microtubules. The disruption of microtubule formation renders the worm unable to regulate metabolic processes such as energy production and glucose transport, leaving it unable to move and slowly starving to death (Martin 1997). Recently, a study has shown that ALB-SO2 prevents binary fission in Wolbachia, suggesting that interference in the endosymbiont could contribute to parasite damage following treatment (Serbus et al. 2012). ALB was first approved for human use in 1982 and is now used for the treatment of soil-transmitted helminths (STH), tapeworm, and other helminth infections (Horton 2001). In the context of LF control, ALB given in combination with either DEC or IVM suppresses Mf longer than either drug alone (Taylor et al. 2010). There is some evidence that higher doses of ALB may affect adults, but whether combining it with DEC produces a synergistic effect that works against them is unconfirmed (Critchley et al. 2005; Gyapong et al. 2005; Taylor et al. 2010). The inclusion of ALB may also increase compliance in LF MDA based on its safety and efficacy against STH (Remme et al. 2006), highlighting its role as a cornerstone of helminth control. 16

35 Ivermectin (IVM) Figure 1.5: Chemical structure of ivermectin Ivermectin (22,23-dihydroavermectin B1a+ 22,23-dihydroavermectin B1b) is a macrocyclic lactone (ML) derived from the fungus Streptomyces avermitilis found in a single soil sample from Japan in 1974 (Omura 2008). Cultures from the soil sample were screened for anthelmintic properties using mice infected with Heligmosomoides polygyrus. One sample, to be named avermectin, proved to be the safest and most potent agent. Modification of two di-hydro avermectin compounds further increased the safety and potential application of the drug, resulting in the mix of 80% B1b and 20% B1a that we know today as ivermectin (Õmura & Crump 2004). The compound was found to be active against a wide array of helminths, arachnids, and insects; its ability to kill both internal and external parasites made IVM the first endectocide (Campbell et al. 1983; Chabala et al. 1980). By 1981, IVM was adopted for veterinary use in livestock, and in 1987 it was approved for human use. In 1988, Merck began to donate IVM for onchocerciasis treatment under the name Mectizan (Crump & Ōmura 2011). 17

36 In patients with LF, IVM treatment nearly eliminates 70% of Mf from the bloodstream within 24 hours, with almost total clearance within a week, and prevents their reappearance for at least six months (Mak et al. 1993; Brown et al. 2000). Despite the rapid effects of the drug, its mechanism of action in filarial parasites remains unclear. We know through studies on C. elegans and H. contortus that IVM acts on glutamategated chloride channels (GluCl) causing hyperpolarization of the nerve cell and an influx of chloride, which causes paralysis by preventing neural and muscular function (Cully et al. 1994; DK et al. 1997; Dent et al. 1997; Dent et al. 2000). In vitro studies on C. elegans and H. contortus, both of which have GluCls in the motor nervous system and pharynx suggested that IVM killed via paralysis and the inhibition of feeding (Dent et al. 1997; Dent et al. 2000; Geary et al. 1993; Pemberton et al. 2001; McCavera et al. 2009). While these findings present a coherent argument for these species, they do not apply to B. malayi Mf, which are also cleared by IVM. The only GluCls that have been found in B. malayi surround the excretory/secretory (E/S) pore of the Mf and are not in the motor nervous system, and Mf treated with IVM released less E/S proteins (Moreno et al. 2010). Furthermore, the Mf of many filarial species are sheathed, and none of them feed at this stage, as they do not have a functional gut (Laurence & Simpson 1974). Another mystery surrounding how IVM works on filarial parasites is our observation that the amount of drug needed to paralyze D. immitis and B. malayi in vitro is several orders of magnitude greater than in vivo. These findings in addition to the differential expression of GluCls in B. malayi point towards a different mode of action for IVM in these parasites, which may also be bolstered by reports of it having a synergistic effect on immune mediators that fight infection (Rao et al. 1987; Zahner et al. 1997). 18

37 Glutamate-gated chloride channels (GluCls): popular targets of anthelmintic drugs Studying the mechanics of nematode nervous systems and how they are interrupted by anthelmintic drugs has been a major driver of research in our laboratory. Of the many types of ion channels targeted by these drugs, we have focused much of our attention on the glutamate-gated chloride channels (GluCls) of nematode nerve and muscle cells. One of the features highlighting GluCls as attractive drug targets is that they are not found in mammals, making them safer than the shared gamma-aminobutyric acid (GABA) receptors. Initially, IVM was thought to cause paralysis by the activation of GABA receptors (Holden-Dye & Walker 1990), but the amount of drug needed to induce this effect was far beyond clinically relevant doses (Dent et al. 1997; Wolstenholme & Rogers 2005). Subsequent studies of the AVR-14 GluCl of H contortus identified these ion channels as the target of IVM (McCavera et al. 2009). Following the sequencing of the B. malayi genome, four potential GluCls were identified: GLC-2, GLC-4, AVR-14a, and AVR-14b (Williamson et al. 2007). Of these, AVR-14 was the only GluCl reported to form IVM-sensitive channels identified in B. malayi (Wolstenholme & Rogers 2005). Expression of AVR-14 in B. malayi co-localizes with the E/S pore in Mf (Moreno et al. 2010). In adults, AVR-14 is highly expressed in the reproductive tract of females, including in the resident developing embryos. In males, the spermatagonia, the vas deferens, and the muscle surrounding its terminal end all express AVR-14 (Li, et al. 2014). Transcriptomic analysis of B. malayi females treated with IVM in vitro identified dysregulation of genes likely involved in reproduction, with meiosis particularly affected (Ballesteros et al. 2016b). These findings suggest that the GluCl are involved in 19

38 reproduction and embryogenesis in filarial worms, and may explain why Mf production is blocked following treatment with IVM. Filariae-induced immune response in humans The immune response to filarial parasites is complicated and highly variable by person. As a result, much of the knowledge we do have is the result of experiments performed in vitro with ex vivo components. Like that of other helminth infections, the response to LF can generally be characterized as T helper 2 (Th2) dominant (Babu & Nutman 2014). The Th2 response involves several cytokines including the interleukins IL-4, IL-5, IL-9, IL-10, and IL-13, and antibody isotypes IgG1, IgG4, and IgE. Alternatively activated macrophage (AAMΦ), eosinophil, basophil, and mast cell populations are expanded during this response. The filarial endosymbiont Wolbachia elicits a much different immune response driven by Th1 and Th17 effectors, leading to inflammation by activating classical macrophages and promoting the recruitment and activation of neutrophils (Turner et al. 2006). Wolbachia exposure also causes innate and adaptive expression of vascular endothelial growth factors (VEGF) that promote lymphatic endothelial cell proliferation, lymphangiogenesis, and the dilation of lymphatic vessels that collectively result in the lymphedema seen in chronically infected patients (Debrah et al. 2006; Debrah et al. 2009). As previously mentioned, LF can be described as a spectrum, with the immune responses of those infected having varied immune profiles. Largely asymptomatic but Mf+ patients present with dramatically elevated IgG4, IL-10, TGF-β, specific T cell hypo-responsiveness, and impaired IFN-γ and IL-2 production, which can be collectively described as a modified Th2 and Treg response 20

39 (Babu et al. 2006; Anuradha et al. 2014). Chronically infected patients who are Mf- with symptoms such as lymphedema or hydrocele tend to present with elevated IgE, IFN- γ, TNF-α, IL-17, IL-22, and IL-23. IL-10 and TGF-β, as well as other Treg cytokines are impaired (Babu et al. 2009). The upregulation of Th1 and Th17 and downregulation of Treg responses result in a strong pro-inflammatory response responsible for pathology. Filarial manipulation: immune evasion and modulation Human life has always involved parasites, and over the course of the mutual arms race between host and invader, filarial parasites have developed methods to evade detection and avoid retaliation from the host immune system. The last two decades of research have begun shedding light on some of these mechanisms, but we are still very much in the dark about how these large worms can flourish for many years within their hosts. Some of the methods so far identified include: altering antigen presentation, manipulating effector cell recruitment, and repelling direct attacks by the immune system to render the host more hospitable for filarial parasites (Hewitson et al. 2009; Schroeder et al. 2012). The tricks employed by filarial parasites vary by life stage, but many of these immunomodulatory mediators are proteins released via the excretory/secretory (E/S) pore (Hewitson et al. 2009; Bennuru et al. 2009; Moreno et al. 2010). Recent reports also suggest that micro RNAs (mirna) released via exosomes interact with and may manipulate host immune cells (Zamanian et al. 2015). Some of these proteins like Bma-MIF-1 mimic cytokines, such as macrophage migration inhibitory factor (MIF), and manipulate macrophages into becoming the antiinflammatory subtype (AAMΦ) that promote the parasite-induced Th2 response. Another 21

40 example is Bma-TGH-2, which mimics human transforming growth factor B (TGF-β) and dampens the immune response by altering lymphocyte and antigen-presenting cell activation and function. Bm-TGH-2 also promotes the expansion of suppressive T regulatory cells (Treg) and inhibits macrophage activation and dendritic cell (DC) maturation (Freitas & Pearce 2010). Parasites also secrete protease inhibitors known as serpins, known to interfere with antigen presentation and immune cell function recruitment. Bma-SPN-2 has been shown to inhibit cathepsin G and neutrophil elastase, two serine proteases released in neutrophil granulocytes that play an immunostimulatory role that would promote parasite clearance (Zang et al. 1999). Similarly, several cysteine protease inhibitors (cystatins), such as Bma-CPI-2 have been identified that inhibit cysteine proteases necessary for antigen presentation and processing by APC, reducing T cell priming. They also induce the production of IL-10 and inhibit T cell proliferation, downregulating the immune response (Schönemeyer et al. 2001). Apart from directly mimicking host cytokines, some parasite proteins are able to modify the immune response by virtue of bearing a phosphorylcholine (PC) glycoconjugate. This lipid component is able to influence the innate and adaptive immune response in several ways. ES-62 of Acanthochielonema vitae is the most studied PC-conjugated protein of filarial parasites, and several studies have shown that it is able to reduce the proliferation and activation of B and T cells and increase IL-10 production in the remaining B cells (Harnett & Harnett 1993; Harnett & Harnett 2006). Macrophages and DCs are also affected; exposure to ES-62 stifles pro-inflammatory Th1 cytokine expression and shifts it towards Th2 (Goodridge et al. 2001). A recent study has also shown that ES-62 interferes with the activation of the classical complement pathway by 22

41 binding to C-reactive protein (CRP), an inflammatory acute phase protein that is elevated in patients with chronic lesions such as lymphedema. ES-62 also depletes C4, the ratelimiting component required for activation of the pathway (Kulthum Ahmed et al. 2016). Beyond bending the immune response to accommodate them, filarial parasites can fend off attacks by host immune cells directly or indirectly. Glutathione peroxidases, superoxide dismutases, and thioredoxin peroxidases are cuticular proteins thought to protect parasites from reactive oxygen species (ROS), such as superoxide radicals, hydrogen peroxide, and nitric oxide (NO). During attack by macrophages, neutrophils, and eosinophils, these antioxidant proteins are able to detoxify damaging enzymes released by antigen-presenting cells, fending off parasite destruction (Henkle-Dührsen & Kampkötter 2001; Kunchithapautham et al. 2003; Hewitson et al. 2008). Known factors in the numerous interactions between parasites and the host immune response are shown below, illustrating the complexity of these infections. Figure 1.6: Regulation of immune responses in filarial infections (Babu & Nutman 2014) 23

42 Canine heartworm Dirofilaria immitis is known colloquially as heartworm and infects dogs, cats, and other wild canids. The first written description of heartworm is from 1626, when it was found during the necropsy of a greyhound (Birago 1626). Joseph Leidy was the first to describe the worm as a distinct species in 1847, having found adults in a dog from Alabama (Bowman & Atkins 2009). He is also responsible for its scientific name, which translates to cruel thread. Like other filarial parasites, heartworm requires an arthropod vector, specifically the mosquito. More than 60 species have been shown to be competent vectors, but those most commonly associated with infection include those from the genera Anopheles, Culex, and Aedes (Ludlam et al. 1970). A dog becomes infected by L3 that are deposited by an infected mosquito during a blood meal. After crawling into the bite wound, L3 burrow under the skin and molt into L4 before migrating to the muscles of the chest and abdomen, becoming L5 (immature adults). L5 mature for 2-6 weeks before entering the bloodstream and being carried through the heart to the pulmonary artery. Adults continue growing in the pulmonary artery over the next 3-4 months before they begin mating. Females begin releasing unsheathed Mf 7-9 months after infection. Adults can live for 5-10 years, producing 300 µm long, unsheathed Mf for up to 7.5 years (Kotani & Powers 1982). 24

43 Figure 1.7: The life cycle D. immitis, the causative agent of canine heartworm Adult females reach cm, while males are significantly smaller at cm in length. Like the Mf of Brugia and Wuchereria spp., D. immitis Mf circulate in the bloodstream and can survive for up to two years waiting to be taken up by a competent mosquito to continue transmission. They also display periodicity, and can generally be considered nocturnally subperiodic, but this is variable from region to region. While the transmission efficiency of heartworm is low like LF, dogs are highly susceptible to infection, and virtually all exposed to L3 will become infected. Heartworm is a cosmopolitan parasite and is found worldwide, but tends to concentrate in warmer areas. It is considered to be the most important veterinary parasite in the United States. D. immitis was primarily concentrated in the southeastern states, especially along the Mississippi River Delta, but has spread across the country over the last half century likely due to many factors acting in concert (Bowman & Atkins 2009). 25

44 Pets are now more likely to encounter an infected mosquito as Americans now travel further and take dogs with them on vacation and other activities. Mosquito populations have increased following the discontinuation of widespread pesticide usage and rapid suburban development. The introduction of invasive Aedes albopictus in the mid-1980s is also thought to have contributed to the establishment of endemicity (McCall et al. 2008). More dogs are at risk now than 100 years ago (Bowman & Atkins 2009) as the range of D. immitis increases (Simón et al. 2009), no doubt helped by the mosquito-friendly effects of climate change. Pathophysiology of heartworm D. immitis is also a carrier of Wolbachia, and the release of bacterial products is believed to contribute to the pathogenesis much like in LF. The signs associated with heartworm disease are related to the presence of the worm in the pulmonary arteries, heart, and lungs. Heartworm disease can be considered a spectrum, ranging from acute cases with few or no clinical signs to those that are severe and potentially fatal (American Heartworm Society 2014). Most of the dogs that have heartworm infections will have no signs, but the presentation and severity of symptoms is dependent upon the length and intensity of infection as well as the individual dog. Dogs commonly present with lethargy, exercise intolerance, coughing, and congestive heart failure in advanced cases. Syncope (fainting) and weight loss may also be present. Lesions develop as adult worms grow in the pulmonary arteries and disrupt the endothelial cell junctions, causing damage to the intimal surface (inner lining) of the artery. These changes occur very quickly following the establishment of worms, and this damage attracts macrophages and 26

45 granulocytes as well as vascular smooth muscle cells (VSMC). Together, these cells form vascular lesions which cause vessels to thicken. Over time, vessel damage, particularly in the small peripheral branches of the pulmonary artery obstruct blood flow and causes pulmonary hypertension. To compensate for the increased pressure, right ventricular hypertrophy may develop. If left unaddressed, the right ventricle may be unable to sustain enough pressure to push blood through the lungs, resulting in congestive heart failure (CHF); up to 50% of dogs with severe pulmonary vascular complications will develop heart failure (Calvert et al. 1999). When worms die, they can break away and form thromboemboli, adding to the burden of disease by blocking blood flow into small vessels of the lung, prompting coagulation and reduced lung function. Reduced vascular and pulmonary integrity often manifest together as exercise intolerance and coughing. In natural infections, dogs tend to acquire more worms as time goes on, contributing to the greater amount of disease seen in older dogs. Small dogs may be able to tolerate a few worms before disease becomes severe, while larger dogs may harbor the same number of worms and suffer no ill health. Some dogs may harbor occult infections, in which no Mf can be found. This can be due to several reasons, including single-sex infections and immune or drug-mediated clearance of Mf (Bowman & Mannella 2011). Heartworm infection can be diagnosed following the six month prepatent period via antigen testing specific for female worms. These tests are used prior to and in conjunction with preventative chemotherapy, to determine infection status and ascertain efficacy. Recent reports of dogs infected despite negative antigen tests have resulted in some veterinarians reverting to classical heat tests to directly identify Mf in the blood (Velasquez et al. 2014). 27

46 Control of heartworm Heartworm is largely controlled through preventative chemotherapy. Preventives belong to the class of drugs known as macrocyclic lactones (ML), which include ivermectin, moxidectin, selamectin, and milbemycin oxime. The collective goal of preventative chemotherapy is to prevent further infection, reduce the number of circulating Mf, and kill larval stages (L3, L4) not yet susceptible to adulticide therapy. ML drugs prevent the establishment of new infections by killing L3 and L4 that have developed in the past 2 months. Current guidelines set by the American Heartworm Society (AHS) recommend preventative therapy year-round, starting as early as possible, normally around 8 weeks of age. Numerous products are available and are composed of several ML drugs alone or in combination with other drug classes to treat other endo- and ectoparasites, including intestinal helminths and ticks. Adult heartworm infection treatment is available through the use of an organoarsenic compound, melarsomine, which has recently been genericized. Current AHS treatment guidelines call for treating the infected dog with doxycycline and ML drugs before beginning adulticidal treatment. Danger arises from potential thromboembolization of dead worms causing fatal vascular blockage. Spacing out injections lessens the potential for this to occur, but strict exercise restriction is recommended for added safety. Following recovery, dogs are often started on a regular preventative regimen to prevent a new infection and clear any remaining Mf. Macrocyclic lactone-resistant heartworm Reports of dogs acquiring heartworm infections despite the use of preventives have been increasing in the last decade despite the complete efficacy provided by ML 28

47 drugs (Hampshire 2005). Our research group and others (Pulaski et al. 2014; Bourguinat et al. 2015) have collected and passaged some of these isolates for laboratory use. Many of these cases of lack of efficacy (LOE) are thought to be the result of poor owner compliance or inconsistent treatment history. Genetic evidence of ML-resistant D. immitis has been presented and published (Bourguinat, Keller, Blagburn, et al. 2011; Geary et al. 2011) and has linked drug insensitivity seen in vitro with genotypic traits (Bourguinat, Keller, Bhan, et al. 2011). Here at the University of Georgia, we have three ML-resistant strains: JYD, Yazoo, and Metairie, as well as MP3, which is considered less susceptible than the susceptible Missouri 2005 strain. The ML status of the JYD and MP3 strains has been demonstrated in controlled efficacy studies. Until recently, resistance had not been considered a likely problem for heartworm based on the long generation time, an ample untreated population of dogs and coyotes, and the apparent efficacy and prolonged successful use of MLs for human filarial infections (Prichard 2005). However, ML-resistant heartworm populations have been identified and are circulating in the Southeastern United States. Our research group has characterized the motility of these D. immitis strains and developed a system to quantify nematode motility (Storey et al. 2014). The health and economic impact of heartworm disease The prevention and treatment of heartworm is not subsidized or orchestrated by nonprofit agencies; this responsibility lies with pet owners and veterinarians. This makes the collection of data on the impact of treatment difficult to collect. Given the paucity of health statistics, economic data may be the best way to attempt to measure the importance 29

48 of heartworm control. Americans are the biggest spenders in the global pet healthcare market, with $15.95 billion spent on veterinary care in 2016 (APPA 2016). There are an estimated 89.7 million dogs owned in the U.S. (APPA 2016), and conservative estimates place current spending on heartworm prevention and treatment at more than $500 million per year. Americans are willing to spend to keep their pets well, and the market potential for novel heartworm preventatives may aid in defraying the cost of developing new drugs that could also be used by humans (Godel et al. 2012). The ability to maintain natural infections of this filarial parasite in the laboratory makes it an important complement to our studies in B. malayi. Furthermore, the maintenance of D. immitis strains irrefutably resistant to ML drugs provide us a model in which to examine the effects of our current anthelmintic drugs and novel compounds that could be developed into new drugs to prevent and treat filarial infections. RNA sequencing as an approach to better understand anthelmintic mechanisms of action Given that we are unable to replicate the efficacy of anthelmintics in vitro, we have opted to study the effects of drug treatment on worms in vivo using gerbils infected with B. malayi. This is carried out by RNA sequencing (RNAseq) of these parasites, with this method measuring the transcription of RNA species at specific points in time and allowing us to compare them under different conditions. RNAseq has been swiftly adopted for studying the development of filarial nematodes (Choi et al. 2011) and has been used to examine the effect of IVM treatment on B. malayi in vitro (Ballesteros et al. 2016b). This study is the first transcriptomic analysis of B. malayi treated with one of 30

49 three drugs used in human MDA drugs in vivo, and has enabled us to identify parasite genes altered by drug treatment. Conclusion While these anthelmintics have helped curb filarial diseases, we possess a limited understanding of how they work against filarial parasites. The immediate and nearly miraculous initial efficacy of modern anthelmintics may have lulled researchers into a false sense of security and fostered widespread resistance in livestock parasites (Kaplan 2004) and the emergence of ML-resistant D. immitis (Pulaski et al. 2014). Our laboratory is fortunate to have unparalleled access to multiple models of filarial infections and the ability to treat and collect large numbers of parasites to conduct in-depth transcriptomic studies. In this study, we have utilized the in vivo treatment of B. malayi in gerbils to examine drug-induced differential gene expression in parasites to better understand how our limited anthelmintic arsenal for LF combats these infections. 31

50 CHAPTER 2: MATERIALS AND METHODS Drug preparation 10 mm stock solutions of IVM were prepared in propylene glycol (PG) and diluted in Roswell Park Memorial Institute media (RPMI L-glutamine, Life Technologies, Grand Island, NY) and 1% penicillin-streptomycin (P/S, 10,000 U/ml; Life Technologies, Grand Island, NY ) to create working solutions of 2 nm, 0.02 µm, 0.2 µm, 2 µm, 4 µm, 12 µm, 20 µm, 40 µm, and 100 µm. Negative controls with 2% PG (v/v) in RPMI + P/S were also prepared. Working solutions were dispensed into 0.5 ml microcentrifuge tubes, with Mf/L3 added in equal volume for final concentrations of 1 nm, 0.01 µm, 0.1 µm, 1 µm, 2 µm, 6 µm, 10 µm, 20 µm, and 50 µm, with 1% (v/v) PG controls. Worminator assays After washing, the liquid volume containing the Mf of B. malayi or D. immitis was adjusted to a final concentration of 4 Mf/µl. 100 µl of RPMI containing Mf was added to a microcentrifuge tube containing an equal volume of drug or control solution. Tubes were briefly vortexed on medium speed (5.5), and then 50 µl was pipetted in triplicate into 384- well plates (NUNC black with optically clear bottom, Thermo Fisher Scientific, Rochester NY, USA catalog# ) for 100 Mf/well at each concentration of drug. Wells surrounding those containing microfilariae and drug were filled with 50 µl 32

51 RPMI 1640 containing 1% Pen/Strep to reduce evaporation during incubation. Plates were kept in a 37 C incubator with 5% CO2 for 24 hours and then read using the Worminator system at 4X magnification, scanning each well for approximately 30 seconds. This assay format was developed for use with the Worminator system as described in Storey et al. (2014). In vivo drug preparation Master stocks of ALB and IVM were prepared in 100% dimethyl sulfoxide (DMSO) and diluted in sterile Hank s Buffered Salt Solution (HBSS, Life Technologies, Grand Island, NY). The final concentration of DMSO in each drug solution was less than 0.001%. Diethylcarbamazine was prepared directly in HBSS. Drug solutions were prepared so that the final volume of solution administered to each gerbil did not exceed 250 µl. Gerbil infection and treatment Adult male gerbils (Meriones unguiculatus) were injected intraperitoneally with 300 Brugia malayi infective third-stage larvae (L3). Gerbils were maintained by the Filariasis Research Reagent Resource Center (FR3) while infections became patent (minimum of 90 days) before they were treated. Gerbils were separated into one of four treatment groups: IVM, ALB, DEC, and control, which was left untreated. Each gerbil was weighed to calculate the exact required dose prior to subcutaneous drug administration. Twenty-four hours after treatment, half of the gerbils from each group (3) were euthanized by exposure to CO2 for parasite collection. The other half of the gerbils 33

52 were euthanized seven days after drug treatment. This experiment was repeated in triplicate, utilizing 72 gerbils. Media preparation RPMI L-glutamine was supplemented with P/S for a concentration of 100 U/ml, and gentamicin (10 mg/ml; Sigma, St. Louis, MO) for a concentration of 0.1 mg/ml. Medium was aliquoted into 50 ml Falcon tubes (Becton Dickinson, Franklin Lakes, NJ) and stored at 4 C. Earle s Balanced Salt solution (EBSS) was prepared as a 10x solution and diluted 1:9 for parasite collection. EBSS was chosen as the collection media because it does not contain phosphates and, as such, could be used to exsheath Mf with calcium chloride without forming calcium phosphate deposits that would occur in other types of media such as HBSS or RPMI. Parasite extraction and purification After euthanasia, gerbil abdomens were shaved before dissection. The peritoneal cavity was opened with a scalpel to allow collection of adult parasites with tweezers. Mf were collected via peritoneal lavage with EBSS. After collecting worms from the peritoneal cavity, the abdominal cavity and testes were also examined for additional adult parasites. Upon retrieval, adult parasites were placed in 90 mm petri dishes in EBSS before being counted by sex and washed twice more. Mf were placed in 50 ml conical flasks, and the flasks were filled to capacity before Mf were counted. They were then centrifuged at 2500 RPM for 10 minutes. This process was carried out twice more for three washes. Half of the Mf from each treatment group were exsheathed with calcium 34

53 chloride. Twenty millimoles (20 mm) of calcium chloride was added to a tube containing Mf in EBSS, shaken, and incubated at 37 C for 30 minutes as described by (Devaney & Howells 1979). After the final washing, adults (by sex, treatment group) and ~250,000 Mf were placed in a 1.5 ml microcentrifuge tube with 1 ml of RNAlater (Sigma-Aldrich, St. Louis, MO) and incubated at 4 C overnight before being transferred to -80 C, per manufacturer s instruction. RNA extraction All surfaces (including gloves) and pipettes used for RNA extraction were treated with RNase AWAY (Life Technologies, Grand Island, NY). Tubes were diethylpyrocarbonate (DEPC; Sigma, St. Louis, MO) treated to inhibit RNase. All water used in the process was nuclease free. RNA was extracted from frozen B. malayi adults and Mf, which had been exposed to ALB, IVM, or DEC for either 24 hours or 7 days. Sample preparation for adults was carried out with several similar, but slightly varied methods. The majority of samples were obtained using the RNeasy Plant Mini Kit (Qiagen, Germantown, MD). Lysis buffer RLT with 10 µl β-mercaptoethanol per ml was added to the frozen sample for homogenization with a mortar and pestle. Liquid nitrogen was added to the sample to re-freeze it and aid in tissue disruption. After crushing with liquid nitrogen twice, the sample was aliquoted into DEPC-treated tubes to which additional lysis buffer was added. A 25 g needle (Becton Dickinson, Franklin Lakes, NJ) was used to further homogenize tissue, which was drawn up and expelled from the syringe 25 times. Lysed tissue was transferred into a QIAshredder spin column, and RNA was cleaned and eluted following kit instructions. Samples were also obtained using the 35

54 Direct-zol RNA Mini Prep Kit (Zymo Research, Irvine, CA). Samples were homogenized as described above using TRIzol Reagent (Life Technologies, Grand Island, NY) and aliquoted into multiple tubes before being centrifuged for 10 minutes at 12,000 x g to pellet the solid material. The supernatant was transferred to a new tube, and RNA was purified and eluted flowing the kit protocol. The LogSpin method developed by Yaffe et al. was also used, combining homogenization in TRIzol, and purification and washing with mini prep columns and sodium acetate and 75% ethanol (Yaffe et al. 2012). RNA extraction from Mf was mainly performed using a modified TRIzol protocol. 1.5 ml of TRIzol was added to one sample of ~500,000 frozen B. malayi Mf and homogenized using a mortar and pestle, with the sample repeatedly frozen and crushed with liquid nitrogen. Samples were aliquoted three times into 2 ml tubes with additional TRIzol added. A 25 g needle, followed by a 30 g needle (Becton Dickinson, Franklin Lakes, NJ) was used to further homogenize tissue, which was drawn up and expelled from the syringe 25 times. Tubes were centrifuged for 10 minutes at 12,000 x g to pellet solid material. The supernatant was added to a new tube and mixed with 0.2 ml of chloroform (Sigma, St. Louis, MO), and shaken for thirty seconds. After a threeminute incubation at room temperature, the samples were centrifuged again for 15 minutes under the same specifications. The aqueous layer was added to an RNA Clean and Concentrator spin column (Zymo Research, Irvine, CA), and the procedure was completed as per product instructions. RNA samples eluted in nuclease free water were analyzed on a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Pittsburgh, PA) to determine their concentration and to measure the 260/280 absorbance ratio. Samples with a 260/280 36

55 ratio above 1.75 were sent to the Georgia Genomics Facility (GGF; Athens, GA) for integrity analysis on an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) using an RNA 6000 Nano chip. RNA Sequencing (RNAseq) Good quality total RNA (1-100 µg) was submitted to GGF for library preparation and sequencing. Libraries for male, female, and Mf were created by pooling samples with TruSeq LT RNA Sample Preparation Kits (Illumina, San Diego, CA). 150 bp paired-end sequencing was carried out for each library on the Illumina NexSeq platform. The output from these runs, totaling Gb, was uploaded to BaseSpace in preparation for bioinformatic analysis. RNAseq analysis Illumina NextSeq raw data (paired end 150) were demultiplexed and converted to fastqc using bcl2fastq from Illumina. Bioinformatics analyses was carried out by the UGA Quantitative Biology Consulting Group as follows. Raw read data was quality assessed using FastQC (Andrews 2010), and residual adapter and quality trimming was done with Trimmomatic software (Bolger et al. 2014). The minimum read length cutoff was 50 bases, and all trimmed samples were reassessed with FastQC. Average sample quality was typically above QC 30, indicating that reads were of good quality. Average loss of data after trimming was typically between 5-10%. Only surviving paired reads were used in subsequent alignments to reference genomes. The Brugia malayi genome (build WS253) and the Wolbachia endosymbiont (strain TRS) reference genomes and 37

56 GFF3 files were downloaded from Wormbase at ftp://ftp.wormbase.org/pub/wormbase/releases/ws253/species/b_malayi/prjna10729/ and from NCBI at ftp://ftp.ncbi.nlm.nih.gov/genomes/archive/old_refseq/bacteria/wolbachia_endosymbion t_trs_of_brugia_malayi_uid58107/, respectively. Bowtie2 (Langmead & Salzberg 2012) indices were constructed for both genomes using bowtie2-build (ver ). The B. malayi GFF3 file was converted to GTF format using Cufflinks (Trapnell et al. 2010) gffread script followed by file sorting with Integrated Genomics Viewer (IGV) software (Robinson et al. 2011). Each sample was mapped to the B. malayi genome using Tophat2 (ver ) (Kim et al. 2013). Mapping resulted in a typical concordant pair alignment of > 90%. Several libraries were aligned to the Wolbachia genome using Tophat2 with the same settings as with B. malayi. The concordant pair alignment rate was less than 0.1% for all samples tested. Due to the extremely low percentage of potential contaminating reads, some of which may be due to highly conserved genes, no further filtering was employed. Custom Perl scripts were used to: i) generate run scripts for name sorting each BAM file with SAMtools (Li et al. 2009), and ii) generate scripts for count extraction using HTSeq (Anders et al. 2015). Text files containing count information for each sample were concatenated with awk to generate the count matrices for each comparison grouping used in subsequent expression analyses. DESeq2 was used for analysis of differentially expressed genes (Love et al. 2014). For each comparison group, a meta data table was generated containing relevant sample and replicate associations. A secondary (batch) analysis column was included to account for the differences in replicate sample collection times within each group. 38

57 Regularized logarithm (rlog) transformation of raw count matrices was used for quality assessment and visualization, i.e. principle component analysis (PCA) and Pearson correlation analyses of sample replicates within each comparative group. After filtering, output was imported into Microsoft Excel for further analysis. Differentially expressed genes were designated by their WormBase Gene ID numbers (ex. WBGene ) and were translated into their respective B. malayi gene names (ex. Bm3610) using WormBait. This program was designed specifically for this study by Christopher Anna and is freely available for download at This program uses the WormBase public RESTful API ( to collect various pieces of information about genes and proteins, such as orthologs, gene classes, and gene models, quickly compiling information and producing a CSV report with the collected information suitable for further review in Microsoft Excel. TaqMan primer and probe design Primers and probes were made for six target genes identified from transcriptome analysis. Genes were chosen based on treatment group and parasite life stage. Sequences from WormBase GeneIDs were used to design primers for selected differentially expressed gene hits using the GenScript Real-time PCR (TaqMan) primer design tool ( Design parameters were set to return primers and probes for amplicons between 50 and 150 bp, and the same ranges for minimum and maximum melting temperatures. Each primer set was designed to span an exon-exon junction on either side, preemptively preventing any contaminating gdna in each sample 39

58 from being amplified. Two endogenous housekeeping genes, NADH dehydrogenase subunit 1 (NADH) and histone H3, were chosen as internal controls. Control gene sequences were accessed through NCBI accession (symbol/locus tag) numbers and used to design primers. To ensure primer specificity, each primer set was entered into the NCBI Primer-BLAST program ( Primers were ordered from Eurofins MWG Operon (Huntsville, AL). The primer/probe sets for NADH1 and histone H3 were chosen based on their use as endogenous controls in earlier studies (Li et al. 2004; Lustigman et al. 2014).The primer set for NADH1 was not explicitly designed to span exons because it could not be manually defined due to discrepancies in gene naming conventions in WormBase and NCBI. The histone H3 probe was explicitly designed to span exons, based on the availability of the sequence on WormBase. Primer/probe sets for adults were designed based on differentially expressed genes compiled from the WS249 release of WormBase. With the release of the WS253 assembly, adult genes hits were compiled again alongside Mf gene hits. The updated release of WormBase assembly did not include three of the gene targets that primers had already been designed for, Bm3390, Bm5815, and Bm

59 Table 2.1: Primer sets used for qpcr GeneID/ Symbol Primer Set Sequence (5 to 3 ) Product size Bm7847 F AACGACAACCTCGTCAAACA 69 bp R TCCGCCTAATTTAACGTCATC Probe (FAM)-CACGCATGAGCCATTCAATCGA- (BHQ) Bm6220 F TGATGTTGACTGTCGCAGAA 142 bp R AGTTTCACCGTCGATCCTTC Probe (FAM)-CCGTGTACCGGGTACATCAGTCGA- (BHQ) Bm1750 F ACAGGATGCTAAAGAACATGCAGTAGA 108 bp R GCGACATCCGCATTTGTCTGA Probe (FAM)- TCGCTGGTTGAACCACCTGCTGCCGA-(BHQ) Bm4783 F ACCAACAGGGCCTACTAACATCAC 79 bp R GGCAACGTAGCTGCGATAGG Probe (FAM)-CGGTTAGCAACTTCCGCCAGCTGCT GC-(BHQ) Bm4605 F CCAGATGAACCACTTCAACG 62 bp R GGTCCTTGTGGTCCTTGTTC Probe (FAM)-TCCTGGTTCGCCCGGAGC-(BHQ) Bm3390 F GTTAATGCGTAGCCGAGACC 88 bp R ACGTTGTAACGCTGCTTGTC Probe (FAM)-CCCGGAATACCCTGAAGATTCCG- (BHQ) Bm5185 F ATTCAAATCATCCAATCCCAA 78 bp R TGCCACCTTTACTACCTCCA Probe (FAM)-CACCGCGCACTGATGGTGAC-(BHQ) Bm4155 F CGTCGGTTAACACGCAAAGGTAAA 108 bp R AACTTCTGCCTCAGATTGACTTGC Probe (FAM)-ACGTCGTCGCTCAACGGCTACCACG G-(BHQ) Bm4360 F TTCAAGCGAGAAGGTGCGGAT 127 bp R TGATGTCGTTGATACGCATCGGA Probe (FAM)-ACAAGCTGGCGCTACGCGACGCT- (BHQ) Bm1_50575 F TGGTACAAACCATCCCTCAA 68 bp NADH R CAAACAAAGTAAAGCCCAAAGA Probe (HEX)-TGCAGTTCTGTCCCTGTAGGCCA- (BHQ1) Bm1_49345 F AAATTGCAACGAATGTGTCC 140 bp (Bm12920) R ACGTTTCGCATGAATAGCAG Histone H3 Probe (HEX)-TTCCGCAGCTTCCTGTAGAGCTGA- (BHQ1) 41

60 PCR primer design Additional primer sets without probes were designed for three additional target genes. Sequences from WormBase were used to design primers with the NCBI Primer- BLAST program ( Each set was blasted against the B. malayi genome to ensure specificity. Table 2.2: Primer sequences for PCR GeneID/Symbol Primer Sequence (5 to 3 ) Product size Bm17689 Forward GGTAATGATGGTAGCGAGCTGA 246 bp Reverse AAGGGCTGCTTTTACTCCCA Bm1811 Forward ATTTGCAACCTGAACCACGC 946 bp Reverse AGTGCTACTGATCCTTTCAACCA Bm6109 Forward ATCGCCGCCAAATGGAAATG 313 bp Reverse TTTTTCCCGGCAAGAATGCG Reverse transcription of RNA to cdna RNA was reversed transcribed into cdna using qscript cdna Synthesis Kit (Quanta Bioscience, Gaithersburg, MD). Reactions were carried out in 0.2 ml thin-walled PCR tubes as follows: RNA (1µg to 10 pg total RNA) Nuclease-free water variable variable qscript Reaction Mix (5X) 4 µl qscript RT (25 U/ml) 1 µl Total 20 µl Reactions were run on a T100 Thermal Cycler (Bio Rad, Hercules, CA) following the manufacturer s protocol with the following conditions: C, 5 minutes 42

61 2. 42 C, 30 minutes C, 5 minutes 4. 4 C, hold PCR cdna was used to perform PCR using GoTaq Hot Start Green Master Mix (Promega, Madison, WI). Reaction components were combined in a 0.2 ml thin-walled PCR tubes as follows: GoTaq Hot Start Green Master Mix 2x 12.5 µl Forward primer, 10 µm 1 µl Reverse primer, 10 µm 1 µl DNA template <250 ng 1-5 µl Nuclease-free water variable Total 25 µl Reactions were run on a T100 Thermal Cycler (Bio Rad, Hercules, CA) following the manufacturer s protocol with the following conditions: 1. Initial Denaturation 95 C 5 min 2. Denaturation 95 C 30s 3. Annealing variable 30s 4. Extension 72 C 30s 5. Go to Step 2, 35 times 6. Final Extension 72 C 5 min 7. Hold 4 C 43

62 Adjustments to annealing temperatures were made to account for buffer composition altering primer melting temperature (Tm) using the BioMath Calculator ( Gel electrophoresis Samples were run on 2-3% (w/v) agarose gels based on expected product size. Gels were prepared by dissolving Certified Molecular Biology Agarose (Bio Rad, Hercules, CA) in 1x TAE buffer (National Diagnostics, Atlanta, GA). The solution was microwaved for approximately 1 minute and 20 seconds until all agarose granules had dissolved. Melted agarose was allowed to cool for several minutes before ethidium bromide (Sigma) was added to a final concentration of 0.05 µg/ml. This mixture was swirled several times before being poured into a gel tray with a comb in place. Gels were allowed to solidify for minutes before being placed in an electrophoresis tank filled with 1 x TAE buffer. Purple Loading Dye (6x) (New England Biolabs, Ipswich, MA) was added as needed to samples. Approximately 10 µl of sample, a 100 bp ladder (Promega, Madison, WI), and a low MW weight ladder (New England Biolabs, Ipswich, MA) were pipetted into the wells. Gels were run for one hour at 100 volts. After finishing electrophoresis, gels were visualized with a transilluminator (Syngene, Frederick, MD) using GeneSnap software v Samples that yielded a band with the correct amplicon size were used for qpcr. 44

63 Quantitative real-time PCR (qpcr) Quantitative real-time PCR was performed in 20 µl duplex reactions containing primer and probe sets for the target gene and histone H3 endogenous control were prepared in quadruplicate as follows: TaqMan Gene Expression Master Mix 1x 10 µl Forward histone primer, 10 µm 1 µl Reverse histone primer, 10 µm 1 µl Histone probe, 2.5 µm 2 µl Forward target primer, 10 µm 1 µl Reverse target primer, 10 µm 1 µl Target probe, 2.5 µm 2 µl cdna template 20 ng 1 µl Nuclease-free water 1 µl Total 20 µl Each reaction was run on an Mx3000P Thermocycler (Stratagene) using Mx3000 software v Fluorescence threshold data (Ct values) were collected for ROX (reference dye), HEX (histone probe), and FAM (target probe). Cycling conditions: C for 2 min C for 10 min C for 15 sec C for 1 min C for 1 min Go to step 2, 40 times 6. Go to step 3, 40 times 45

64 CHAPTER 3: RESULTS Development and validation of the Worminator system Programs designed to control parasitic nematodes rely on only a few drugs, which are now met with widespread resistance from veterinary parasites, with recent reports indicating that some of these drugs may also be losing efficacy in human patients (Osei- Atweneboana et al. 2011). Currently, researchers lack an objective and repeatable in vitro assay for multiple parasite genera at various life stages that would allow for the detection of resistance or the screening of novel anthelmintic compounds. To address this need we have developed the Worminator system, which objectively measures the motility of microscopic stages of parasitic nematodes on a quantitative scale. Motility reduction/alteration in response to drug treatment is the current standard for measuring anthelmintic efficacy. Our system is built around the computer application WormAssay, developed at the Center for Discovery and Innovation in Parasitic Diseases at the University of California, San Francisco. WormAssay was designed to assess motility of macroscopic parasites for the purpose of high throughput screening of potential anthelmintic compounds, utilizing high definition video as an input to assess motion of adult stage (macroscopic) parasites (B. malayi) (Marcellino et al. 2012). We modified this state-of-the-art assay system for use with microscopic parasites by modifying the software to support a full-frame analysis mode that applies the motion algorithm to the entire video frame, allowing the motility of all parasites in a given well to be recorded and measured simultaneously (Storey et al. 2014). The resulting motility 46

65 scores provide an objective measurement of drug-induced effects on motility. Resulting dose response curves for D. immitis and B. malayi Mf exposed to various MLs are shown in Figures 3.1 and 3.2. Figure 3.1: D. immitis Mf mean motility unit (mmu) and dose response curves for macrocyclic lactone class anthelmintics. Dashed vertical lines indicate IC50 values (Storey et al. 2014) 47

66 Figure 3.2: B. malayi Mf mean motility unit (mmu) and dose response curves for macrocyclic lactone (ML) class anthelmintics. Note differences in the moxidectin dissolved using DMSO as compared to moxidectin dissolved in PG. Dashed vertical lines indicate IC50 values (Storey et al. 2014) 48

67 Table 3.1: IC50 values for B. malayi and D. immitis Mf Species ML Time (hours) IC50 mmu (µm) IC50 %Δ (µm) D. immitis IVM D. immitis MOX D. immitis DOR B. malayi IVM B. malayi MOX (DMSO) B. malayi MOX (PG) B. malayi DOR Initial studies on the Worminator sought to determine the optimal conditions under which to carry out assays. We wanted to determine which MLs provided the most consistent results on a specific parasite life stage and the appropriate incubation periods to measure the effect of these drugs. A majority of these assays were carried out using the Mf of B. malayi and D. immitis, as they are readily available and require little preparation before being used in assays. Due to IVM being the chief ML of interest, it was used to determine the length of time ML assays were incubated (24 hours) to capture its effects on parasites in vitro. These experiments were performed three times in triplicate. Characterization of motility in C. elegans expressing nicotinic acetylcholine receptor subunits from parasitic nematodes The Worminator system has also been used to measure the motility of C. elegans, a nematode model organism that is often used to study parasitic nematodes. Levamisole is a nicotinic agonist that binds to the nicotinic acetylcholine receptors (nachrs) at the nematode neuromuscular junction, preventing neuromuscular function and causing parasite paralysis and death. C. elegans with null deletion mutations in the unc-29 or unc- 38 genes are resistant to levamisole and display locomotion defects (Brenner 1974; Lewis et al. 1980). Members of our lab were able to express the UNC-29 nachr subunits from A. suum and H. contortus in C. elegans mutants lacking either orthologous subunit to 49

68 study whether parasite nicotinic receptor subunits could rescue these phenotypes in C. elegans mutants (Sloan et al. 2015). Worminator assays were performed on C. elegans to quantify the motility of transgenic C. elegans strains expressing UNC-29 from H. contortus (HMC 29/8) and A. suum (ASC 29/3) and compare it to wild-type (N2) and null mutants (VC1944). As shown in Figure 3.3, adult HMC 29/8 worms were significantly more motile than the VC1944 strain used to express these subunits, while ASC 29/3 worms were not. Figure 3.3: Motility of C. elegans lines determined using the Worminator (n=5 independent experiments for each strain shown). All recordings were for 30 seconds at room temperature. (Sloan et al. 2015) 50

69 B. malayi and B. pahangi treated with emodepside Emodepside is a cyclooctadepsipeptide anthelmintic with broad-spectrum anthelmintic activity against all major clades of nematodes (Krücken et al. 2012). It is the only member of this drug class used commercially and is used in Europe as a component of deworming products for dogs and cats (Kulke et al. 2014). This drug acts via a different mechanism of action than other anthelmintics (Guest et al. 2007) and is able to paralyze adult filarial worms (Townson et al. 2005), prompting it to be considered for use against onchocerciasis (Crisford et al. 2015; Kuesel 2016). As shown in Figure 3.4, we have carried out Worminator assays with B. malayi and B. pahangi Mf treated with emodepside, demonstrating that this drug induces sustained paralysis in Brugia spp. Mf with nanomolar IC50 values (Table 3.2). Figure 3.4: B. malayi and B. pahangi Mf treated with emodepside. Plates were read on the Worminator system at 24, 48, and 72 hours after treatment. The above graphs represent three experiments performed in triplicate (Kulke et al., manuscript in preparation) 51

70 Table 3.2: IC 50 values for B. malayi & B. pahangi Mf treated with emodepside IC50 (nm) B. malayi B. pahangi 24 hours 102 ± 1.32 nm 28.1 ± 1.54 nm 48 hours ± 1.80 nm 19.1 ± 1.21 nm 72 hours 52.3 ± 1.35 nm 23.8 ± 1.27 nm 52

71 B. malayi Mf assayed with anthelmintics used in human MDA programs After demonstrating that the Worminator system is able to quantify the motility of microscopic parasites, we performed assays with B. malayi Mf treated with anthelmintics used in human MDA programs. As shown in Figure 3.5, Mf were alive and active at doses several orders of magnitude greater than those that kill parasites in vivo, indicated by the vertical dashed lines. IVM was the only drug for which an IC50 could be calculated (IC50= 6.0 ± 1.05 µm), and this was much higher than the maximum plasma concentrations reported following administrations of the doses used in MDA programs. Figure 3.5: Worminator assays for B. malayi Mf treated with ALB, its secondary metabolite ALB sulfoxide, DEC, or IVM in vitro. The above graphs represent three experiments performed in triplicate. 53

72 In vivo Brugia malayi drug treatment In order to examine the effects of ivermectin, albendazole, and diethylcarbamazine on parasites in vivo, parasites were recovered following drug treatment, parasite RNA was prepared, and transcript levels were measured via RNAseq. Following necropsy for parasite collection, B. malayi adult males, females, and Mf were separated and counted for each gerbil based on drug treatment time point. The total number of parasites per gerbil treatment group (three per drug per time point per experiment) is shown in Tables 3.3 and 3.4. Table 3.3: B. malayi adult collection Control (M/F) ALB (M/F) DEC (M/F) IVM (M/F) Round 1: 24 hours Round 1: 1 week Round 2: 24 hours Round 2: 1 week Round 3: 24 hours Round 3: 1 week Gender Total Experiment Total Table 3.4: B. malayi Mf collection (in millions) Control ALB DEC IVM Round 1: 24 hours Round 1: 1 week Round 2: 24 hours Round 2: 1 week Round 3: 24 hours Round 3: 1 week Experiment Total Grand Total 95.5 million Mf There was no significant difference in the number of parasites collected from any of the drug-treated gerbils compared to controls. This observation is in stark contrast to 54

73 human LF, wherein treatment with diethylcarbamazine and ivermectin quickly clear Mf from circulation, and females may be temporarily sterilized by ivermectin and albendazole. In addition, there was no significant difference in the numbers of males versus females recovered, regardless of treatment. An average of 68 adults and 1.3 million Mf were recovered from each gerbil. No dead or dying adults were observed during recovery. RNAseq sample preparation RNA sequencing allows researchers to examine transcript expression, and in order to obtain high quality reads for mapping and expression analysis, it is imperative that the RNA used for library preparation be of high quality. The quality of every RNA sample was measured on an Agilent 2100 Bioanalyzer at GGF. This machine and its corresponding software measure the ratio of the eukaryotic ribosomal 18s band to the 28s band based on their peaks to evaluate RNA integrity. Samples with a RIN (RNA Integrity Number) of 8/10 or higher, as shown in Figure 3.6, are considered to be sufficiently intact and appropriate for sequencing. Figure 3.6: Agilent 2100 Bioanalyzer report for B. malayi females Approximately 320 samples were submitted to GGF to assess RNA quality. This was due to many samples not reaching a RIN of at least 8. High quality Mf RNA was the 55

74 most difficult to produce, with 5.5 being the minimum RIN of a sample submitted for sequencing. Personal communications with another researcher who has performed RNAseq with Mf samples indicated that filarial samples, particularly Mf, often produce bad RIN scores but perform adequately in sequencing projects. It was therefore decided that samples with a RIN 7 would be suitable for adults and that the highest scoring Mf samples would be used. Over the course of repeated sample submissions, it was verified that the algorithm used to calculate RIN scores for eukaryotic samples was developed and optimized for human, mouse, and rat samples. This may explain why many samples received lower scores. Adult female and male samples were submitted for three separate sequencing runs (Tables ) containing a representative RNA sample from each experiment, time point, and treatment group. While compiling samples for sequencing, it became apparent that Mf samples from the first experiment at the 1 week time point were consistently low in quality and were not submitted for library preparation and sequencing (Table 3.7). 56

75 Table 3.5: Samples submitted for B. malayi female sequencing run Female Sample Name [Agilent] RIN Round 1 10 control females 24 hrs 3/6/ control females 24 hrs 4/21/15 Trizol +RNe control females 24 hrs 7/24/15 LogSpin ALB females 24 hrs 3/6/15 RNeasy ALB females 24 hrs EtOH 2 6/6/ ALB females 24 hrs 7/24/ DEC females 24 hrs 3/6/15 RNeasy DEC females 24 hrs 4/21/ DEC females 24 hrs 7/24/15 LogSpin IVM females 24 hrs 3/6/15 RNeasy IVM females 24 hrs #2 5/28/ IVM females 24 hrs 7/24/15 LogSpin control females 1 week 3/12/ control females 1 week 4/27/ control females 1 week 7/30/ ALB females 1 week 3/12/ ALB females 1 week 4/27/ ALB females 1 week 7/30/ DEC females 1 week 3/12/ DEC females 1 week 4/27/ DEC females 1 week 7/30/ IVM females 1 week 3/12/15 new RNeasy IVM females 1 week 4/27/ IVM females 1 week 7/30/

76 Table 3.6: Samples submitted for B. malayi male sequencing run Male Sample Name [Agilent] RIN Round 1 20 control males 24 hrs 3/6/ control males 24 hrs 5/11/ control males 24 hrs 7/24/ ALB males 24 hrs 3/6/ ALB males 24 hrs 5/11/ ALB males 24 hrs 7/24/15 LogSpin DEC males 24 hours 3/6/ DEC males 24 hrs #2 5/28/ DEC males 24 hrs 7/24/ IVM males 24 hrs 3/6/ IVM males 24 hrs Directzol #1 5/11/ IVM males 24 hrs 7/24/15 LogSpin control males 1 week 3/12/ control males 1 week 4/27/ control males 1 week 7/30/ ALB males 1 week 3/12/ ALB males 1 week 4/27/ ALB males 1 week 7/30/ DEC males 1 week 3/12/ DEC males 1 week 4/27/ DEC males 1 week 7/30/ IVM males 1 week #1 6/24/ IVM males 1 week #1 5/28/ IVM males 1 week 7/30/15 LogSpin

77 Table 3.7: Samples submitted for B. malayi Mf sequencing run Mf Sample Name description [Agilent] RIN Round 1 CON1 Control Mf 24 hrs 3/6/15 QIAshredder CON2 Control mf 24 hrs 4/21/ CON3 Control mf ex 24 hrs EconoSpin 7/24/ CON4 Control mf 1 week 4/28/15 C+C CON5 Control mf 1 week 7/30/15 C+C ALB1 ALB mf 24 hrs 3/6/15 # ALB2 ALB mf 24 hrs 4/21/15 # ALB3 ALB mf 24 hrs 7/24/15 EconoSpin ALB4 ALB mf 1 week 4/27/15 Trizol+RNeasy v #2 10 ALB5 ALB mf 1 week 7/30/15 C+C DEC1 DEC mf ex 24 hrs 3/6/15 C+C # DEC2 DEC mf 24 hrs 4/21/15 # DEC3 DEC mf 24 hrs 7/24/ DEC4 DEC mf 1 week 4/28/15 C+C # DEC5 DEC mf 1 week 7/30/15 C+C IVM1 IVM mf ex 24 hrs 3/6/ IVM2 IVM mf 24 hrs 4/21/15 # IVM3 IVM mf 24 hrs 7/25/15 Econospin IVM4 IVM mf 1 week 4/28/15 # IVM5 IVM mf 1 week C+C Transcript analysis A total of 1,116,826,802 total paired reads were covered, resulting in a collective x coverage of the B. malayi transcriptome and x coverage of the B. malayi genome. No contaminating mammalian sequences were identified. 80% or more of reads from each of the three sequencing runs mapped to the reference genome concordantly. Average overall mapping was 91.8% for adults and 82.9% for Mf. One hundred nineteen differentially expressed genes (DEG) were identified in adult males and females, and eighty-four were found in Mf (Table 3.8). Reads covered 98% or more of the WS253 and WS254 releases of the B. malayi genome alignment (Table 3.9). 11,590 transcripts were detected across the three sequencing runs, amounting to near complete coverage of all B. 59

78 malayi genes in each run when compared to the WS253 assembly. Each time point and life stage covered between 98.1% and 98.6% of this assembly, with the 7 day time points slightly lower than those for 24 hours. Coverage was slightly greater with the most recent alignment (WS254), with 99% or greater coverage from each run. Table 3.8: Sequencing data summary 819,917,610 Adult paired reads 296,909,192 Mf paired reads Adult Overall mapping: 94.4% Mf Overall mapping: 82.9% Adult Concordant mapping: 91.8% Mf Concordant mapping: 80.5% Adult DEG: 119 Mf DEG: 84 Table 3.9: Read coverage by sequencing run and B. malayi genome release Sample type/ time point Gene count % WS253 assembly covered % WS254 assembly covered Mf 24 hours 11, Mf 7 days 11, Males 24 hours 11, Males 7 days 11, Females 24 hours 11, Females 7 days 11, GeneID and ortholog matching The corresponding GeneID and annotation information for each DEG was fetched from WormBase ( using the WormBait program ( DEG were then grouped by drug treatment, gender, and life stage using Venny 2.1 ( (Oliveros 2007) to visualize their number and distribution. Of the 203 identified DEG, 189 were specific to a particular drug treatment and/or parasite life stage (Figure 3.7). DEG were further organized by gender and life stage according to drug treatment in order to identify any overlapping transcripts and highlight any differences or similarities in the number of genes expressed (Figures ). Orthologs, particularly in C. elegans, O. 60

79 volvulus, and Homo sapiens were identified from the WormBase page for a given GeneID. Gene ontology (GO) and pathway analysis was carried out with PANTHER (Mi et al. 2016) using C. elegans orthologs of B. malayi gene hits. Figure 3.7: Venn diagram generated with Venny 2.1 of differentially expressed genes organized by drug. 61

80 Figure 3.8: Differentially expressed genes in Mf 62

81 Figure 3.9: Differentially expressed genes in adults 63

82 Figure 3.10: Genes differentially expressed by IVM treatment by gender, life stage and time point 64

83 Figure 3.11: Genes differentially expressed by DEC treatment 65

84 Table 3.10: Summary of differentially expressed genes (DEG) ALB DEC IVM 24 hours 7 days 24 hours 7 days 24 hours 7 days Mf Mf Mf Mf Mf Mf Total DEG Downregulated DEG Upregulated DEG DEG with C. elegans ortholog DEG with GO terms*

85 Differentially expressed gene sequences Table 3.11: Differentially expressed genes in IVM-treated Mf at 24 hours 73 in total: 61 upregulated, 12 downregulated sequence Log2 fold change sequence Log2 fold change Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm

86 Table 3.12: Differentially expressed genes in IVM-treated males at 24 hours 14 in total, all downregulated sequence Log2 fold change sequence Log2 fold change Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Table 3.13: Differentially expressed genes in IVM-treated females at 7 days 25 in total: 12 upregulated, 13 downregulated sequence Log2 fold change sequence Log2 fold change Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Table 3.14: Differentially expressed genes in IVM-treated males at 7 days 15 in total: 12 upregulated, 3 downregulated sequence Log2 fold change sequence Log2 fold change Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm

87 Table 3.15: Differentially expressed genes in DEC-treated males at 24 hours 5 in total: 1 upregulated, 4 downregulated sequence Log2 fold change Bm Bm Bm Bm Bm Table 3.16: Differentially expressed genes in DEC-treated females at 7 days 54 in total: 1 upregulated, 4 downregulated sequence Log2 fold change sequence Log2 fold change Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm

88 Table 3.17: Differentially expressed genes in DEC-treated Mf at 7 days 10 in total: 1 upregulated, 9 downregulated sequence Log2 fold change Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Table 3.18: Differentially expressed genes in ALB-treated females at 7 days 6 in total: all downregulated sequence Log2 fold change Bm Bm Bm Bm Bm Bm

89 Gel electrophoresis of qpcr target transcripts Products of duplex reactions performed with treated samples were used to perform gel electrophoresis (Figure 3.12) to confirm product size. Ten microliters of each qpcr reaction product were run for 1 hour on a 3% agarose gel. Figure 3.12: Gel electrophoresis of qpcr products. The top band in each lane is the 140 bp band for the histone H3 control, and the lower band for each target gene corresponds to the amplicon of each primer set. Bm4360 has a 127 bp that merges with the 140 bp histone band, resulting in the thick single band seen in lane 8. Bm6220 has a 142 bp band that completely merges with the histone band, resulting in a single 140 bp band. 71

90 PCR results All three of these primer sets initially produced multiple products and/or products that were not the expected size. Bm17689 yielded a band of ~ 550 bp in addition to the 246 bp product (Figure 3.13, left). Putting the unspliced, rather than spliced transcript sequence for Bm17689 into the PRIMER-Blast program yielded a 555 bp product, explaining the larger band. This primer set is specific to Bm17689, but gives two bands corresponding to the spliced and unspliced gene products. Bm6109 yielded a band at 313 bp in addition to a brighter band of ~150 bp (Figure 3.13, left). Using the PRIMER-Blast program on both spliced and unspliced sequences yielded an alternative amplicon of 2297, but not 150 bp. Initially, the Bm1811 primer set gave a product roughly 240 bp in size rather than the expected 946 bp product (Figure 3.13, left); lengthening the extension time to 1 minute allowed the Bm1811 primer set to produce the 946 bp product (Figure 3.13, right). Figure 3.13: Gel electrophoresis of Bm6109, Bm1811, and Bm17689 PCR products 72

91 qpcr standard curves All primer/probe sets were performed with five-fold serial dilutions of Brugia cdna template to create standard curves and obtain amplification efficiencies to analyze changes in gene expression (Figure 3.14). The efficiencies of each set are summarized in Table 3.19 Figure 3.14: Amplification plot and standard curve of Bm4605 primer/probe set Table 3.19: Amplification efficiencies of qpcr targets B. malayi gene Amplification efficiency (%) R 2 Bm % Bm % Bm % Bm % Bm % Bm % Bm % Bm % Bm % Histone H %

92 qpcr In order to confirm the changes in gene expression identified by RNAseq, qpcr was performed on select target transcripts to compare gene expression between treated samples and time-matched controls. Target genes were chosen to represent both time points and all treatments in males, females, and Mf. The genome of B. malayi is A+T rich and contains many repetitive sequences (Scott & Ghedin 2009), which made designing primers difficult or impossible for some gene hits. In the case of Mf, the target genes chosen were the only ones from their respective treatment groups for which primers and probes could be readily designed. Table 3.20: Expression of qpcr target genes according to DESeq2 Bm4155 IVM Mf 24 hours ortholog of C. elegans cey-2 Bm4360 IVM Mf 24 hours ortholog of C. elegans dnj-13 Bm1750 DEC Mf 7 days ortholog of C. elegans hlh-1 Bm4783 DEC Mf 7 days ortholog of C. elegans fkh-9 Bm7847 IVM IVM 7 days Putative mrna splicing cofactor Bm7847 ALB ALB 7 days Bm5185 IVM 7 days (WS249) ortholog of O. volvulus OVOC6118 Bm6220 IVM 24 hours ortholog of C. elegans ttn-1 Bm3390 DEC 24 hours (WS249) ortholog of C. elegans ubql-1 Bm4605 IVM 7 days (WS249) ortholog of C. elegans col-119 and col-124 Twenty microliter duplex reactions containing the primer and probe sets for the target gene and histone H3 endogenous control were prepared in quadruplicate for treated and control cdna samples. Fold changes in gene expression were calculated using the delta-delta Ct (ΔΔCt) method (Livak & Schmittgen 2001) and are summarized in Table For all nine target genes tested, results from qpcr supported transcript fold change 74

93 predicted by bioinformatic analysis (Table 3.21). Representative graphs of qpcr results for up and downregulated genes are shown in Figures 3.15 and 3.16 Table 3.21: ΔΔCt values and fold changes of gene targets gene ΔΔCt Fold change: 2 -ΔΔCt Bm Bm Bm Bm Bm7847 IVM Bm7847 ALB Bm Bm Bm Bm Table 3.22: Fold change of qpcr target genes: comparison of results from RNAseq and qpcr gene Predicted fold change: 2 DESeqlog2 Actual fold change: 2 -ΔΔCt qpcr DESeq2 & qpcr agree? Bm Y Bm Y Bm Y Bm Y Bm7847 IVM Y Bm7847 ALB Y Bm Y Bm Y Bm Y Bm Y 75

94 Figure 3.15: qpcr curve of Bm7847 expression in IVM, ALB, and untreated females worms from the 7 day time point. The top set of curves demonstrates that Bm7847 expression in treated females is reduced compared to controls, with curves coming up in later cycles for treated samples. Figure 3.16: qpcr curve of Bm1750 expression in DEC-treated Mf and untreated Mf from the 7 day time point. The top set of curves demonstrates that Bm1750 expression in DEC-treated Mf is increased compared to controls, with a curve coming up in earlier for treated samples. 76

95 I identified nearly 200 genes whose expression is altered by in vivo treatment of Brugia malayi with ivermectin, diethylcarbamazine, or albendazole. One hundred thirteen (60%) of these altered genes were from ivermectin-treated parasites. Diethylcarbamazine produced sixty-one (32%) of the genes identified. Albendazole treatment yielded six differentially expressed genes, only one of which was exclusive to this treatment. Overall, there was very little overlap in differential gene expression between treatment groups, with only thirteen (6.3%) occurring in more than one treatment group. A majority of shared genes were found in genes dysregulated in females. One gene was identified in both adults and Mf, and one gene was shared by males and females. The exclusivity of these genes to a particular drug treatment bolsters confidence that they are indicative of specific drug effects rather than a generalized response caused by stress. In terms of the life stage most affected by treatment, females had the most differentially expressed genes followed by Mf. Males had the fewest genes dysregulated by drug treatment, but transcripts were affected in the IVM group at both 24 hours and seven days. This is in contrast to female hits only occurring at 7 days and those for Mf at 24 hours. Five genes were dysregulated in DEC-treated males at 24 hours, while transcripts were identified in females and Mf at 7 days. This was surprising, especially for Mf, given that DEC is known to rapidly reduce microfilaremia in vivo (Ottesen et al. 1997). IVM also quickly clears Mf, and 73 of the 84 genes dysregulated in Mf occurred in those exposed to IVM for 24 hours. Pharmacokinetic studies on the oral delivery of these drugs in humans has shown that the time it takes for the concentration of drug to peak in plasma (tmax) is 5 hours for IVM and 3 hours for DEC, and elimination half-life is 35 hours for IVM and 9 for DEC (González Canga et al. 2008; Shenoy et al. 2002). 77

96 While both of these drugs quickly reach their maximum concentrations, DEC is more rapidly eliminated. With regards to why females had no differential gene expression at 24 hours, it may be that both drugs had reached but not yet started to impact females, but were affecting the smaller males more quickly. Male parasites had the fewest genes dysregulated but were affected at both time points, suggesting that drug treatment is affecting them earlier than females. It should also be reiterated that despite each male RNA sample coming from 3-7 times the number of male worms compared to female samples, they had far fewer dysregulated genes than females. The majority of differentially expressed genes, regardless of treatment or life stage were upregulated by anthelmintic administration. Downregulated gene hits were all or nearly all of those identified in IVM males at 24 hours, DEC males at 24 hours, ALB females 7 at days, and DEC Mf at 7 days. The function and role of differentially expressed genes were compiled and mapped using PANTHER based on their corresponding C. elegans orthologs. Despite having the fewest gene hits overall, the most strongly upregulated and downregulated genes in this study were identified in male parasites treated with IVM. Dysregulation by drug treatment: PANTHER analysis Matching differentially expressed B. malayi genes to their orthologs in the more extensively annotated C. elegans allowed gene ontology (GO) analysis to identify biological processes, molecular functions, and cellular component information of gene hits to be collected and visualized using PANTHER (Figure 3.17). This program was also able to identify pathways overrepresented in a given collection of gene hits (Figure 3.17). 78

97 Figure 3.17: PANTHER pathway chart of DEG upregulated by IVM and overrepresented pathways Collectively examining transcripts in adults and Mf that were up or downregulated by IVM, six biological processes were shared: cellular component organization or biogenesis, cellular process, developmental process, localization, metabolic process, and multicellular organismal process. Six processes were only found in upregulated hits: biological adhesion, biological regulation, immune system process, locomotion, reproduction, and response to stimulus. Across all transcripts upregulated by IVM, products of genes involved in the endothelin signaling pathway were overrepresented based on Bma-AEX-5, Bma-GCY-9, and Bma-LIT-1 from 24 hours IVM-treated Mf. A similar pattern emerged in genes dysregulated by DEC, where there were five shared biological processes impacted: cellular process, developmental process, metabolic process, multicellular organismal process, and response to stimulus. There were an additional six biological processes only found in transcripts upregulated by DEC. These 79

98 processes were biological adhesion, biological regulation, cellular component organization or biogenesis, immune system process, localization, and reproduction. Among transcripts upregulated by DEC, those involved in the Wnt signaling and Alzheimer disease-presenilin pathway were overrepresented according to PANTHER. This group also had transcripts that overrepresented CDO (cell-adhesion-moleculerelated/downregulated by oncogenes) in myogenesis according to the REACTOME pathway database. This suggests that in the face of IVM and DEC, parasites are forced to increase the transcription of genes required to maintain structural integrity, cell signaling, and immune function to counter drug effects. IVM 24 hour Mf In Mf treated with IVM for 24 hours, 33 of the 35 upregulated transcripts had C. elegans orthologs that were recognized by PANTHER. These yielded 58 process hits related to biological function belonging to the following categories: biological adhesion, biological regulation, cellular component organization or biogenesis, cellular process, developmental process, immune system process, localization, locomotion, metabolic process, multicellular organismal process, and response to stimulus. Significant overrepresentation (p<0.05) of biological processes for chromosome segregation and metabolic process was identified in this group, as well as tubulin complex for cellular component, collectively suggesting that cellular division is impacted. All 7 transcripts downregulated in IVM-treated Mf at 24 hours were mapped, yielding 9 process hits related to cellular component organization or biogenesis, cellular process, and metabolic 80

99 process. In terms of molecular function, these genes are involved in binding, catalytic activity, and structural molecule activity. No overrepresented GO terms were identified. IVM 24 hour males The expression of all differentially expressed genes in IVM-treated males at 24 hours were downregulated, with 10/12 recognized by PANTHER. Thirteen biological process hits were identified, and are involved in cellular component organization or biogenesis, cellular process, developmental process, localization, and multicellular organismal process. Nicotinic acetylcholine receptor (nachr) signaling was the sole pathway identified. Cytokinesis and motor activity were overrepresented biological process and molecular function terms. Protein classes associated with these genes include cell adhesion, actin binding motor, cell junction and immunoglobin receptor superfamily binding. These findings corroborate IVM s ability to paralyze parasites, and suggests this drug exerts these effects by impeding the production of parasite components required for normal muscle function. IVM 7 day males Five transcripts were upregulated in male parasites treated with IVM at 7 days, resulting in 11 biological process hits related to biological adhesion, biological regulation, cellular component organization or biogenesis, cellular process, developmental process, immune system process, metabolic process, and multicellular organismal process. Four upregulated transcripts were orthologs of O. volvulus genes, three of which encode collagens (Bm7894, Bm9729, and Bm8043). 81

100 IVM 7 day females In IVM-treated females at 7 days, 11/12 differentially expressed genes yielded 24 hits relating to biological processes: cellular component organization or biogenesis, cellular process, developmental process, immune system process, localization, metabolic process, multicellular organismal process, reproduction, and response to stimulus. Developmental process was the only overrepresented biological GO term. Three of the thirteen downregulated IVM 7 day female transcripts have C. elegans orthologs. PANTHER was not able to map GO terms. GO information from WormBase was available for 4 of these 13 genes for one or more category. DEC 7 day Mf DEC-treated Mf at 7 days had 10 differentially expressed genes, 5 of which were mapped by PANTHER. Eleven biological process hits were identified involving cellular process, developmental process, metabolic process, multicellular organismal process, and response to stimulus. No GO terms were overrepresented. Bm1750 (Bma-HLH-1), a helix-loop-helix transcription factor was the only upregulated transcript at 7 days. This gene is associated with five biological processes: cellular component organization or biogenesis, cellular process, developmental process, metabolic process, and multicellular organismal process. PANTHER identifies binding as its sole molecular function, but WormBase GO terms collectively include protein dimerization, RNA polymerase II binding, and DNA binding for Bma-HLH-1 and C. elegans HLH-1. 82

101 DEC 24 hour males Bm8476, an ortholog of C. elegans cdh-1 (cadherin family) was the only upregulated transcript in DEC-treated males at 24 hours. Bma-CDH-1is involved in the developmental process, and according to WormBase, larval development, locomotion, and homophilic cell adhesion via plasma membrane molecules. The three remaining mappable transcripts were downregulated in males at this time point, and are involved in metabolic process. DEC 7 day females Forty-two transcripts were upregulated in DEC-treated females at 7 days. Of these, thirty-seven corresponded to mappable genes, yielding fifty-one biological process hits involved in biological adhesion, biological regulation, cellular component organization or biogenesis, cellular process, developmental process, immune system process, localization, metabolic process, multicellular organismal process, reproduction, and response to stimulus. Five biological processes were significantly overrepresented, including RNA metabolic process, regulation of transcription from RNA polymerase II promoter, and DNA-dependent transcription. Two pathways were overrepresented, Alzheimer disease-presenilin and Wnt signaling pathway. Chromatin/chromatin-binding and transcription factor proteins were overrepresented. All four downregulated transcripts belonged to genes that had cellular process as the sole biological process and are involved in binding and catalytic activity for molecular function. 83

102 CHAPTER 4: DISCUSSION Differentially expressed genes identified in previous studies: In order to compare differentially expressed gene hits in this study with those found previously, we compared our findings to those of previous genomic, transcriptomic, and proteomic studies of B. malayi genes. In the case of some studies, it has been nearly ten years since their publication and the genome alignment has been vastly improved and naming conventions have changed in that time. In total, approximately 30 of the differentially expressed genes identified in this study have been documented by others, in studies characterizing the development of B. malayi within the mosquito, its interaction with human tissues, and its secreted products. Tables 26 and 27 display some of the differentially expressed genes from the current study that have been identified elsewhere. Table 4.1: Differentially expressed genes identified from the secretome of B. malayi Bm2510 (thioredoxin, Bma-trx-1) Bm3610 (N-acetylglucosaminyltransferase) Bm6084 (nematode polyprotein allergen npa-1) Bm2632 (myosin regulatory light chain 1) Bm11186 (myosin heavy chain, Bma-myo-3) Bm5544 (actin, Bma-act-5) Bm2799 (Bma-pqn-22) The secretome of the filarial parasite, Brugia malayi: proteomic profile of adult excretory-secretory products (Hewitson et al., 2008) 84

103 Table 4.2: Differentially expressed genes identified as potential drug targets based on the C. elegans orthologs Gene Description Gene Description Bm1868 Bm1868 Bm3276 Bm3276, ortholog of C. elegans mig-10 Bm6240 Bma-mlt-8 Bm6109 Bma-mlt-11 Bm4482 Bma-vig-1, Hyaluronan/mRNA binding family protein Bm14333 Bm14333, chitin binding peritrophin-a domain containing protein, ortholog of C. elegans cpg- 1, cbd-1, cpg-2 Bm12511 Bm12511, RNA recognition motif containing protein Bm9729 Bm9729, cuticle collagen 2 precursor Bm2799 Bma-pqn-22 Bm5103 Bma-hlh-2 Bm4063 Bma-patr-1 Bm9676 Bma-cdt-1 Bm9021 Bm9021, nematode cuticle collagen N-terminal domain containing protein Bm1750 Bma-hlh-1 Bm2216 Bm2216 Bm2750 Bma-aff-1 Bm1770 Bma-unc-44 Bm4489 Bm4489 Bm9585 Bma-inx-14 Bm11366 Bma-anc-1 Mining predicted essential genes for Brugia malayi for nematode drug targets (Kumar et al., 2007) In contrast to previous transcriptomic studies: All previous transcriptomic studies of drug treatment on B. malayi have been carried out in vitro using adult females, and IVM has been the only anthelmintic studied. Given the hundreds of differentially expressed genes identified in the literature, one of the first differences of our study was having no female genes differentially expressed at 24 hours post-treatment for any of the treatment groups, compared to the many found by Ballesteros et al. (2016) in the presence and absence of IVM. Bm4605, Bm8043, Bm7894, and Bm9021 are four cuticle collagens whose expression was found to be upregulated by IVM treatment in males at 7 days. These findings are contrary to those of Ballesteros et al., who found that expression of these genes was downregulated in 85

104 females treated in vitro with IVM for five days (Ballesteros et al. 2016b). In their first study cultivating female parasites in vitro without IVM, these genes were upregulated, matching our results in vivo with theirs in vitro without drug treatment. My findings were also contrary for Bm5288, an ortholog of C. elegans NPP-21 (Nuclear Pore complex Protein) that was upregulated in DEC-treated females at 7 days rather than downregulated, as in their study. Bm5185 was upregulated by in vitro parasite cultivation, but in our study it was downregulated by IVM treatment in females at 7 days in the original WS249 assembly. Bm5185 was chosen for qpcr validation, and its expression was downregulated as predicted by DESeq2. Considering that there were no shared genes between males and females in our study, perhaps it is not surprising that the same genes in the opposite sex and/or different drug treatment in vitro is not in agreement with our results. There were several gene hits that did agree with those found by Ballesteros et al., but only two of them belonged to IVM-treated females. It should be noted that in their first study, Ballesteros et al. identified several hundred transcripts altered only by the maintenance of B. malayi females in vitro (Ballesteros et al. 2016a), which further complicates any comparisons between their in vitro and our in vivo data. Patterns of differential gene expression and putative transcript function In organizing the output from bioinformatic analysis, one of the first results to emerge was that differential gene expression did not occur in all parasites for a given drug treatment time point. We were not necessarily expecting this to occur, but how some transcripts clustered was surprising. The total absence of female differentially expressed genes transcripts in any treatment at 24 hours was also unexpected, given that a majority 86

105 of transcriptomic studies utilize female parasites and have been able to detect differential expression following shorter durations of drug exposure. There are no immediate explanations for why DEG manifested in male parasites before females, but this could be due to their size. B. malayi males are roughly one third of the length and one quarter the width of female parasites, resulting in a greater surface to volume ratio for drug exposure. This discrepancy in size may also result in differences in cuticle morphology or permeability that could also account for the more rapid onset of differential expression seen in males. While both IVM and DEC rapidly remove Mf in vivo, the 24-hour time point yielded transcripts in IVM-treated Mf but not in DEC-treated Mf. This is especially puzzling since males were affected at this time, but another consideration for this and other unforeseen patterns of transcript expression could be due to the gerbil model itself. The intraperitoneal (IP) infection model allows parasites to fully develop and reproduce, but it does not replicate the full range of host-parasite interactions on a tissue-specific or immunological level since parasites are contained to this compartment of the abdomen. In examining the gene ontology (GO) information for treatment-induced transcripts, very few molecular functions or biological processes were restricted by a single parameter. All six ALB transcripts occurred at 7 days, suggesting that this drug may take longer to affect parasites, and that a later endpoint may have resulted in more differentially expressed genes. Only one transcript was exclusive to ALB treatment, which shifted our focus to transcripts altered by IVM and DEC. Treatment with either drug resulted in several transcripts involved in molting, but those with a primary role in this process were restricted to IVM-treated parasites. Molting is the shedding of the old 87

106 cuticle and synthesis of a new one that allows nematodes to continue their growth and development into adulthood. The cuticle is an extracellular matrix composed of collagen secreted by the underlying epithelial cells (Frand et al. 2005). Transcripts encoding cuticular collagens were differentially expressed in IVM-treated male parasites at 7 days, suggesting that this drug damages the cuticle in addition to impacting molting. Other affected transcripts include those related to proteolysis, which is also an important part of molting and development. These transcripts were also focused in IVM-treated parasites, particularly in Mf. Cadherin expression was upregulated by treatment with DEC or IVM. In nematodes these proteins are involved in cell adhesion and development and the clustering of their upregulation at 7 days may indicate that drug treatment results in parasite damage by interfering with their ability to regulate cellular interactions internally or externally. Beyond these biological or molecular functions, other differentially expressed genes may play a role in protein modification, immune evasion, and transcriptional regulation based on their orthologs in other nematodes or humans when applicable. 88

107 Molting Table 4.3: B. malayi genes with orthologs involved in molting Gene Ortholog Treatment group Bma-mlt-8 C. elegans mlt-8 IVM males 7 days Bma-mlt-11 C. elegans mlt-11, H. sapiens TFPI IVM Mf 24 hours & IVM females 7 days Bm4699 C. elegans H42K12.3, paralog of IVM females 7 days Bma-noah-1 Bm4960 C. elegans tfg-1 DEC females 7 days Bma-cbp-1 C. elegans cbp-1 & cbp-2, H. sapiens DEC females 7 days CREBBP & EP300 Bma-ptr-4 C. elegans ptr-4 IVM Mf 24 hours Bma-let-19 C. elegans let-19 IVM Mf 24 hours Bma-anc-1 C. elegans anc-1 IVM Mf 24 hours Molting has been a key target of chemotherapeutic development against nematode parasites, as it is a widely conserved process in this phylum but does not occur in vertebrates. Over 150 genes have been identified as required for molting in C. elegans and mediate many facets of this process, from intracellular signaling to begin the process to extracellular execution carrying out the digestion and development of the new cuticle. RNAi knockdown of many of these genes produced defective or lethal phenotypes, further incentivizing molting as a prime drug target (Frand et al. 2005). Almost all of these genes have counterparts in B. malayi, and several of them have been identified as targets for anthelmintic drug development. In their study to predict gene targets in B. malayi based on their orthologous function in C. elegans, Kumar et al. found several molting targets that were also recognized in our current study. Bma-mlt-8 and Bma-mlt- 11 were among these genes, as was Bm4699, a paralog of their top-ranked drug target Bma-noah-1 (Kumar et al. 2007). 89

108 In C. elegans, the mlt (MoLTing defective) gene class is made up of eight members required for proper molting. MLT-8 is a membrane signaling protein and enzyme activator that aids in the synthesis of a new cuticle. Loss of function phenotypes suggest that mlt genes are responsible for regulating cuticle collagen processes such as formation, condensation, and degradation during molting (Frand et al. 2005). Expression of Bma-MLT-8 was upregulated in male parasites treated with IVM at 7 days in our studies. We observed only one transcript, Bma-MLT-11, that was differentially expressed in both adults and Mf. Expression was upregulated in IVM females at 7 days and in IVM Mf at 24 hours. In C. elegans, MLT-11 is a secreted protein required for proper molting and temporal regulation of proteolysis, preventing premature release of the old cuticle (Frand et al. 2005). Bma-mlt-11 encodes a Kunitz-type serine-peptidase inhibitor involved in nematode larval development, embryo development, and the molting cycle. This gene is an ortholog of H. sapiens tissue factor pathway inhibitor (TFPI, E value= 1.1e-32), which is responsible for preventing tissue-mediated coagulation. TFPI is found in vascular endothelial tissue and plasma, and inhibits activated Factor X and VIIa TF proteases in an auto-regulatory loop that tightly regulates the formation of blood clots. Several Kunitz-domain containing proteins from helminth parasites and arthropod vectors are known anti-coagulants (Ranasinghe & McManus 2013), lending credence to the premise that these Brugia proteins may play a role beyond molting. The fact that both parasite and host proteins are secreted could mean that this protein is important for parasite development and may act to impede coagulation, which could damage circulating Mf. TFPI has also been shown to inhibit endothelial cell migration and 90

109 adhesion in vitro, impeding angiogenesis (Provençal et al. 2008). This function may be beneficial for adult parasites by preventing cell transmigration that may damage them and cause inflammatory damage to lymphatic vessels. Bma-MLT-11 also shows some similarity to Fasciola hepatica Kunitz-type proteinase inhibitor (Fh-KTM, 100% coverage, 42% identity, E value= 3e-13), which is known to suppress pro-inflammatory cytokine production in DC, preventing their ability to initiate Th1 and Th17 responses, resulting in bystander suppression of immune responses that reduces hostility to parasites (Falcón et al. 2014). The expression of all DEG involved in molting were upregulated in adult parasites and occurred at 7 days. Four transcripts involved in molting were identified in IVM 24 hour Mf. Bma-MLT-11 and Bma-PTR-4 expression was upregulated, and Bma- LET-19 and Bma-ANC-1 expression was downregulated. Bma-ANC-1 (abnormal nuclear ANChorage) was the most downregulated transcript in IVM-treated Mf at 24 hours and the second most downregulated transcript in this study. As demonstrated in previous studies, molting is a prime target for drug intervention, and several transcripts involved in this process were dysregulated by drug treatment in this study. The functions of the secreted products of several of these genes may extend beyond parasite development into host interaction and immune evasion, further prioritizing them for exploitation in drug development. 91

110 Proteolysis Table 4.4: B. malayi genes with orthologs involved in proteolysis Gene Ortholog Treatment group Bma-mig -6 C. elegans mig-6 IVM Mf 24 hours Bm12975 C. elegans cpl-1 IVM Mf 24 hours Bma-aex -5 C. elegans aex-5, H. sapiens PCSK1 IVM Mf 24 hours Bma-lat-1 C. elegans lat-1, H. sapiens ADGRL2 DEC & IVM females 7 days All differentially expressed genes associated with proteolysis were upregulated by drug treatment. Bma-mig-6 (abnormal cell MIGration) expression was upregulated in IVM-treated Mf at 24 hours (third most upregulated transcript in IVM 24 hour Mf, eighth most upregulated transcript overall). In C. elegans, mig-6 is involved in multiple processes including larval development, reproduction, cuticle development, locomotion, proteolysis, and receptor-mediated endocytosis. The proteolytic role of secreted MIG-6 is likely exerted through its modulation of metallopeptidase function during development. The peptidase function of MIG-6 in C. elegans is not well understood, but homologs of this gene in parasitic nematodes are thought to play important roles in host invasion and defense from host immune response. In Dictyocaulus viviparus, the bovine lungworm, the MIG-6 homolog GP300 is a PC-conjugated glycoprotein that elicits a powerful immune response in calves (Kooyman et al. 2007). GP300 localizes to the cuticle and subcuticle, suggesting that it may protect parasites by inhibiting proteolytic damage by host digestive enzymes in vivo (Kooyman et al. 2009). Aligning Bma-MIG-6 and D. viviparus GP300 with BLASTp revealed 93% coverage and 59% identity between the proteins and an E value of 0, suggesting an orthologous role in B. malayi. 92

111 While investigating D. viviparus GP300 as a vaccine candidate, it was demonstrated that this protein cross-reacts with platelet-activating factor (PAF), possibly neutralizing it and downregulating inflammatory responses directed at the parasite (Kooyman et al. 2007). PAF is an inflammatory mediator produced by activated platelets, endothelial cells, granulocytes, monocytes, and macrophages that induces the aggregation of platelets and dilation of blood vessels. Many of the lesions characteristic of bovine lungworm infections, such as pulmonary edema, bronchoconstriction, and the influx of eosinophils are associated with PAF (Kooyman et al. 2007) and are similar to lesions in humans with TPE. Eosinophils are known producers of PAF and TF, promoting the coagulation cascade (Ames et al. 2011) and perpetuating the local immune response (Klion & Nutman 2004). Mf release of proteins that could inhibit clot formation and dampen inflammatory cell recruitment may contribute to how they prevent getting trapped and cleared from the bloodstream and/or damaged by innate immune cells. Bm12975 encodes a secreted cathepsin L-like cysteine protease precursor involved in proteolysis, nematode larval development, and locomotion. Bm12975 expression was upregulated in IVM-treated Mf at 24 hours. This gene is an ortholog of C. elegans cpl-1 (CathePsin L family), which is essential for nematode viability; RNAi knockdown of cpl-1 results in 100% embryonic lethality (Nomura et al. 2004). Bm12975 is also a paralog of Bma-cpl-1, a cathepsin L-like cysteine protease that plays an important role in modulating molting (Ford et al. 2009; Song et al. 2010). RNAi knockdown of Bma-cpl-1 in L3 reduces mosquito infection prevalence, suggesting that this and other cathepsins are important for establishing and maintaining infection (Zamanian et al. 2015). The importance of these proteases in promoting infection may 93

112 hinge on their regulation of parasite development, ensuring that parasites are in the right place at the right time in order to properly develop, reproduce, or be taken up by vectors. Bma-AEX-5 expression is also upregulated in IVM-treated Mf at 24 hours, and was one of the genes that is part of the endothelin signaling pathway overrepresented in genes upregulated by IVM. In C. elegans, AEX-5 [ABoc, EXpulsion (defecation) defective] is a proprotein convertase that affects anterior body contractions and the defecation cycle. AEX-5 is thought to exert its proteolytic function by cleaving neuropeptide precursors, activating them to become peptide hormones (Li & Kim 2014). Bma-aex-5 is an ortholog of human neuroendocrine convertase 1 (PCSK1/P1, E=7e-160), which cleaves proinsulin into its active form. PANTHER analysis identified Bma-AEX-5 as a homolog of furin, a subtilisin-like protease that can initiate the endothelin signaling pathway by cleaving pre-pro-endothelin 1-3, forming big endothelin intermediates that are further cleaved into physiologically active endothelin (ET-1,2,3) enzymes that activate downstream GPCRs to affect various physiological responses including vasoconstriction (Kedzierski & Yanagisawa 2001). ET-1 is secreted from the basal side of endothelial cells and is directed below to vascular smooth muscle cells (VSMC) (Wagner et al. 1992). Under normal conditions, the vasoconstrictive effect of ET-1 is checked by NO, producing vasodilation as the net effect of insulin. In cases of insulin resistance and hyperinsulinemia, insulin is unable to stimulate NO production but can still promote ET-1 expression and action. Without NO, vascular tone remains increased and vasodilation is impaired (Sarafidis & Bakris 2007). ET-1 is considered a proinflammatory cytokine, and is often elevated in LF patients with chronic lymphatic lesions (Debrah et al. 2009). If IVM does in fact work in concert with immune cells, 94

113 upregulating a product that could prevent vasodilation might also prevent the transmigration of immune cells in addition to blocking damaging ROS. In vitro, Mf inhibit transendothelial migration of neutrophils and monocytes (Schroeder et al. 2012). These findings were in agreement with an in vivo mouse model in which leukocyte infiltration of the peritoneal cavity was reduced in the presence of Mf alone compared to adults (MacDonald et al. 2003). Another in vivo mouse model examining adaptive inflammation demonstrated that ET-1 recruits neutrophils in an CXCL1-dependent manner (Zarpelon et al. 2012). Like Bma-NARS-1, ET-1 can influence immune cell migration and could exert different effects in filarial infections in vitro versus in vivo. It would be very interesting if both Mf and adults were able to manipulate the recruitment of immune cells and down-modulate the immune response via IL-8 signaling. The overrepresentation of Mf gene hits involved in human endothelin signaling warrants further study of this pathway in the context of filarial infections. Bma-LAT-1 (LATrophilin receptor) was the only proteolysis-related DEG identified in adults, and its expression was upregulated in both IVM and DEC-treated females at 7 days. This gene is an ortholog of C. elegans lat-1 and human adhesion G protein-coupled receptor L2 (latrophilin 2, ADGRL2, E value=6e-118) that encodes an adhesion GPCR. Like Bma-AEX-5, the proteolytic function of Bma-LAT-1 is to cleave and convert protein precursors into their active form. Bma-LAT-1 contains a GPCR autoproteolysis inducing (GAIN) domain, allowing it to cleave itself after ligand binding and travel from the ER to the plasma membrane to continue the GPCR signaling cascade. This receptor was named for its affinity to bind α-latrotoxin present in the venom of Latrodectus mactans (black widow) spiders. This toxin induces exhaustive (total) release 95

114 of neurotransmitters from nerve and endocrine cells in vertebrates and has been widely used to study how exocytosis is regulated (Ushkaryov et al. 2008). In C. elegans, LAT-1 is required for proper tissue polarity in embryos (Langenhan et al. 2009), sperm function (Pro mel et al. 2012), and controls neurotransmitter release in adults (Silva & Ushkaryov 2010). RNAi knockdown of LAT-1 results in several phenotypes, including worms that are constipated (Mee et al. 2004) with abnormal head, epithelial, and pharyngeal development (Langenhan et al. 2009), and slow growth and larval arrest in L1 (Langenhan et al. 2009). LAT-1 mutants are also resistant to the anthelmintic emodepside, exhibiting reduced inhibition of pharyngeal pumping compared to wild-type worms exposed to the drug (Willson et al. 2004). Upregulation of this GPCR in adult females may be due to IVM or DEC interfering with signal transduction; expression at 7 days could indicate that parasites are recovering from treatment and increasing LAT-1 expression to reorder signaling and affected downstream effects such as reproduction and embryo development. Interference with cell trafficking and exocytosis has been suggested as a possible mechanism of action for DEC, as treatment inhibited proteoglycan exocytosis and molecule transport in rat cells (Stevens et al. 1985). Could the upregulation of genes involved in proteolysis be detrimental for parasites by throwing off the tight regulation of signal transduction and developmental cues that govern successful transmission and establishment within their hosts? Does greater expression of proteolytic activators in the face of drug treatment make Mf more vulnerable to immune effectors? Moreno et al. (2010) demonstrated that IVM reduces E/S product release in Mf in vitro, so should the upregulation of E/S machinery and E/S products be considered compensatory or indicative of damage by transport blockage? 96

115 Cadherins: cell adhesion proteins and more Table 4.5: B. malayi gene hits with cadherin or cell-adhesion orthologs Gene Ortholog Treatment group Bma-hmp-1 C. elegans hmp-1, H. sapiens CTNNA1 DEC females 7 days & CTNNA2 Bma-afd-1 C. elegans afd-1, H. sapiens MLLT4 DEC females 7 days Bma-act-5 C. elegans act-5, H. sapiens ACTB DEC females 7 days Bma-hmr-1 C. elegans HMR-1a, H. sapiens DEC & IVM females 7 days CDH11 Bm6122 C. elegans Y52B11A.11, H. sapiens DEC & IVM females 7 days FAT1 Bm8476 C. elegans cdh-1, H. sapiens FAT4 DEC males 24 hours Cadherins are a superfamily of type-1 transmembrane proteins named for their calcium-dependent adhesive properties. They play important roles in cell adhesion, signaling, and organ development, and are conserved across vertebrates and invertebrates (Perez & Nelson 2004). These proteins are expressed in many tissue types and are divided into classical, protocadherin, desmosomal, and unconventional groups based upon structure. Four cadherin genes were identified in this study, all of which were upregulated in response to IVM and/or DEC treatment. Two of these transcripts overlapped between groups, and one was the sole upregulated transcript in IVM-treated males at 7 days. These findings are interesting from the perspective of both host and parasite, and may shed light on how these proteins are important for both parties in the context of LF. Given the location of these parasites in the host, many studies have sought to examine how they interact with and may modulate the cells with which they interact, particularly lymphatic endothelial cells (LEC) for adults and vascular endothelial cells (VEC) for Mf. These studies have been carried out in vitro with live parasites and their 97

116 secreted products co-cultured with these cell types. In their study examining the impact of parasite antigen exposure on LEC, Bennuru & Nutman (2009) found that the expression of many genes involved in cell adhesion were altered in human cells. Alpha-catenin (CTNNA1) expression in lymphatic LEC was strongly upregulated when exposed to either BmA (B. malayi adult antigen) or MfAg (Mf antigen) for 24, 48, or 72 hours. CTNNA2 expression was also upregulated compared to controls. The expression of the B. malayi ortholog of these genes, Bma-HMP-1, was upregulated in DEC-treated females at 7 days, and is a cadherin-related protein. Expression of MLLT4, which encodes afadin, was also upregulated in response to both adult and Mf antigen, increasing with time. Bma-AFD-1 expression was upregulated in DEC-treated females at 7 days and is part of the catenin complex that interacts with cadherin. Adult and Mf antigen also increased LEC expression of VE-cadherin (CDH5) starting 24 and 48 hours after exposure, respectively, with expression increasing with time. Interestingly, two LEC genes that were dysregulated by MfAg exposure had B. malayi orthologs that were also dysregulated by DEC treatment, but in the opposite direction. BCL11A (B-cell CLL/lymphoma 11A (zinc finger protein) expression was increased upon exposure to MfAg, but was decreased in DEC-treated Mf at 7 days. LEC actin beta (ACTB) expression was downregulated by MfAg (Bennuru & Nutman 2009), while Bma-ACT-5 expression was upregulated in DEC 7 day females. Collectively these findings demonstrate that filarial parasites alter the expression of host genes involved in cellular integrity and signal transduction. The current study shows that the expression of several of these same genes in parasites are altered by DEC, and that cellular adhesion proteins could be exploited in novel drug development. 98

117 The loss or downregulation of some cadherins and associated proteins is a marker of cancer metastasis and tumor invasion, reducing the strength of tissue cellular adhesion and rendering cell junctions more permeable. Interestingly, several studies searching for existing drugs that could be repurposed to fight cancer have identified IVM and the related macrocyclic lactone selamectin as promising targets. These drugs inhibited invasion in MDA-MB-231 breast adenocarcinoma cells and upregulated the expression of epithelial cadherin (E-cadherin) (Kwon et al. 2015). Inhibitors of arachidonic acid metabolism, a speculative mechanism of action for DEC, have also been shown to halt cancer metastasis. PC-3 and LNCaP prostate cancer cells treated with the lipoxygenase inhibitor zileuton had increased expression of E-cadherin, and treated mice had fewer tumors (Meng et al. 2013). Celexicob is a cyclooxygenase 2 (COX-2) inhibitor that when administered to pre-operative gastric cancer patients increased E-cadherin expression and decreased VEGF expression, suggesting that this drug inhibits angiogenesis and suppresses gastric cancer invasion (Zhou et al. 2007). Celexicob also binds to and inhibits cadherin-11 (CDH11), a cadherin marker upregulated in several types of cancer stem cells. CDH11 induces VEGF-D expression via cell contact in fibroblasts, promoting lymphangiogenesis (Orlandini & Oliviero 2001), and CDH11 upregulation with concomitant E-cadherin downregulation has been associated with tumor cell metastasis and invasion (Assefnia et al. 2014). Bma-HMR-1 was an upregulated transcript in DEC and IVM-treated females at 7 days, and is an ortholog of C. elegans HMR-1a (hammerhead embryonic lethal) and H. sapiens CDH11 (cadherin-11, E value= 8.2e-34). HMR-1a is expressed in epithelial tissue and some neurons and encodes a neuronal classical cadherin involved in axon 99

118 fasciculation and is required for epithelial morphogenesis (Broadbent & Pettitt 2002). Of the 12 cadherin genes in C. elegans, hmr-1 is the only one that is essential for viability (Pettitt 2005). During embryo development, HMR-1a regulates cell ingression during gastrulation, promoting proper epidermal morphogenesis and subsequent ventral enclosure and elongation (Hardin et al. 2012). Bma-HMR-1 has been identified as an E/S protein product released by Mf (Bennuru et al. 2009), and Ballesteros et al. found that Bma-HMR-1 expression was downregulated in females maintained in vitro for five days (Ballesteros et al. 2016a). They suggest that the downregulation of cadherins may be an indicator of nervous system degeneration, supporting the thought that loss of E-cadherin is deleterious for cell function. Its status as a secreted protein product, combined with its importance in nematode biology and the function of its human ortholog makes Bma- HMR-1 and interesting target for anthelmintic drug development. Bm6122 is an immediate gene neighbor of Bma-hmr-1 and ortholog of C. elegans Y52B11A.11 bearing close homology to HMR-1b. Like Bma-HMR-1, Bm6122 was also upregulated in females at 7 days in response to DEC and IVM. In C. elegans, both isoforms of this gene are part of the cadherin-catenin complex (CCC), which links the adhesion interface to the actin cytoskeleton, allowing adhesion and cell signaling (Hardin et al. 2012). Proper function of the CCC is crucial for embryonic development and tissue morphogenesis (Hardin et al. 2012). RNAi of this gene results in embryos with defective or altered morphology and contributes to the total embryonic lethality seen in HMR-1 knockout mutants (Grana et al. 2010). Interestingly, a B. malayi ortholog of a noncadherin component of the CCC, PAC-1 [PAR-6 at contacts (abnormal early localization of PAR-6)], was downregulated in DEC Mf at 7 days. The best human ortholog of 100

119 Bm6122 is fat atypical cadherin 1 (FAT1, E=3.5e-108), which is thought to play a role in neuronal tissue homeostasis and act as an upstream regulator of the Hippo signaling pathway (Ahmed et al. 2015). This pathway regulates the size of organs by controlling cell apoptosis and proliferation, with upstream regulators producing signals to arrest organ growth upon stimulation (Hilman & Gat 2011). Bm8476, an ortholog of C. elegans CDH-1, was the only upregulated transcript in DEC-treated males at 24 hours. Bm8476 is an ortholog of human fat atypical cadherin 4 (FAT4, E=4.1e-181), which is also part of the Hippo signaling pathway. The expression of cadherins was upregulated in response to IVM and DEC treatment, and was found in both male and female parasites. This was one of the few consistent findings among gene hits that were found in more than one drug treatment group. The maintenance of cellular adhesion is important for structural and signaling integrity in both nematodes and humans. It is interesting that these drugs may exert the same effect on both host and parasite by enforcing these connections, reducing cellular permeability and tightly controlling signaling function. In the context of LF pathology, this reduction of permeability contradicts some of the long-held beliefs that parasites induce permeability to abet their development and reproduction and that this alteration contributes to lymphatic dysfunction seen in patients. Some of the examples discussed in the cited literature and this study s findings suggest that parasites promote cellular adhesion in the host and upregulate expression of their own genes to maintain this function within themselves in response to drug treatment. In finding that live Mf induce elevated intercellular adhesion molecule expression in host vascular endothelial cells (VEC), Schroeder et al. (2012) suggest that this upregulation may explain why smaller 101

120 lymphocytes are able to migrate through endothelium, while monocytes and neutrophils are retained. Similar findings also suggest that parasite-derived molecules do not increase small molecule trafficking, and that BmA or MfAg were able to impede the permeability effects of inflammatory cytokines TNF-α and IL-1α (Bennuru & Nutman 2009). Another possibility to consider is that the production of parasite cadherins and products that promote barrier integrity actually limit lesion development rather than promote it. Schroeder et al. (2012) suggest that lymphedema associated with filarial infection may be due to parasite-exposed lymphatic vessels being unable to resorb fluid rather than due to fluid to passing through LEC cell junctions abnormally (Schroeder et al. 2012). If so, perhaps the reason these drugs are not true macrofilaricides is that they force adult parasites to respond in a host-beneficial way that allows adults to survive in the lymphatic vessels but halts reproduction for an extended period and eliminates Mf. In light of our findings and those from previous studies, parasite-produced cadherins and other celladhesion proteins should be evaluated for the ability to impact transendothelial migration. Based on the importance of these proteins in C. elegans, they should also be explored in Brugia to see if they are also crucial for development and tissue morphogenesis. 102

121 Glycosylation and phosphorylcholine Table 4.6: B. malayi gene hits with orthologs involved in glycosylation or whose products are PC-conjugated Gene Ortholog Treatment group Bm3368 H. sapiens ESL-1, C. elegans F14E5.2 DEC females 7 days Bma-fut-1 H. sapiens FUT3, C. elegans fut-1 IVM Mf 24 hours Bm5648 H. sapiens FKTN, O. volvulus OVOC8243 DEC females 7 days Bm3610 Many in C. elegans, nematode specific IVM males 7 days Bma-mig-6 C. elegans mig-6 IVM Mf 24 hours Bm3276 C. elegans mig-10 DEC females 7 days Bm3368 is an ortholog of H. sapiens ESL-1/GLG1 (E-selectin ligand/golgi glycoprotein 1, E=0), and was upregulated in females exposed to DEC for 7 days. ESL-1 is involved in the cell adhesion molecule, cell surface interaction at the vascular wall, and hemostasis pathways in humans. This protein is localized to the Golgi apparatus and cell membrane and encodes a ligand for endothelial (E)-selectin, which is expressed on endothelial cells. E-selectin expression is induced by pro-inflammatory cytokines and acts a leukocyte and granulocyte recruiter, drawing cells bearing ESL-1 to the affected site. The ability of ESL-1 to bind to E-selectin relies on fucosylation mediated by fucosyl transferase 3 (FUT3) (Steegmaier et al. 1995). Expression of Bma-FUT-1, the ortholog of FUT3, was upregulated in Mf treated with IVM for 24 hours, suggesting that this type of protein modification could be important for cellular adhesion and is increased in response to drug treatment. In the Golgi apparatus, ESL-1 acts as a negative regulator of TGF-β production by binding its precursors and preventing their maturation (Yang et al. 2010). In patients who are Mf+ and have few or no symptoms, increased TGF-β and IL-10 production are clinical markers indicating a parasite-permissive Th2 response (Babu et al. 2006; Anuradha et al. 2014). Neutralization of TGF-β has been shown to partially restore 103

122 T cell response in PBMCs of Mf + patients in vitro (King et al. 1993; Babu et al. 2011). Evidence that DEC is able to interfere with this cytokine has also been demonstrated in vivo. In a mouse model of alcohol-induced liver injury, administration of DEC decreased TGF-β expression and increased IL-10 expression, collectively inhibiting the induction of the pro-inflammatory NF-κB pathway (da Silva et al. 2014; Rodrigues et al. 2015). It is intriguing to speculate that DEC treatment could upregulate the expression of parasite genes that themselves may downregulate effectors promoting the tolerigenic host response while still exerting an overall anti-inflammatory effect. Beyond Bm3368, the expression of other genes encoding sugar-bearing proteins was altered by drug treatment. Bma-OGT-1 and Bm5648 are both involved with protein glycosylation, in which a sugar is added to a protein. Bm5648 is an ortholog of human fukutin (FKTN/FCMD, E value= 6.2e-28) and was the most downregulated transcript in DEC-treated females at 7 days. Fukutin is a glycosyltransferase that plays a role in synthesizing carbohydrate structures present in α-dystroglycan and is required for muscle integrity (Kobayashi et al. 1998). Fukutin and the other members of the fukutin-related protein family are best known for mutations causing Fukuyama congenital muscular dystrophy, but have also garnered the attention of glycobiologists for their role in transferring phosphorylcholine (PC) to carbohydrates in bacteria (Lysenko et al. 2000). PC is a widely recognized molecule with immunomodulatory properties, interfering with B and T cell signaling, macrophage and DC development, and mast cell degranulation, collectively promoting parasite survival (Grabitzki & Lochnit 2009). In searching for the nematode genes responsible for attaching PC to proteins, the fukutin gene family members of C. elegans were identified as glycosyltransferases likely able to carry out this 104

123 function (Harnett et al. 2010). RNAi targeting PC synthesis and metabolism in C. elegans dramatically reduces offspring production, suggesting that PC is required for nematode development in addition to immune evasion (Houston et al. 2008; Lochnit et al. 2005). Targeting parasite proteins involved in the synthesis of immunomodulatory products may present one of the ways DEC combats parasites. Hindering the ability of adults to manipulate the immune response may induce the clearance of Mf by re-energized leukocytes and granulocytes while reducing embryogenesis and Mf release. Alteration of glycosylated or PC-bearing gene products was not limited to DECtreated parasites. Bm3610 expression was upregulated in IVM-treated males at 7 days and was the most upregulated gene identified in this study. Bm3610 is a N- acetylglucosaminyl transferase E/S product released by adults and has the highest PC content of secreted Brugia products (Hewitson et al. 2008). Finding that Bm3610, but not the B. malayi homolog of ES-62 was PC-conjugated (Hewitson et al. 2008) has shifted some of the attention for immunomodulation to this product. ES-62 is a PC-bearing E/S product of the nematode parasite Acanthocheilonema viteae that possess numerous immunomodulatory abilities (Harnett & Harnett 1993; Goodridge et al. 2001; Goodridge et al. 2005) and is one of the most studied E/S products of nematodes, with or without PC. Proteomic studies identified Bm3610 as a male-associated gene (Moreno & Geary 2008) that is upregulated nearly 100-fold in males compared to females (Li et al. 2011). To date, no studies have been conducted to investigate the capacity of Bm3610 to induce responses similar to those elicited by ES-62, but its identification as the most upregulated transcript sets it apart for further characterization. 105

124 Many protein products of Brugia bear PC (Thomas Nutman, personal communication), and modifying proteins with sugar moieties is a common process across organisms. Bma-MIG-6 (abnormal cell MIGration) expression was upregulated in IVMtreated Mf at 24 hours. MIG-6 is secreted at the extracellular matrix and is required for embryonic hypodermal cell enclosure and normal excretory canal cell function in L1 larvae of C. elegans (Kramerova et al. 2000). The role of the excretory canal cell is probably analogous to the renal system in higher animals, mediating osmotic/ionic regulation and waste elimination. It presumably collects fluids and wastes and then empties them outside via the excretory duct and pore (Nelson & Riddle 1984; Buechner et al. 1999). The excretory system is critical for the worm s survival, and mutants lacking MIG-6 or other excretory system components have embryonic and adult lethal phenotypes (Kramerova et al. 2000; Kamath et al. 2003). The release of E/S products is important for nematode development and host interaction in parasitic species, and the interruption of this process has been a major hypothesis for how IVM acts against filarial parasites. Moreno et al. determined that the GluCl subunits in B. malayi Mf are localized to the muscle tissue surrounding the E/S vesicle. They also demonstrated that in vitro treatment of Mf with IVM reduces the release of E/S products as soon as 24 hours after exposure (Moreno et al. 2010). Bm3276 is another MIG family ortholog that was differentially expressed and was upregulated in DEC-treated females at 7 days. This gene is also involved in C. elegans signal transduction and axon guidance in addition to excretory cell formation and maintenance (Chang et al. 2006; Stavoe et al. 2012). The dysregulation of some glycosylated gene products that are involved in excretory function by IVM suggests that parasites 106

125 upregulate the expression of these genes to preserve their development and ability to modulate host response. Conversely, the downregulation of some genes involved in glycosylation may also indicate that impeding this process is deleterious for parasites. Host immune evasion and manipulation Bm17689 is an ortholog of C. elegans nars-1 and H. sapiens NARS (asparaginyl (N) aminoacyl trna synthetase, AsnRS E value=1.9e-173), the expression of which was upregulated in IVM-treated females at 7 days. As an aminoacyl trna synthetase (AARS), NARS-1 attaches amino acids to their corresponding trnas, allowing ribosomal transfer from the trna to the growing peptide and continued protein translation (Klipcan & Safro 2004). This protein was first recognized as an immunodominant antigen that produced a strong IgG3 response in patients with LF (Perrine et al. 1988; Nilsen et al. 1988) and was also present in the O. volvulus genome (Nilsen et al. 1988; Kron et al. 1995). There has not been a great deal of study of nematode AARSs beyond their role in filarial nematodes, but in C. elegans, nars-1 is also involved in nematode larval development, reproduction, and apoptotic process (Fraser et al. 2000; Maeda et al. 2001). This protein is secreted by adult B. malayi and binds to CXCR1 and CXCR2, the GPCRs of IL-8 expressed by granulocytes, monocytes, mast cells, and some NK cells (Chuntharapai et al. 1994). IL-8 is considered one of the most important chemokines for transendothelial neutrophil and monocyte migration (Kilgore et al. 1996), attracting granulocytes and inducing phagocytosis upon their arrival. This chemokine is expressed by many cell types, including endothelial cells, and promotes angiogenesis by stimulating the production of VEGF (Martin et al. 2009). Bma-NARS-1 107

126 is a potent chemoattractant like human NARS-1 for human lymphocytes and immature DCs, and also attracts neutrophils and eosinophils (Ramirez et al. 2006). Preliminary in vitro studies of Bma-NARS-1, demonstrating its chemotactic ability for IL-8-expressing cells suggested a pro-inflammatory function, but intraperitoneal administration of Bma- NARS-1 in mice modeling colitis produced a potent anti-inflammatory response that resolved gut lesions (Kron et al. 2013). An anti-inflammatory role for IL-8 has been demonstrated in endothelial cells overexpressing CXCR1 and CXCR2, which mimic neutrophils that respond and adhere to damaged endothelial tissue, preventing inflammation and promoting re-endothelialization (Xing et al. 2012). Bma-NARS-1 is able to mimic the ability of VEGF to stimulate endothelial cell proliferation and migration, inducing angiogenesis in vitro (D JJ et al. 2016). Why a parasite would secrete a protein that attracts granulocytes initially mystified researchers, but this may be an example of parasites playing a long game with the immune system. The chemokine-chemotaxis response is exhaustible, and leads to receptor desensitization/internalization, inhibiting further cellular migration towards a pathogen (Ramirez et al. 2006). This could be an evasion technique in which worms try to make the immune response cry wolf, and allow parasites to be left alone. Female worms could be secreting more of this potential immunomodulatory protein to try to combat and reduce granulocyte migration stimulated by IVM. Identification of this gene hit at the latter time point, after IVM has presumably been excreted, suggests an increased immune response to parasites persists for some time after treatment, and that worms are still responding to it. It should also be noted that this gene was also identified 108

127 in a previous transcriptomic study conducted in our lab and was also upregulated in B. pahangi Mf exposed to IVM in vivo (Rogers 2013). In addition to mimicking chemokines and their receptors, parasites may also be manipulating the host immune system by interfering with other trafficking proteins such as galectins. Galectins are sugar-binding proteins that recognize and attach their ligands through a conserved carbohydrate-recognition domain (CRD) (Cooper & Barondes 1999). Nine galectins have been identified in humans, and these proteins have also been identified in helminth parasites (Klion & Donelson 1994; Newlands et al. 1999). Two galectin genes were identified in this study; Bma-LEC-5 expression was downregulated in IVM-treated males at 24 hours and Bm17568 expression was downregulated in DECtreated females at 7 days. Proteomic studies of E/S products produced by B. malayi have identified galectins, including Bma-LEC-5 with tandem-repeat CRDs and sequence similarity to galectins found in O. volvulus and H. contortus (Hewitson et al. 2008; Bennuru et al. 2009). At the time of these studies, no functions had been ascribed to helminth galectins, but it has been established that mammalian galectins could inhibit Th1- and Th2-mediated inflammation (Toscano et al. 2006; Katoh et al. 2007). Galectins are also known to bind specifically to IgE (Klion & Donelson 1994), regulate AAMΦ function (MacKinnon et al. 2008), and inhibit lymphocyte trafficking (Norling et al. 2007). Since then, studies on galectins from H. contortus have demonstrated that these proteins promote ovine eosinophil migration, possibly mimicking the action of galectin-9 (Turner et al. 2008), and that they may promote an anti-inflammatory response by downregulating caprine (goat) PBMC function and signaling cascades in vitro (Wang et al. 2014). Similar results were observed after administration of a galectin-9 homolog 109

128 from the ascarid parasite Toxocara leonina; mice that received recombinant Tl-galectin displayed fewer inflammatory signs and increased levels of TGF-β and IL-10 compared to controls (Kim et al. 2010). Increased levels of these cytokines are associated with healing and amelioration of inflammation, but also promote parasite survival by suppressing T cell and inflammatory cytokine function (Jackson et al. 2009). Aligning Bma-LEC-5 and Bm17568 with T. leonina and H. contortus galectins provided over 95% coverage and 40% identity, suggesting that B. malayi galectins could induce similar chemotactic and regulatory responses. The downregulation of galectins may also suggest that these proteins could act in immune defense like their C. elegans orthologs (O Rourke et al. 2006; Schulenburg et al. 2008). Lectin expression, including LEC-5, is upregulated in female B. malayi in response to E. coli exposure ex vivo (Libro et al. 2016). Human galectin-4 and galectin-8 are able to recognize and bind to E. coli surface protein O86, directly killing bacteria by destroying membrane integrity and motility (Stowell et al. 2010). The closest human ortholog of both Bma-LEC-3 and Bm17568 is galectin-4 (LGALS4). This galectin is mainly expressed in intestinal epithelial cells and is involved in several processes, including lipid raft stabilization, apical protein trafficking, and cell adhesion (Cao & Guo 2016). In a study of intestinal inflammation, it was demonstrated that galectin-4 binds to T cell CD3 receptors and inhibits T cell activation, cycling, and expansion, and reduces pro-inflammatory cytokine secretion (Paclik et al. 2008). If the secreted galectins produced by Brugia could exert the same effects this would certainly be beneficial for survival and could contribute to T cell apoptosis observed in vivo and in vitro (Jenson et al. 2002; Semnani et al. 2003; Harnett et al. 2006) in human and mouse 110

129 models of filarial infection. Inhibition of Brugia galectins with IVM or DEC treatment may reduce the ability of parasites to suppress T cell function and expansion, allowing the immune response to respond more efficiently and kill or damage parasites. Based on our findings, treatment with either IVM or DEC reduces galectin production and/or function in adult parasites, and could be deleterious by impeding protein trafficking and adhesion, hindering their ability to modulate immune effectors, and blunting parasite response to the immune system, or a combination of all of these. The dysregulation of galectins in males at 24 hours and females at 7 days follows the observed pattern of dysregulation occurring in males before females. This could be due to males being more susceptible to drug treatment, which itself warrants further study in addition to characterizing the role of B. malayi galectins within the parasite, and whether they also influence interactions with the host. 111

130 Genes potentially involved in circadian entrainment Table 4.7: B. malayi gene hits with orthologs involved in circadian entrainment Gene Ortholog Treatment group Bma-ogt-1 C. elegans ogt-1, H. sapiens OGT IVM Mf 24 hours Bma-hlh-1 C. elegans hlh-1, H. sapiens MYF6 DEC Mf 7 days Bm9098 C. elegans gei-8, H. sapiens NCOR DEC females 7 days Bm8119 O. volvulus OVOC8194, H. sapiens UBE3A DEC females 7 days Bma-cbp-1 C. elegans cbp-1 & cbp-2, H. sapiens DEC females 7 days CREBBP & EP300 Bm9015 H. sapiens PP1 IVM females 7 days One of the most intriguing aspects of both IVM and DEC is how quickly they clear Mf from the bloodstream after treatment. This swift reduction is not always without side effects in patients, who occasionally report dizziness and sleepiness one to two hours after drug administration (WHO 2016c; Center for Drug Evaluation and Research 1996). It has also been observed that some nocturnally periodic W. bancrofti and subperiodic B. malayi populations can be found in the blood during the day after administration of DEC (Russel et al. 1975); IVM does not produce this effect. The quick disappearance or reappearance of Mf after drug administration has largely remained an intriguing observation that has not garnered much follow-up. Like their hosts, Mf also have an internal clock set by their circadian rhythm that dictates when they are active. The main hypothesis for the specific periodic patterns of Mf is to match with the biting behaviors of their mosquito hosts in order to maximize the chance of transmission (Manson 1899; Hawking & Thurston 1951). In mammals, light and darkness aid in regulating circadian rhythm, setting the 24- hour day. The translation of photo cues into behavioral patterns is mediated by melatonin, a hormone produced by the pineal gland. Darkness stimulates the secretion of melatonin 112

131 during the night, while light suppresses it, setting the pace for a new day. Since Mf are not exposed to light, they must rely on another cue to regulate their appearance in the circulation, and while this phenomenon is not well understood, it is thought that Mf utilize cues from their hosts (Dixit et al. 2004). In analyzing data from multiple studies regarding the periodicity of Mf, Sack found that the appearance and rise of Mf in peripheral circulation closely coincides with the amount of melatonin in host plasma. He suggests that host melatonin itself may act as the cue for Mf, and that melatonin could be an effective alternative to DEC to provoke Mf (Sack 2009). This hypothesis has not been tested, but if true, could suggest that drug treatment alters the circadian rhythm of Mf. Dysregulation of the Mf internal clock could negatively impact downstream biological processes resulting in Mf clearance and may explain the rapid effects of drug treatment. Expression of Bma-ogt-1 was downregulated by IVM in Mf at 24 hours. This gene encodes an ortholog of C. elegans and H. sapiens O-linked N-acetylglucosamine (O-GlcNAc) transferase enzyme (E=0). In C. elegans, ogt-1 plays a role in nutrient sensing and storage, insulin-signaling pathways, and mounting an appropriate response to stress or infection (Bond et al. 2014). This enzyme is responsible for catalyzing the addition of a single N-acetylglucosamine in O-glycosidic linkage to serine or threonine residues. This singular task of modifying proteins feeds into many pathways, such as chromatin modification and organization, deubiquitination, and protein metabolism. In turn, more than 1,000 proteins are modified, impacting protein transcription, signal transduction, and cellular metabolism (Hart et al. 2011). OGT-1 is also a circadian rhythm-related gene, promoting the expression of BMAL1/CLOCK target genes and stabilizing them by inhibiting their ubiquitination (Li et al. 2013). OGT-knockout mice 113

132 exhibit an advance in circulating glucose rhythm, suggesting that the destabilization of the BMAL1/CLOCK complex leads to early accumulation of PER and CRY proteins that signal the beginning of a new circadian day (Li et al. 2013). In Drosophila, knocking down ogt-1 results in shorter circadian behavioral rhythm, with flies becoming active earlier, suggesting that OGT-1 plays a role in setting the pace of the circadian clock (Kim et al. 2012). Furthermore, IVM has been shown to alter the circadian rhythm in human cells (Ollinger et al. 2014), demonstrating that this drug may alter circadian circuitry in hosts as well as parasites. Bm9015 was the only downregulated transcript in adults, occurring in IVMtreated females at 7 days. In B. malayi, this protein is predicted to have hydrolase activity and is an ortholog of human protein phosphatase 1 catalytic subunit alpha (PP1/PPP1CA, E= 6.1e-35). PP1 is one of the most conserved and abundant eukaryotic serine/threonine phosphatases (Ceulemans & Bollen 2004) with roles in various biological processes, including circadian rhythm regulation. Both mice and human U-2 OS cells with reduced PP1 expression exhibit phase delays resulting in significantly longer circadian periods. The results of this study combined with others suggests that PP1 acts as a posttranslational regulator of the circadian clock (Schmutz et al. 2011). It has been established that post-translational modification of clock components through ubiquitination, acetylation, and phosphorylation directly impact the mammalian circadian clock, and that altering the expression of these proteins can modify its pace by delaying or advancing the circadian clock (Vanselow & Kramer 2010). The functions of other B. malayi genes with human circadian orthologs also carry out these functions, suggesting that anthelmintic treatment alters the ability of parasites to modify proteins. This 114

133 dysregulation may manifest in altered behavioral or cellular responses that could be damaging to Mf. The presence of several upregulated transcripts in adults at 7 days suggests that parasites may be trying to reset their circadian clock and re-normalize functions such as transcription factor activity and protein binding. In total, six B. malayi genes with human orthologs involved in circadian rhythm were differentially expressed. All but Bma-ogt-1 and Bma-hlh-1 were found in adult female parasites. The location of adult worms in the lymphatics makes closely observing them in vivo difficult, and we do not know if or how their behavior is governed by circadian rhythms. Many of these genes are transcriptional regulators that also play roles in reproduction, muscle function, and motility in nematodes. Disrupted expression of transcripts regulating these functions could prevent successful mating or Mf release, contributing to the observed reduction in microfilaremia and extended suppression of their reappearance. This effect could be magnified by the onset of dysregulation, with male parasites affected before females, creating a larger temporal gap, in which either sex is dysregulated by drug treatment, and reproductive potential and/or output is diminished. 115

134 Gcy-9 Bma-GCY-9 (Guanylyl CYclase) expression was upregulated in IVM-treated Mf at 24 hours. This gene is involved in intracellular signal transduction, protein phosphorylation, and cyclic nucleotide production. The encoded protein is a receptor-type class III adenylate and guanylate cyclase that catalyzes the production of cyclic adenosine monophosphate (camp) and cyclic guanosine monophosphate (cgmp) from ATP and GTP, respectively. This is an ortholog of C. elegans gcy-9, which has much more annotation in terms of localization and function. GCY-9 expression is most concentrated in the neuronal cell body (Ortiz et al. 2006), but is also reportedly expressed intracellularly and on the plasma membrane. GCY-9 is involved in detecting and responding to carbon dioxide (CO2) via the sensory BAG neurons in the head (Brandt et al. 2012). In order to sense CO2, BAG neurons require a cgmp signaling pathway mediated by GCY-9, TAX-2, and TAX-4 (Brandt et al. 2012). Under normal conditions, C. elegans is repelled by CO2, but nutrient deprivation decreases avoidance, presumably to promote food seeking (Hallem & Sternberg 2008). Mutants lacking gcy-9 are unable to sense CO2 (Hallem et al. 2011; Fenk & de Bono 2015) and do not turn around and retreat from increasing CO2 levels like wild-type worms (Fenk & de Bono 2015). Many parasitic nematodes, including the human hookworms Ancylostoma duodenale and Necator americanus (Haas 2003), and plant-parasitic nematodes (Pline & Dusenbery 1987; Robinson 1995) utilize CO2 to seek hosts. Dysregulation of an intracellular signal transduction gene involved in responding to CO2 could present an explanation for the rapid effect of IVM against Mf. Changes in gas tension have been put forth as a mechanism governing the periodicity of Mf. 116

135 Hawking et al. postulated that the retention of Mf in the lungs during the day was due to high oxygen tension, and their release into the bloodstream at night is triggered by oxygen tension dropping (Hawking 1967; Hawking et al. 1981). As Sack elaborates in putting forth host melatonin as a cue for Mf to circulate in the bloodstream, changes in oxygen tension are secondary to sleep (Sack 2009) but could contribute to Mf periodicity. It could be possible that B. malayi Mf incorporate sensing CO2 into regulating periodicity to optimize their chances of being taken up by a mosquito and continuing the transmission cycle. Upregulation of Bma-GCY-9 expression could indicate that Mf chemosensation has been disrupted, which could alter their behavior. In C. elegans, GCY-9 expression is driven by the transcription factor ETS-5 (Brandt et al. 2012). ETS-5 activity is also required for exploratory behavior and controls the behavioral state of C. elegans (Juozaityte et al. 2017). Bma-gcy-9 was also one of the genes identified as part of the overexpressed endothelin signaling pathway. The human ortholog of Bma-GCY-9 is atrial natriuretic peptide receptor 1 (NPR1/NPRA, E=3.3e-107). This receptor is activated by the binding of atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) to produce cgmp. In the context of endothelin signaling, ANP and cgmp relax vascular smooth muscle cells (VSMC), inhibiting endothelin (ET-1) synthesis and regulating its vasoconstrictive effect. It is possible to speculate that IVM treatment increases ET-1 expression in Mf, preventing cgmp production and downstream signaling function to regulate numerous downstream processes. Retention of E/S and waste products caused by IVM treatment could result in damage similar to the nephrotic and vascular damage caused by ET-1 overexpression in humans. The NPR1 ligand ANP plays an important role in fluid and 117

136 electrolyte homeostasis (Pandey 2014), and Mf may be upregulating this orthologous receptor GCY-9 to increase ligand binding and regulate fluid homeostasis and excretion of waste. This could mean that in the face of IVM, Mf are producing more of the receptor that produces cgmp, an important second messenger for mediating signaling to alter physiological responses. Reduced cgmp signaling could have several effects on Mf, including altering chemosensation and behavior, leaving them vulnerable to clearance by IVM. Bma-GCY-9 is one of nearly two hundred transcripts identified in this study whose expression is affected by drug treatment in vivo. The known and speculative functions of these genes and their orthologs in other nematodes and in humans when applicable, provide several possible processes that may be altered by drug treatment. A general summarization of how treatment with IVM or DEC could affect parasites based on differentially expressed genes identified in this study are as follows: 1. Interference with protein trafficking, both intracellularly and extracellularly. This could include altered production of products involved in molting and proteolysis, as well as protein translocation to and interference with glycosylation. 2. Altering cellular adhesion via cadherins and other adhesive proteins. This may interfere with the ability of parasites to regulate their own cellular integrity during development and embryogenesis, as well as mediate interactions with host tissues and immune effector cells. 3. Modifying expression of transcriptional regulators, impacting posttranslational protein modification and parasite physiology with downstream 118

137 effects on behavior, including periodicity, metabolic regulation, reproduction, and chemosensation. 4. Reducing the ability of parasites to modulate the host immune response. This could be achieved through the three previous processes, but also by downregulating the expression of cytokine and chemokine mimics, and by IVM or DEC treatment directly stimulating host immune cells. 119

138 CHAPTER 5: FUTURE DIRECTIONS Nearly 200 differentially expressed genes were identified in this study, and while no single narrative can be ascribed to explain how these drugs combat filarial parasites, there were several processes identified including the modification, trafficking, and release of proteins, as well as cellular adhesion and transcriptional regulation. We can begin to address the importance of these processes in filarial parasites and their interactions with their hosts by devising further studies to consider the following: 1. Can native or recombinant B. malayi parasite protein products induce chemotaxis of immune cells, and how does treatment with ivermectin (IVM) or diethylcarbamazine (DEC) affect this interaction? 2. How could altered protein trafficking and signaling in the face of treatment affect the parasites ability to alter host immune responses? 3. What roles do parasite cadherin and cell-adhesion proteins play in the parasitehost interactions? 4. How can we study behavior, such as circadian rhythm in parasites and how is it altered by drug treatment? 120

139 Examine the impact of drug treatment on selected E/S products in vitro Several B. malayi genes and their protein products identified in this study have demonstrated immunomodulatory activities or have orthologs in other parasites able to do so. As previously discussed, numerous studies have utilized protein purification and recombinant expression to examine the impact of parasite proteins on host tissue and immune cells. Previous work carried out in our lab has demonstrated that IVM increased the adherence of peripheral blood mononuclear cells (PBMCs) and polymorphonuclear cells (PMNs) to D. immitis microfilariae (Mf) (Vatta et al. 2014), and the addition of human cell cultures will further aid the measurement of drug-induced immune cell chemotaxis and adherence. As such, our lab should be able to build on these methods to examine how drug treatment effects these interactions. Table 5.1: Secreted protein products for further study Gene Treatment group Support Bma-nars-1 IVM 7 day females Binds IL-8 receptors (Kron et al. 2012), mimics VEGF in vitro (D JJ et al. 2016), promotes anti-inflammatory response in vivo in mouse colitis model (Kron et al. 2013). Bma-lec-5 IVM males 24 hours Galectins from other parasites have demonstrated chemoattractant and immunomodulatory abilities (Sun et al. 2007; Kim et al. 2010; Wang et al. 2014), may act as parasite innate immune response gene (Libro et al. 2016). Bma-mlt-11 IVM Mf 24 hours, IVM 7 day females Ortholog of TFPI, some similarity to F. hepatica protein that promotes parasite tolerance (Falcón et al. 2014). Only DEG found in both adults and Mf. Bma-mig-6 IVM Mf 24 hours Homolog in D. viviparus neutralizes PAF (Kooyman et al. 2007). Bm3610 IVM 7 day males Most upregulated transcript identified in this study, also bears the most PC of B. malayi proteins (Hewitson et al. 2008) and may modulate host immune response. 121

140 A simple model to start with is a single transwell with a single cell layer as shown in Figure 5.1. This could be adapted to measure cell migration in the presence of E/S proteins, Mf, or adults: 1. We could express B. malayi proteins in mammalian cell lines, which should be better at expressing secreted or modified proteins like those identified in this study. Bma- NARS-1 can be expressed in an E. coli vector system described by (D JJ et al. 2016). Proteins can be collected and purified and then added to transwells to measure their effect on the chemotaxis of specific immune cell types. Immune cells would be placed in the top chamber and recombinant proteins would be in the bottom. 2. Following the methods used previously by Schroeder et al. (2012), Mf, or a single adult could be placed in the lower well, and vascular cells such as HUVEC could be grown over the apical (top) side of the membrane. Human monocytes and neutrophils could be added to the upper chamber, and their migration to the bottom layer could be measured after 24 hours. 3. Assays described above could be modified to also measure the effects of drug treatment on cell chemotaxis with IVM, DEC, or a combination of drugs added to the upper chamber. Immune cell chemotaxis could be measured after 24 hours. 4. Mf could be placed in the top compartment above vascular endothelial cells, and an adult worm would be placed in the bottom compartment in contact with lymphatic endothelial cells (Figure 5.1, right side). Previous studies have taken an either/or approach, utilizing Mf or adults, or just their antigens or E/S products. Infections in vivo contain most or all of the above, so the development of a more authentic in vitro 122

141 system incorporating as many of these factors as possible could greatly aid the study of filariae-host interactions. Figure 5.1: Schematic of transwell assay systems, Corning Labs. On the left is a single monolayer, and on the right the transwell has cell monolayers in both compartments Culturing parasites in in vitro models of vascular and endothelial tissues with drug, as previously described (Schroeder et al. 2012; D JJ et al. 2016) will allow us to collect and measure E/S products following drug treatment and examine host tissue. We could collect the fluid from the top layer containing cell monolayers to perform ELISA and measure cytokine expression, and use qpcr to quantify expression of chemokine receptors in a similar manner to Schroeder et al., who used these methods to study the effects of Mf on endothelial cell function (Schroeder et al. 2012). Of the B. malayi transcripts identified in this study that have demonstrated the ability to impact immune signaling, Bma-NARS-1 has been the most characterized. It would be interesting to see if the increased expression of this gene in vivo can be recapitulated in vitro, and how it might affect co-cultured human cells. Previous in vitro studies suggested a pro-inflammatory effect (Ramirez et al. 2006), and it would be interesting to investigate if expression of these mediators is impacted by IVM treatment. Other strong and interesting candidates include Bma-LEC-5, which has been suggested as 123