a surface permeabilized

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "a surface permeabilized"

Transcription

1 a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected to cell surface staining or membrane-permeabilized staining with anti- mab. Gray histograms show staining with the secondary reagent alone. (b) CD11b + Ly6G - monocytes in the peripheral blood from WT, Tlr7 -/-, or Unc93b1 3d/3d (3d) mice were stained with anti- mab. Shaded histograms show staining with the secondary reagent alone. These data are representative of three experiments. 1

2 a BM-MCs Loxoribine 5µM RNA9. 5µg/ml CpG-B 1nM TNFα[ng/ml] 3 1 6" 4" " " 1".5" " RANTES[ng/ml] 6"" 4"" "" "" (µg/ml) 6"" 4"" "" "" " " " anti- anti- anti- b BM-cDC Loxoribine 5µM RNA9. 5µg/ml + LF CpG-B 1nM TNFα[ng/ml] " 1" 3" " 1" 1" 5" RANTES[ng/ml] " 6" 4" " " (µg/ml) " 1" 5" " " " 1" " anti- anti- anti- c BM-pDC polyu 5µM+LF Loxoribine µm CpG-A µm IL1-p4[ng/ml] IL-6[ng/ml] 4"" "" ""."" 1."" 5."" ns 1".5""."" ".4"" ns ""."" 1""."" (µg/ml) 3 3 anti-."" 3 3 "" 3 3 anti- anti-

3 Supplementary Figure. Anti- mab inhibits responses. BM-MCs (a), BM-cDCs (b), and BM-pDCs (c) were stimulated with the indicated TLR ligands. Anti- mab or IgG1 mab was administered in culture. TNFα and RANTES (a, b) or IL-6 and IL1 p4 (c) were measured by ELISA. The results are represented by the mean plus SD from triplicate wells. These data are representative of three independent experiments. Statistical analyses were calculated with Student s t-test (***: p<.5; ns: not significant). BM-MCs 15- -F IB:N IB:StAv Supplementary Figure 3. Cell surface exists in the cleaved and full length forms. BM-MCs from WT, 3d or Tlr7 -/- mice were subjected to cell surface biotinylation at 4 C, 3

4 immunoprecipitation with anti- mab, and immunoblotting with anti-n Ab for total (left) or streptavidin for cell surface (right). F; full-length ; N, N-terminal cleaved fragment of. BM-cDCs 1m 3m 4hr IgG DAPI/Alexa488 Supplementary Figure 4. Anti- mab is internalized by BM-cDCs. BM-cDCs were incubated with Alexa Fluor 488-labeled IgG1 or anti- mab for the indicated periods of time at 37 C. The distribution of IgG1 or anti- mab was visualized by confocal microscopy. These data are representative of two independent experiments. Scale bar, 1 µm. 4

5 3T3 UNC93B1 BM-MCs! BM-cDCs! FcγRII/FcγRIII Supplementary Figure 5. Cell surface FcγR expression levels on NIH3T3 cells and BM-MCs. NIH3T3, BM-MCs and BM-cDCs were subjected to cell surface staining with anti- FcγRII/FcγRIII. Gray histograms show the staining buffer alone. These data are representative of two experiments. 5

6 Pull-down assay protein CL64- Biotin mab IgG - IP Strept-avidin IgG - prog F 5- IB:N IB:N Supplementary Figure 6. The effect of anti- mab on the interaction between the purified ectodomain and the ligand CL64. ectodomain protein (1 µg) was incubated with either anti- mab (1 µg) or control IgG1 (1 µg) for 1 hr. Biotinylated CL64 (1 µg) was then added. CL64 or IgG was precipitated by streptavidin or ProG Dynabeads, respectively. The precipitated ectodomain was detected using anti-n pab. F; full-length ; N, N-terminal cleaved fragment of. These data are representative of two independent experiments. 6

7 1 5 cdc CD11c pdc CD PDCA CD4 1 pdc CD4 + CD4 - CD8 - CD KI (cell surface) KI (permeabilized) Supplementary Figure 7. Cell surface expression of on splenic Unc93b1 D34A/D34A DCs. The left dot plot shows the expression of CD11c and PDCA-1 on splenic cells. The gates indicate pdcs and cdcs. The right dot plot shows the expression of CD4 and 7

8 CD8 on the cdcs indicated by the gate in the left dot plot. Histograms show cell surface (upper) or total (lower) expression on pdcs and the cdcs subsets from WT, Unc93b1 D34A/D34A (KI), or Tlr7 -/- mice. The gray histograms show the staining with the secondary reagent alone. These data are representative of two independent experiments. BM-MCs F IB:N IB:StAv Supplementary Figure 8. The full scanned image of the western blot shown in Figure 3a. 8

9 anti- (hr) IgG1 (hr) F F WCL Grb WCL Grb - - Supplementary Figure 9. The full scanned image of the western blot shown in Figure 4d. 9

10 BM-MCs F IB:N IB:StAv Supplementary Figure 1. The full scanned image of the western blot shown in Supplementary Figure 3. 1

11 Pull-down assay protein CL64- Biotin mab IgG - IP Strept-avidin IgG - prog F IB:N Supplementary Figure 11. The full scanned image of the western blot shown in Supplementary Figure 6. 11

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV)

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV) A mln NK Cells(x ) 6 1 * ndln NK Cells (x ) ns C Lung NK Cells(x ) 1 1 7 * D LN NK Cells (x ) 1 7 1 7 Days post-infection (A/PR/8) * * E Liver NK Cells (x ) 1 7 Days post-infection (A/PR/8) * * * 1 7 Days

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice SUPPLEMENTAL METHODS T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice Florian Wiede 1, Benjamin J. Shields 1, Sock Hui Chew 1, Konstantinos Kyparissoudis 2,

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

APOLs with low ph dependence can kill all African trypanosomes

APOLs with low ph dependence can kill all African trypanosomes SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41564-17-34-1 In the format provided by the authors and unedited. APOLs with low ph dependence can kill all African trypanosomes Frédéric Fontaine 1, Laurence

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Detection of Apoptosis in Primary Cells by Annexin V Binding Using the Agilent 2100 Bioanalyzer. Application Note

Detection of Apoptosis in Primary Cells by Annexin V Binding Using the Agilent 2100 Bioanalyzer. Application Note Detection of Apoptosis in Primary Cells by Annexin V Binding Using the Agilent 2100 Bioanalyzer Application Note Samuel D. H. Chan Marc Valer and Tobias Preckel, Introduction The Agilent 2100 bioanalyzer

More information

Rose et al. Supplementary Material. 1. Supplementary Materials and Methods

Rose et al. Supplementary Material. 1. Supplementary Materials and Methods Rose et al. Supplementary Material 1. Supplementary Materials and Methods 1.1. Synthesis of the biotinylated CrA modules. 1.1.1. Instrumentation and reagents: All solvents were purchased from Carl Roth

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

RayBio Human ENA-78 ELISA Kit

RayBio Human ENA-78 ELISA Kit RayBio Human ENA-78 ELISA Kit Catalog #: ELH-ENA78 User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

DC-SIGN Mediates Cell-Free Infection and Transmission of Human T-Cell Lymphotropic Virus Type 1 by Dendritic Cells

DC-SIGN Mediates Cell-Free Infection and Transmission of Human T-Cell Lymphotropic Virus Type 1 by Dendritic Cells JOURNAL OF VIROLOGY, Nov. 2009, p. 10908 10921 Vol. 83, No. 21 0022-538X/09/$12.00 doi:10.1128/jvi.01054-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. DC-SIGN Mediates Cell-Free

More information

Recombinant Integrins

Recombinant Integrins Recombinant Integrins Ligand INTEGRIN α subunit S S β subunit Recombinant Integrins Integrins are heterodimeric integral membrane proteins that play key roles in regulating cell-cell and cell-extracellular

More information

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD) Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

More information

Differential Response of Respiratory Dendritic Cell Subsets to Influenza Virus Infection

Differential Response of Respiratory Dendritic Cell Subsets to Influenza Virus Infection JOURNAL OF VIROLOGY, May 2008, p. 4908 4919 Vol. 82, No. 10 0022-538X/08/$08.00 0 doi:10.1128/jvi.02367-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Differential Response

More information

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes Diabetes Volume 64, April 2015 1341 Subha Karumuthil-Melethil, 1 M. Hanief Sofi, 2 Radhika Gudi, 3 Benjamin M. Johnson, 2 Nicolas Perez, 1 and Chenthamarakshan Vasu 2,3 TLR2- and Dectin 1 Associated Innate

More information

9-O-Acetylation of Sialomucins: A Novel Marker of Murine CD4 T Cells that Is Regulated during Maturation and Activation

9-O-Acetylation of Sialomucins: A Novel Marker of Murine CD4 T Cells that Is Regulated during Maturation and Activation 9-O-Acetylation of Sialomucins: A Novel Marker of Murine CD4 T Cells that Is Regulated during Maturation and Activation By Murli Krishna and Ajit Varki From the Glycobiology Program, UCSD Cancer Center,

More information

Optimization of an Adapta Kinase Assay for PIK3C2B (PI3K-C2 beta)

Optimization of an Adapta Kinase Assay for PIK3C2B (PI3K-C2 beta) Optimization of an Adapta Kinase Assay for PIK3C2B (PI3K-C2 beta) Overview This protocol describes how to perform an Adapta assay with the kinase PIK3C2B. To maximize the ability of the assay to detect

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

Optimizing Intracellular Flow Cytometry:

Optimizing Intracellular Flow Cytometry: Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Human Leptin ELISA Kit

Human Leptin ELISA Kit Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

Phenotype and function of nasal dendritic cells

Phenotype and function of nasal dendritic cells nature publishing group ARTICLES Phenotype and function of nasal dendritic cells H Lee 1,2, D Ruane 1,2,1, K Law 2,3,1,YHo 4, A Garg 1, A Rahman 2,5, D Esterházy 6, C Cheong 7, E Goljo 4, AG Sikora 8,

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Optimization of a LanthaScreen Kinase assay for CSF1R (FMS)

Optimization of a LanthaScreen Kinase assay for CSF1R (FMS) Optimization of a LanthaScreen Kinase assay for CSF1R (FMS) Overview This protocol describes how to develop a LanthaScreen kinase assay designed to detect and characterize kinase inhibitors. The development

More information

IMMUNOLOGY BIO 463 LABORATORY EXERCISE FALL 2015

IMMUNOLOGY BIO 463 LABORATORY EXERCISE FALL 2015 IMMUNOLOGY BIO 463 LABORATORY EXERCISE FALL 2015 IL-2 Production in mouse splenocytes INTRODUCTION Interleukin-2, or IL-2, is a potent cytokine produced by T-cells, stimulating their proliferation. As

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

Transcytosis of Retinol-Binding Protein across Renal Proximal Tubule Cells after Megalin (gp 330)-Mediated Endocytosis

Transcytosis of Retinol-Binding Protein across Renal Proximal Tubule Cells after Megalin (gp 330)-Mediated Endocytosis ARTICLES J Am Soc Nephrol 12: 637 648, 2001 Transcytosis of Retinol-Binding Protein across Renal Proximal Tubule Cells after Megalin (gp 330)-Mediated Endocytosis MICHELE MARINÓ,* DAVID ANDREWS,* DENNIS

More information

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit]

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit] MANUAL IL-1alpha (mouse) ELISA Kit [Interleukin-1 alpha (mouse) ELISA Kit] For research use only. Not for diagnostic use Version 1 (March-5-2013) Cat. No. AG-45B-0003-KI01 www.adipogen.com Table of Contents

More information

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20

More information

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit STAT3 (py705) (Human/Mouse/Rat) ELISA Kit Catalog Number KA2175 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT3 (py705) (Human/Mouse/Rat) ELISA (Enzyme-Linked

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

IL-15 regulates memory CD8 + T cell O-glycan synthesis and affects trafficking

IL-15 regulates memory CD8 + T cell O-glycan synthesis and affects trafficking Research article IL-15 regulates memory CD8 + T cell O-glycan synthesis and affects trafficking Jeffrey C. Nolz 1 and John T. Harty 1,2,3 1 Department of Microbiology, 2 Department of Pathology, and 3

More information

Supporting Information for:

Supporting Information for: Supporting Information for: Ultrasensitive Fluorescent Probes Reveal an dverse ction of Dipeptide Peptidase IV and Fibroblast ctivation Protein during Proliferation of Cancer Cells Qiuyu Gong,, Wen Shi,

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn. Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates

More information

Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells. by Regulating the Interaction of Tumor with its Immune Microenvironment

Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells. by Regulating the Interaction of Tumor with its Immune Microenvironment Supplementary Data for Kang et al. (Title) Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells by Regulating the Interaction of Tumor with its Immune Microenvironment Tae-Wook Kang 1,3,,

More information

Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint

Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint APPLICATION NOTE AlphaLISA Technology Authors: Matthew Marunde Stephen Hurt PerkinElmer, Inc. Hopkinton, MA Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint Introduction

More information

Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex.

Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. Figure Captions Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. A) XRD, B) Particle size distribution and zeta potential distribution of LDHs and 5- FU(10)/LDH nanohybrids,

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements with constitutive

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information

Protein disulfide isomerase acts as an injury response signal that enhances fibrin generation via tissue factor activation

Protein disulfide isomerase acts as an injury response signal that enhances fibrin generation via tissue factor activation Research article Protein disulfide isomerase acts as an injury response signal that enhances fibrin generation via tissue factor activation Christoph Reinhardt, 1 Marie-Luise von Brühl, 2 Davit Manukyan,

More information

Fisher et al. Supplemental Figure 1

Fisher et al. Supplemental Figure 1 Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000

More information

Human Immunodeficiency Virus type-1 p24 protein (HIV p24) Kit

Human Immunodeficiency Virus type-1 p24 protein (HIV p24) Kit TECHNICAL DATA SHEET AlphaLISA Research Reagents Caution: For Laboratory Use. A research chemical for research purposes only. Human Immunodeficiency Virus type-1 p24 protein (HIV p24) Kit Product No.:

More information

Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS:

Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS: Cancer Cell, Volume 18 Supplemental Information The Therapeutic Effect of Anti-HER2/neu Antibody Depends on Both Innate and Adaptive Immunity SaeGwang Park, Zhujun Jiang, Eric D. Mortenson, Liufu Deng,

More information

Supporting Information

Supporting Information Translation of DNA into Synthetic N-Acyloxazolidines Xiaoyu Li, Zev. J. Gartner, Brian N. Tse and David R. Liu* Department of Chemistry and Chemical Biology, Harvard University, Cambridge, Massachusetts

More information

Eukaryotic elongation factor 2 controls TNF-α translation in LPS-induced hepatitis

Eukaryotic elongation factor 2 controls TNF-α translation in LPS-induced hepatitis Research article Eukaryotic elongation factor 2 controls TNF-α translation in LPS-induced hepatitis Bárbara González-Terán, 1 José R. Cortés, 1 Elisa Manieri, 1,2 Nuria Matesanz, 1 Ángeles Verdugo, 1,2

More information

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.

More information

Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples

Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Patient ID Age (yrs) BIC classification * HGVS classification # 1 2 BRCA1 del exon BRCA1g.71598-?_71681+?del

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

Eosinophil Recruitment to the Lung in a Murine Model of Allergic Inflammation

Eosinophil Recruitment to the Lung in a Murine Model of Allergic Inflammation Eosinophil Recruitment to the Lung in a Murine Model of Allergic Inflammation The Role of T Cells, Chemokines, and Adhesion Receptors Jose-Angel Gonzalo,* Clare M. Lloyd,* Leonor Kremer, Elizabeth Finger,*

More information

Foxp3-positive Macrophages Display Immunosuppressive Properties and Promote Tumor Growth

Foxp3-positive Macrophages Display Immunosuppressive Properties and Promote Tumor Growth Foxp3-positive Macrophages Display Immunosuppressive Properties and Promote Tumor Growth The Harvard community has made this article openly available. Please share how this access benefits you. Your story

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 3 ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Staining of human whole blood with the ezkine Th1/Th17 Whole Blood Intracellular

More information

Purification and Fluorescent Labeling of Exosomes Asuka Nanbo 1*, Eri Kawanishi 2, Ryuji Yoshida 2 and Hironori Yoshiyama 3

Purification and Fluorescent Labeling of Exosomes Asuka Nanbo 1*, Eri Kawanishi 2, Ryuji Yoshida 2 and Hironori Yoshiyama 3 Purification and Fluorescent Labeling of Exosomes Asuka Nanbo 1*, Eri Kawanishi 2, Ryuji Yoshida 2 and Hironori Yoshiyama 3 1 Graduate School of Medicine, Hokkaido University, Sapporo, Japan; 2 Graduate

More information

MagniSort Mouse CD4 Naive T cell Enrichment Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

MagniSort Mouse CD4 Naive T cell Enrichment Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 2 MagniSort Mouse CD4 Naive T cell Enrichment Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse splenocytes were unsorted (left) or sorted with the MagniSort Mouse CD4

More information

Induction of granulysin in CD8 T cells by IL-21 and IL-15 is suppressed by human immunodeficiency virus-1

Induction of granulysin in CD8 T cells by IL-21 and IL-15 is suppressed by human immunodeficiency virus-1 Article Induction of granulysin in T cells by and is suppressed by human immunodeficiency virus-1 A. E. Hogg, G. C. Bowick,, N. K. Herzog, M. W. Cloyd,, and J. J. Endsley,,1 Departments of Microbiology

More information

IL-12 upregulates TIM-3 expression and induces T cell exhaustion in patients with follicular B cell non-hodgkin lymphoma

IL-12 upregulates TIM-3 expression and induces T cell exhaustion in patients with follicular B cell non-hodgkin lymphoma Research article IL-12 upregulates TIM-3 expression and induces T cell exhaustion in patients with follicular B cell non-hodgkin lymphoma Zhi-Zhang Yang, 1 Deanna M. Grote, 1 Steven C. Ziesmer, 1 Toshiro

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

mtor and MEK1/2 inhibition differentially modulate tumor growth and the immune microenvironment in syngeneic models of oral cavity cancer

mtor and MEK1/2 inhibition differentially modulate tumor growth and the immune microenvironment in syngeneic models of oral cavity cancer Washington University School of Medicine Digital Commons@Becker Open Access Publications 2015 mtor and MEK1/2 inhibition differentially modulate tumor growth and the immune microenvironment in syngeneic

More information

A Reciprocal Interdependence between Nck and PI(4,5)P 2 Promotes Localized N-WASp-Mediated Actin Polymerization in Living Cells

A Reciprocal Interdependence between Nck and PI(4,5)P 2 Promotes Localized N-WASp-Mediated Actin Polymerization in Living Cells Molecular Cell, Volume 36 Supplemental Data A Reciprocal Interdependence between Nck and PI(4,5)P 2 Promotes Localized N-WASp-Mediated Actin Polymerization in Living Cells Gonzalo M. Rivera, Dan Vasilescu,

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information