Resistance profiles to antiretroviral drugs in HIV-1 drug-naive patients in Argentina

Transcription

1 Antiviral Therapy 6: Resistance profiles to antiretroviral drugs in HIV-1 drug-naive patients in Argentina Gustavo H Kijak 1, Sandra E Pampuro 1, María M Avila 1, Carlos Zala 2, Pedro Cahn 2, Mark A Wainberg 3 and Horacio Salomón 1 * 1 National Reference Center for AIDS, Department of Microbiology, School of Medicine, University of Buenos Aires, Argentina 2 Huesped Foundation, Buenos Aires, Argentina 3 McGill University AIDS Centre, Montreal, Canada *Corresponding author: Tel: ; Fax: ; hsalomon@fmed.uba.ar The drug resistance profile of treatment-naive HIVinfected individuals living in Buenos Aires, Argentina, was studied. Samples taken from 94 drug-naive individuals with established HIV infection and 13 patients with primary HIV infection were assessed by nucleotide sequencing and LiPA. The prevalence of drug-associated primary mutations in individuals with established infection was very low. In the viral protease region, 1/86 (1.2%) individuals carried the D30N mutation, whereas 1/85 (1.2%) had the M41L mutation in the reverse transcriptase (RT) region. Secondary mutations in both the protease and RT regions were found in almost 90% of the individuals. In individuals with primary infection, primary mutations were detected in 2/13 (15.4%) patients, one of them carrying M46I mutation in the protease while the other patient had a mutation at codon 184 of the RT. In accordance with current drug resistance testing guidelines, the results of this study suggest that susceptibility tests need not be performed at this time prior to initiation of antiretroviral therapy in HIV-1-infected people in Argentina. However, the public health implications of this subject warrant follow-up studies that will examine a larger number of drug-naive patients, not only in Buenos Aires but also in other major Argentinian cities and in rural areas. Introduction Due to the high replication rate of HIV-1 [1] and the fact that the viral enzyme reverse transcriptase (RT) cannot perform proof-reading activity [2], HIV populations can be described as quasispecies. These allow the appearance of viral mutant variants that can escape the immune system and antiretroviral drug pressure, and are strongly associated with treatment failure [3]. These mutants have amino acid substitutions in the proteins that are targetted by antiretroviral treatment: RT and viral protease [4]. In 1993, the first case of transmission of a zidovudine-resistant strain was published [5], and in 1994 natural drug-resistant mutations in HIV-1 isolates from patients who had not received drug therapy were described [6]. Since then, many other cases of transmission of drug-resistant isolates and even multidrug-resistant ones have been reported [3]. Mathematical models have proposed that treatment failure in patients who have not undergone antiretroviral treatment, is most likely caused by the pre-existence of resistant mutants [7]. However, the possibility of detecting such viral variants using available technology remains unclear. Because of the public health implications of this phenomenon, many studies on the prevalence of drugresistant HIV-1 strains in treatment-naive individuals have been carried out in different countries [8 11]. In Argentina, antiretroviral therapy is provided free of charge to all eligible HIV-infected individuals according to local therapeutic guidelines. Since 1997, protease inhibitors (PIs), non-nucleoside RT inhibitors (NNRTIs) and all the nucleoside analogues have been widely available to patients through the Ministry of Health. Although more than a decade has passed since antiretroviral drugs were first used in Argentina, little is known about the drug susceptibility of the viral variants that circulate in this country [12]. According to the latest antiretroviral drug resistance testing guidelines, the use of these tests should be considered before starting treatment in patients with established infection, particularly in areas where the local prevalence of primary drug resistance is appreciable [13]. In developing countries, such as Argentina, knowing the cost-effectiveness of testing for antiretroviral resistance in drug-naive patients is necessary to optimize the distribution of resources for HIV/AIDS. The aim of this investigation was to study drug resistance profiles in antiretroviral-naive patients in the Argentinian population International Medical Press /01/$

2 GH Kijak et al. Materials and Methods Population under study Between January 1997 and June 2000, antiretroviral therapy-naive, HIV-1-infected individuals were referred to the National Reference Center for HIV/AIDS (Buenos Aires, Argentina) to have their plasma viraemia monitored in order to determine their eligibility for the initiation of antiretroviral therapy. Ninety-four blood samples taken in 1997 (n=36), 1999 (n=26) and 2000 (n=32) were randomly selected to investigate the prevalence of drug resistance-associated mutations. In addition, 13 baseline samples from patients enrolled in a primary HIV infection clinical trial during 1999 were also evaluated. Subjects with a history of recognized high-risk HIV exposure, followed by symptoms of an acute HIV infection or a documented seroconversion were enrolled if they had at least one of the following diagnostic criteria: (i) negative HIV antibodies on ELISA followed by a positive ELISA test confirmed by Western blot; (ii) positive ELISA plus evolving Western blot plus detectable HIV RNA; or (iii) symptoms of acute HIV infection plus a negative ELISA or indeterminate Western blot and/or detectable HIV RNA. All the individuals studied came from Buenos Aires and the surrounding area, the region in which 76% of the total AIDS cases of Argentina have been reported [14]. Plasma viral load was assessed by branched DNA (b-dna) method with a detection limit of 500 copies/ml (Quantiplex HIV RNA 2.0, Chiron Co., Emeryville, Calif., USA) for samples taken in 1997, while those taken in 1999 and 2000 were assessed by b-dna method with a detection limit of 50 copies/ml (Quantiplex HIV RNA 3.0, Chiron Co., Emeryville, Calif., USA). Cell populations from peripheral blood were studied by flow cytometry (Coulter XL, Coulter Co., Hialeah, Fla., USA). Sequence analysis Peripheral blood mononuclear cells (PBMCs) were separated in a Ficoll Hypaque gradient [15] from samples taken during 1997 and Pellets of two million PBMCs were stored at 70 C until used. Proviral DNA was extracted by incubating the PBMC at 56 C for 45 min with lysis buffer [PCR-5x (Perkin Elmer, Norwalk, Conn., USA), Tween %, and Proteinase K (20 mg/ml)], followed by a 10-min incubation at 96 C [16]. The RT coding region of the pol gene was amplified by nested PCR (INNO-LiPA HIV-1 RT Amplification, INNOGENETICS N.V., Ghent, Belgium) [17] and automatic sequencing (ABI PRISM DNA, Perkin Elmer, Norwalk, Conn., USA) was performed. The primer used for sequencing was: (5 3 ) CCAAAAGTTAAA- CAATGGC CATTGACAGA. The protease coding region of the pol gene was amplified by nested PCR using as first round primers: sense (5 3 ) GCTAATTTTTTAGGGAAGATCTGGCC TT; antisense (5 3 ) TTTATGGCAAATACTGGAGTATTG TATGGA; and second round primers: sense (5 3 ) AGCCCACCAGAAGAGAGCTT; and antisense (5 3 ) CTTTTGGGCCATCCATTCCTG. The protease region was automatically sequenced using the same sense primer utilized in the second PCR round. Before sequencing, nested PCR products from the RT and protease regions were purified with Exonuclease I and alkaline phosphatase (Amersham Life Science). The sequences obtained were aligned with a HTLV III/LAI reference sequence (GeneBank, Accession K02012) using Clustal W [18], and previously reported mutations were searched [13,19]. Viral RNA was isolated from plasma samples taken in the year 2000 using the QIAamp viral extraction kit (QIAGEN GmbH, Hilden, Germany). The TRUGENE HIV-1 genotyping Assay was used in conjunction with Table 1. Demographic and clinical characteristics of the population studied Year Type of HIV-1 infection Established infection Established infection Primary infection Established infection Total Individuals (n) Sex (%) Male 77.8% 42.3% 61.5% 84.4% 69.2% Female 22.2% 57.7% 38.5% 15.6% 30.8% Median age (years) Route of transmission (%) Sexual 52.8% 73.1% 100.0% 65.6% 67.3% Intravenous drug use 8.3% 19.3% 0.0% 3.1% 8.4% Unknown 38.9% 7.6% 0.0% 31.3% 24.3% Plasma viral load (median) (RNA copies/ml) CD4 cell count (median) (cells/µl) International Medical Press

3 Resistance in drug-naive HIV patients in Argentina the Open Gene automated DNA sequencing system (Visible Genetics, Toronto, Canada) to sequence the protease and RT regions of HIV-1 cdna. Testing involved simultaneous clip sequencing of PR and codons of RT from amplified cdna in both the 3 and 5 directions. Sequences were aligned and compared with a lymphoadenopathy-associated virus type 1 consensus sequence using Visible Genetics Librarian software. Sequence quality control was performed according to Los Alamos National Laboratory (Los Alamos, N.M., USA) recommendations (URL LiPA genotypic testing Line Probe Assay (INNO-LiPA HIV-1 RT, INNO- GENETICS N.V., Ghent, Belgium) was used to detect the presence of wild-type and mutated RT codons at position 41, 69, 70, 74, 184 and 215 [17]. The RT region of the pol gene was amplified from proviral DNA and cdna obtained from samples taken in 1997 and 2000, respectively. The amplicons were incubated with LiPA membrane strips, onto which selected oligonucleotide probes had been fixed. Following hybridization, a colorimetric reaction provided visual indication of the presence or absence of wild-type and mutated RT codons. Results One-hundred-and-seven antiretroviral drug-naive individuals were studied. Thirty-six of them were enrolled in 1997, 39 in 1999 and 32 in Demographic and clinical characteristics of the population under study are shown in Table 1. Samples were taken from 94 individuals with established HIV-1 infection. Sequences of the protease region were obtained from 86 samples, while the RT region was successfully sequenced from 85 samples (Table 2). Sequence quality control showed that no laboratory contamination had occurred. Similar drugassociated mutational profiles were observed in samples taken in different years. As shown in Table 2, drug resistance-associated mutations that were more frequently found in drugnaive patients with established infection consisted of the following: M36I, L63P and V77I (in 45/86, 22/86 and 18/86 samples, respectively) in the protease region; and mutations L214F and R211K (in 65/85 and 24/85 individuals, respectively) in the RT region. Most of the mutations detected in the RT region (V179D, R211K and L214F) belong to the group of secondary mutations [13,19]. Only one primary mutation (M41L), which is associated with resistance to zidovudine [13,19,20], was detected in the RT region in 1/85 Table 2. Antiretroviral-resistance-associated mutations detected in 94 drug-naive individuals with established infection using nucleotide sequencing Number of samples Mutation with mutations Percentage Viral protease region (n=86) L10I 7 8.1% L10V 4 4.7% K20M 1 1.2% K20R 2 2.6% D30N 1 1.2% M36I % L63P % A71T 5 5.8% V77I % Reverse transcriptase region (n=85) M41L 1 1.2% V179D 1 1.2% R211K % L214F % Primary mutations are indicated in bold (1.2%) patients. The only primary mutation observed in the PR region was D30N, which is associated with resistance to nelfinavir [13,19,21]. This mutation was found in only one sample (1/86, 1.2%), which belonged to a patient who also carried L10V and L63P mutations in the protease region (data not shown). However, the latter are not considered to be compensatory mutations of D30N [13,19,22]. All the other mutations found in the protease region (L10I, L10V, K20M, K20R, M36I, L63P, A71T and V77I) are classified as secondary mutations [13,19]. As the majority of protease and RT mutations confer weak resistance as single mutations, the number of drug resistance-associated mutations in the RT and PR regions detected in each patient was studied. Mutations in the protease region were found in 72/86 patients (83.7%), 43 of them carrying only one mutation, and 29 carrying two or more. In the RT region, mutations were detected in 78/85 patients (91.8%), 44 of them harbouring only one mutation. Thirty-four individuals had two or more mutations in this region. Of note, all the individuals in whom two mutations were detected in the RT region had the combination of mutations R211K and L214F. In order to analyse the presence of wild-type/mutant mixed populations, a LiPA test was performed on 52 samples. Wild-type variants were detected in most of the samples (between 76.9 and 92.3%, depending on the codon studied) (Table 3). The presence of pure mutant variants was observed at codon 70 (1/52 individual), whereas mixed populations were found at codons 70 (4/52 individuals) and 184 (1/52 individuals). Antiviral Therapy 6:1 73

4 GH Kijak et al. Table 3. LiPA results of drug resistance-associated mutations detected in samples taken in 1997 and in 2000 from 52 drug-naive individuals with established HIV-1 infection Year Total Codon Amino acid Individuals % Individuals % Individuals % 41 L % % % M 0 0.0% 0 0.0% 0 0.0% Mix L/M 0 0.0% 0 0.0% 0 0.0% No band 3 8.6% % % 69 T % % % D 0 0.0% 0 0.0% 0 0.0% Mix T/D 0 0.0% 0 0.0% 0 0.0% No band 1 2.9% % 4 7.7% 70 K % % % R 1 2.9% 0 0.0% 1 1.9% Mix K/R 3 8.5% 1 5.9% 4 7.7% No band 1 2.9% % 4 7.7% 74 L % % % M 0 0.0% 0 0.0% 0 0.0% Mix L/M 0 0.0% 0 0.0% 0 0.0% No band % % % 184 M % % % V 0 0.0% 0 0.0% 0 0.0% Mix M/V 1 2.9% 0 0.0% 1 1.9% No band 0 0.0% % 3 5.8% 215 T % % % Y 0 0.0% 0 0.0% 0 0.0% F 0 0.0% 0 0.0% 0 0.0% Mix T/Y or F 0 0.0% 0 0.0% 0 0.0% No band 1 2.9% % % Resistant viral variants can be transmitted [3,5]; however, as they have a lower degree of replication fitness in a drug-free environment, they may be outgrown by wild-type virus. Consequently, mutant viral variants may not be detected in drug-naive patients with an established infection, whereas they would probably be detected in patients with primary infection. In order to verify this hypothesis, samples were taken from 13 patients with primary infection Table 4. Antiretroviral resistance-associated mutations detected in 13 drug-naive individuals with primary infection using nucleotide sequencing Number of samples Mutation with mutations Percentage Viral protease region (n=13) K20M 1 7.7% M36I % M46I/M 1 7.7% L63P % A71T 5 5.6% Reverse transcriptase region (n=13) M184M/V 1 7.7% R211K % L214F % Primary mutations are indicated in bold. and the protease and RT regions were sequenced. Two primary mutations were detected in two different individuals with primary infection. Mutation M46I of the protease, associated with resistance to indinavir [13,19,23], was found in 1/13 individuals. In the RT region, mutation M184V of the RT-associated with resistance to lamivudine [13,19,24], was found in 1/13 individual. In both cases, mixtures of wild-type and mutant populations were observed (Table 4). Discussion Knowing that antiretroviral drug-resistant HIV-1 variants were present in an individual could help to determine the success of therapeutic intervention [25]. Due to HIV-1 population dynamics, these variants may not only be found in patients receiving antiretroviral treatment but also in individuals who have not undergone such therapy [3]. Studies carried out in countries in which there has been widespread use of antiretroviral drugs for many years, showed that the frequency of drug-resistant variants in drug-naive population ranges from 1 to 14% [8]. Resistance-associated mutations were found in 1 11% of recently HIV-1-infected antiretroviral-naive individuals studied in the USA [10,26], and in 5 14% International Medical Press

5 Resistance in drug-naive HIV patients in Argentina in Europe [27,28]. In drug-naive individuals with established infection, resistance-associated mutations were detected in 3 6% of cases in the USA [29,30] and 2 12% of cases in Europe [31,32]. The results of the present study suggest a low prevalence of drug resistance-associated mutations in antiretroviral-naive individuals with established HIV infection living in Buenos Aires, Argentina, and the surrounding area. It should be noted that this pattern did not substantially change over time despite wide availability of antiretroviral drugs. Almost 90% of the samples studied contained at least one secondary mutation in the protease or RT regions. This may be interpreted as polymorphisms present in HIV variants, which circulate in the Argentinian population. This hypothesis is supported by the fact that a high level of secondary mutations in the protease region was detected in samples taken in 1997 (in other words 75% of the individuals carried at least one secondary mutation), at a time that PIs were not widely used in Argentina. In addition, mutations R211K and L214F in the RT were very frequent in the population studied. These are considered polymorphisms that may facilitate dual resistance to zidovudine and lamivudine in association with M184V and other zidovudine resistance mutations [33]. In a recent report, mutation R211K was found in 43.6% of the analysed samples from drug-naive non-b subtype HIV- 1-infected individuals [34]. The consequences of the presence of secondary mutations when the therapy is initiated are still unknown. Mathematical models suggest that treatment failure in patients who have not yet undergone antiretroviral treatment is most likely to be caused by the pre-existence of resistant mutants [7]. However, the possibilities of detecting such viral variants using available technology are unclear. The nucleotide sequencing procedures used in this study are population amplification methods. Had sub-populations of drug-resistant virus been present at low frequency (less than 20%), they would have not been detected by these methods [35, 36]. In spite of the fact that the LiPA test is also based on population amplification, this assay has been reported to have a low detection limit of viral variants [17]. This may explain the detection of wildtype/mutant mixtures by LiPA in samples that had a wild-type result by sequencing. Sequencing of 1997 and 1999 specimens were done on proviral DNA, while sequencing of specimens collected in 2000 were done on plasma RNA samples. The resistance mutations seen in the two compartments may not always be similar. However, comparative studies performed on proviral DNA and plasma RNA suggest that this difference may not have significant implications for the present study [37]. The higher levels of resistant variants usually detected in recently infected individuals, compared to that in drug-naive persons with established infection, can be explained by HIV-1 dynamics. Mutant viral variants may have been transmitted during infection of an individual, but may have been outgrown by fitter wild-type variants during viral replication in a drugfree environment. In order to assess this hypothesis, samples from individuals with primary infection were analysed. In the present study, the prevalence of mutations associated with drug resistance in patients with primary HIV infection did not significantly differ from that observed in patients with established infection, suggesting that transmission of antiretroviral drugresistant variants in Argentina is low. The lower frequency of primary drug resistance mutations detected in the Argentinian population, compared with several developed countries [8 11], might be a result of the later introduction of antiretroviral drugs in Argentina as well as the more limited use of these drugs. We might expect that the widespread use of antiretroviral drugs will result in a rise in the prevalence of drug resistance among treated patients, bringing about an increase in the transmission of drugresistant variants to uninfected individuals. In accordance with current drug resistance testing guidelines [13], the results of this study suggest that susceptibility tests need not be performed at this time prior to initiation of antiretroviral therapy in HIV-1 infected people in Argentina. However, the public health implications of this subject [3] warrant followup studies that will examine a larger number of drug-naive patients, not only in Buenos Aires but also in other major Argentinian cities and in rural areas. Acknowledgements This study was supported by funds from the Agencia Nacional de Promoción Cientifica y Tecnológica (ANPCyT), grant BID 802/OC-AR-PICT References 1. Ho DD, Neumann AU, Perelson AS, Chen W Leonard JM & Markowitz M. Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature 1995; 373: Mansky LM & Temin HM. Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase. Journal of Virology 1995; 69: Wainberg MA & Friedland G. Public health implications of antiretroviral therapy and HIV drug resistance. Journal of the American Medical Association 1998; 279: Schinazi R, Larder B & Mellors J. Mutations in retroviral genes associated in drug resistance. International Antiviral News 1997; 5: Erice A, Mayers DL, Strike DG, Sannerud KJ, McCutchan Antiviral Therapy 6:1 75

6 GH Kijak et al. FE, Henry K & Balfour HH Jr. Brief report: primary infection with zidovudine-resistant human immunodeficiency virus type 1. New England Journal of Medicine 1993; 328: Najera I, Richman DD, Olivares I, Rojas JM, Peinado MA, Perucho M, Najera R & Lopez-Galindez C. Natural occurrence of drug resistance mutations in the reverse transcriptase of human immunodeficiency virus type 1 isolates. AIDS Research and Human Retroviruses 1994; 10: Ribeiro RM & Bonhoeffer S. Production of resistant HIV mutants during antiretroviral therapy. Proceedings of the National Academy of Sciences, USA 2000; 97: Little SJ. Transmission and prevalence of HIV resistance among treatment-naive subjects Antiviral Therapy 2000; 5: Salomon H, Wainberg MA, Brenner B, Quan Y, Rouleau D, Coté P, LeBlanc R, Lefebvre E, Spira B, Tsoukas C, Sekaly RP, Conway B, Mayers D, Routy JP & Investigators of the Quebec Primary Infection Study. Prevalence of HIV- 1 resistant to antiretroviral drugs in 81 individuals newly infected by sexual contact or injecting drug use. AIDS 2000; 14:F17 F Little SJ, Daar DS, D Aquila RT, Keiser PH, Connick E, Whitcomb JM, Hellmann NS, Petropoulos CJ, Sutton L, Pitt JA, Rosenberg ES, Koup RA, Walker BD & Richman DD. Reduced antiretroviral drugs suceptibility among patients with primary HIV infection. Journal of the American Medical Association 1999; 282: Boden D, Hurley A, Zhang LQ, Cao YZ, GuoY, Jones E, Tsay J, Ip J, Farthing C, Limoli K, Parkin N & Markowitz M. HIV-1 drug resistance in newly infected individuals. Journal of the American Medical Association 1999; 282: Kijak GH, Pampuro S, Gómez Carrillo M, Avila M, Villahermosa M, Cuevas M, Delgado E, Pérez L, Contreras G, Nájera R & Salomón H. Resistance profiles of antiretroviral drugs in HIV-1 naive patients. 7 th Conference on Retroviruses and Opportunistic Infections, San Francisco, Calif., USA, 30 January 2 February Abstr Hirsch MS, Brun-Vézinet F, D Aquila RT, Hammer SM, Johnson VA, Kuritzkes DR, Loveday C, Mellors JW, Clotet B, Conway B, Demeter LM, Vella S, Jacobsen DM & Richman DM. Antiretroviral drug resistance testing in adult HIV-1 infection. Journal of the American Medical Association 2000; 283: Ministry of Health, Buenos Aires, Argentina. Boletín sobre el SIDA en la Argentina 1999; 18: Salomón H, Belmonte A, Nguyen K, Gu Z, Gelfand M & Wainberg MA. Comparison of cord blood and peripheral blood mononuclear cells as targets for viral isolation and drug sensitivity studies involving human immunodeficiency virus type 1. Journal of Clinical Microbiology 1994; 32: Villahermosa ML, Contreras G, Perez-Alvarez L, Bru F, Medrano L, Delgado E, Colomo C, Thomson M & Najera R. Evaluation of mixtures of wild-type HIV-1 and HIV-1 with resistance point mutations against reverse transcriptase inhibitors. Antiviral Therapy 1998; 3: Stuyver L, Wyseur A, Rombout A, Louwagie J, Scarcez T, Verhofstede C, Rimland D, Schinazi RF & Rossau R. Line probe assay for rapid detection of drug-selected mutations in the human immunodeficiency virus type 1 reverse transcriptase gene. Antimicrobial Agents & Chemotherapy 1997; 41: Thompson JD, Higgins DG & Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 1994; 22: Hammond J, Calef C, Larder B, Schinazi R & Mellors JW. Mutations in retroviral genes associated with drug resistance in human retroviruses and AIDS 1998: a compilation and analysis of nucleic acid and amino acid sequences. Edited by B Korber, B Hahn, B Foley, F McCutchan, C Kuiken, B Hahn, JW Mellors & J Soroski. 1998; pp. III- 36 III-79. Los Alamos, N.M., USA: Theoretical Biology and Biophysics Group, Los Alamos National Laboratory. 20. Larder BA & Kemp SD. Multiple mutations in HIV-1 reverse transcriptase confer high-level resistance to zidovudine (AZT). Science 1989; 246: Patick AK, Duran M, Cao Y, Shugarts D, Keller MR, Mazabel E, Knowles M, Chapman S, Kuritzkes DR & Markowitz M. Genotypic and phenotypic characterization of human immunodeficiency virus type 1 variants isolated from patients treated with the protease inhibitor nelfinavir. Antimicrobial Agents & Chemotherapy 1998; 42: Martinez-Picado J, Savara AV, Sutton L & D Aquila. RT. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. Journal of Virology 1999; 73: Condra JH, Holder DJ, Schleif WA, Blahy OM, Danovich RM, Gabryelski LJ, Graham DJ, Laird D, Quintero JC, Rhodes A, Robbins HL, Roth E, Shivaprakash M, Yang T, Chodakewitz JA, Deutsch PJ, Leavitt RY, Massari FE, Mellors JW, Squires KE, Steigbigel RT, Teppler H & Emini EA. Genetic correlates of in vivo viral resistance to indinavir, a human immunodeficiency virus type 1 protease inhibitor. Journal of Virology 1996; 70: Schinazi RF, Lloyd RM Jr, Nguyen MH, Cannon DL, McMillan A, Ilksoy N, Chu CK, Liotta DC, Bazmi HZ & Mellors JW. Characterization of human immunodeficiency viruses resistant to oxathiolane-cytosine nucleosides. Antimicrobial Agents & Chemotherapy 1993; 37: Durant J, Clevenbergh P, Halfon P, Delgiudice P, Porsin S, Simonet P, Montagne N, Boucher CA, Schapiro JM & Dellamonica P. Drug-resistance genotyping in HIV-1 therapy: the VIRADAPT randomised controlled trial. Lancet 1999; 353: Grant R, Hescht F, Petropoulos C, Hellman N, Warmerdam M, Brandapalli N, Gittens T, Chesney M & Kahn J. Trends in prevalence of primary HIV-1 drug resistance among recently infected persons in San Francisco. Antiviral Therapy 1999; 4(Suppl. 1): Miller V, Perrin N, Modai J, Clumeck N, Johnson M, Gazzard B, Montaner J, Gaines H, Bloch N, Larder B, Beauvais L, Goh L, Girard P & Sonnerborg A. Prevalence of baseline drug resistance mutations in primary HIV infection patients from the QUEST Study. Antiviral Therapy 1999; 4(Suppl. 1): Cunningham P, Hurren L, Satchell C, Karr A & Cooper D. Reduced incidence of drug-selected mutations associated with zidovudine resistance in patients with primary HIV-1 infection. Program and Abstracts of the 38 th Interscience Conference on Antimicrobial Agents and Chemotherapy, San Diego, Calif., USA. Abstr. I Verbiest W, Schel P, Conant M, Van Den Broeck R, Blor S, Alcorn T, Stoffels P, Larder B & Hertogs K. An epidemiological prospective survey assessing the prevalence of HIV-1 resistance in 230 HIV-1-possitive antiretroviralnaive patients of the USA. Antiviral Therapy 1999; 4(Suppl. 1): Wegner S, Brodine S, Mascola J, Barile A, Aronson N, Martin G, Stephan K, Tasker S, Emmons W, Shaffer R, Blor S, Vingerhoets J, Hertogs K & Larder B. High frequency of antiretroviral drug resistance in HIV-1 from recently infected therapy-naive individuals. Antiviral Therapy 1999; 4(Suppl 1): Descamps D, Costagliola D, Glaude G, Buffet-Janvresse C, Calvez V, Collin G, Cottalorda J, Ferchal F, Harzic M, Izopet J, Maquelier B, Fufffault A, Schmuck A, Tamalet C, Yvon A & Brun-Vézinet F. Prevalence of resistance mutations in antiretroviral-naïve patients: French National Study. Antiviral Therapy 1999; 4(Suppl. 1): Gomez-Cano M, Rubio A, Puig T, Perez-Olmeda M, Ruiz L, Soriano V, Pineda JA, Zamora L, Xaus N, Clotet E & Leal M. Prevalence of genotypic resistance to nucleoside analogues in antiretroviral-naïve and antiretroviral-experienced HIV-infected patients in Spain. AIDS 1998; 12: International Medical Press

7 Resistance in drug-naive HIV patients in Argentina 33. Kemp SD, Shi C, Bloor S, Harrigan PR, Mellors JW & Larder BA. A novel polymorphism at codon 333 of human immunodeficiency virus yype 1 reverse transcriptase can facilitate dual resistance to zidovudine and l-2,3 -dideoxy- 3 -thiacytidine. Journal of Virology 1998; 72: Vergne L, Peeters M, Mpoudi-Ngole E, Bourgeois A, Liegeois F, Tourke-Kane C, Mboup S, Mulanga-Kabeya C, saman E, Jourdan J, Reynes J & Delaporte E. Genetic Diversity of protease and reverse transcriptase sequences in non-b human immunodeficiency virus type 1 strains: evidence of many minor drug resistance mutations in treatment-naive patients. Journal of Clinical Microbiology 2000; 38: Gunthard HF, Wong JK, Ignacio CC, Havlir DV & Richman DD. Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples. AIDS Research and Human Retroviruses 1998; 14: Schuurman R, Demeter L, Reichelderfer P, Tijnagel J, de Groot T & Boucher C. Worldwide evaluation of DNA sequencing approaches for identification of drug resistance mutations in the human immunodeficiency virus type 1 reverse transcriptase. Journal of Clinical Microbiology 1999; 37: Kaye S, Comber E, Tenant-Flowers M & Loveday C. The appearance of drug resistance-associated point mutations in HIV type 1 plasma RNA precedes their appearance in proviral DNA. AIDS Research and Human Retroviruses 1995; 11: Received 18 September 2000; accepted 11 December 2000 Antiviral Therapy 6:1 77