TGTTAGATTCAGAGTCGCTAGCTAGCTAGCTATATTCTCGTATAGACTATCGTAGCGC-3 3 -ACAATCTAAGTCTCAGCGATCGATCGATCGATATAAGAGCATATCTGATAGCATCGCG-5

Transcription

1 LS1a Problem Set #5 Due Friday 11/3 by noon in your TF s drop box on the 2 nd floor of the Science Center All questions including (*extra*) ones must be answered 1. If you recall from last week, nerve impulses are transmitted across neurons through the release of neurotransmitter molecules. The neurotransmitter molecules diffuse across the space between the neurons (synapse) and bind to neurotransmitter receptors, which in turn propagate the nerve impulse into the neurotransmitter receiving neuron. N + N DiI a. In neurons where the plasma membrane has been labeled with DiI, DiI fluorescence is initially only seen at the cell surface. However given enough time, DiI fluorescence will also be observed in vesicles inside the cell. Explain how this could occur. b. Fusion proteins are used to study how neurotransmitters are released and cleared from the synapse. If a vesicle associated membrane protein fused to GFP (VAMP-GFP) is expressed in the neuron, fluorescence is strongly observed on vesicles inside the cell near the synapse. If one observes carefully the fluorescence is on the cytosol facing side of the vesicles. Where else in the diagram below would you predict to see GFP fluorescence? Indicate whether the fluorescence you would observe would be on the cytosolic or lumenal side of various organelles if possible. Explain. 1

2 c. To further investigate the cellular localization of VAMP, a short fusion protein (svamp- GFP) consisting of the first 20 amino acids of VAMP connected to GFP is made. When expressed in cells, fluorescence from svamp-gfp is observed on the cytosol facing side of vesicles. However when the GFP protein is expressed alone fluorescence is observed only in the cytoplasm. Based on this information, is the 20 amino acid segment of VAMP necessary and sufficient for targeting to vesicles? Explain. d. If the VAMP-GFP fusion protein is now modified to remove the first 20 amino acids from VAMP (Δ20VAMP-GFP) and expressed in neurons, GFP fluorescence is observed only in the cytoplasm. Does the information from parts b through d indicate whether or not this 20 amino acid segment is necessary and sufficient for targeting to vesicles? Explain. 2

3 2. You have identified a new sigma factor native to a bacterium only found in the Charles River, which you have named σ ls. You have found that σ ls binds to the promoter of a gene important for adaptation of the bacteria to abrupt changes in the weather. You have decided to name this effect, the Cambridge Shock Response. The sequence of this gene whose expression is regulated by σ ls is shown below TGTTAGATTCAGAGTCGCTAGCTAGCTAGCTATATTCTCGTATAGACTATCGTAGCGC-3 3 -ACAATCTAAGTCTCAGCGATCGATCGATCGATATAAGAGCATATCTGATAGCATCGCG-5 5 -TGTTAGAAGCCGGCCAGATCCGCTGGCCGGCATTTTAACTCTCTCTTA-3 3 -ACAATCTTCGGCCGGTCTAGGCGACCGGCCGTAAAATTGAGAGAGAAT-5 a) Please label the template and coding strands b) In what direction is RNA synthesized, 5 to 3 or 3 to 5? c) In what direction is RNA polymerase traveling along the template DNA strand, 5 to 3 or 3 to 5? d) Write the sequence of the first 10 bases of the mrna. Label the 5 and 3 ends. e) Please identify (with boxes) the features in the sequence above that aid in termination of transcription and explain how they help accomplish termination. 3

4 f) You would like to identify more genes that are regulated by σ ls and required for the Cambridge Shock Response. Would you predict that σ ls would be able to bind and recruit RNA polymerase to the following promoters? Briefly explain your reasoning. Promoter 1 5 -TGTTAGATTCAGAGTCGCTAGCTAGCTAGCTATATTCTCGTATAGACTATCGTAGCGC-3 3 -ACAATCTAAGTCTCAGCGATCGATCGATCGATATAAGAGCATATCTGATAGCATCGCG-5 Promoter 2 5 -TGTTAGATTCAGAGTCGCTAGCAATATAGCTATATTCTCGTATAGTCTGAAGTAGCGC-3 3 -ACAATCTAAGTCTCATCGATCGTTATATCGATATAAGAGCATATCAGACTTCATCGCG-5 Promoter 3 5 -TGTTAGATTCAGAGTCGGTATATTCTAGCCTCGTATAGAGCATCTACTATCGTAGCGC-3 3 -ACAATCTAAGTCTCAGCCATATAAGATCGGAGCATATCTCGTAGATGATAGCATCGCG-5 Promoter 4 5 -TGTTAGATTCAGAGTCGCTAGCTTATATGCTATATTCTCGTATAGTCTGAAGTAGCGC-3 3 -ACAATCTAAGTCTCATCGATCGAATATACGATATAAGAGCATATCAGACTTCATCGCG-5 Promoter 5 5 -TGTTAGACCTGGAGTCGCTAGCTAGCTAGCTATATTCTCGTATAGACTATCGTAGCGC-3 3 -ACAATCTGGACCTCAGCGATCGATCGATCGATATAAGAGCATATCTGATAGCATCGCG-5 4

5 3. The Tat protein is necessary for efficient replication of HIV. Tat binds to TAR, a sequence contained in the RNA transcribed from the integrated HIV genome. Binding of Tat to TAR increases the efficiency of transcription of the viral genome by making RNA polymerase less likely to dissociate from the DNA template before transcription is complete. To investigate the role of TAR in transcription, you use Cyan Fluorescent Protein (CFP) reporter gene constructs. You insert TAR at each of the three positions shown below to create the TAR-containing genes A, B and C. You express genes A, B and C separately in uninfected human cells. Promote r Tr anscriptional Start CFP Coding Sequenc e Tr anscriptional Termination Sequence Normal Gene TAR Pr omoter Transcriptiona l Start CFP Coding Sequenc e Tr anscriptional Termination Sequenc e Gene A Tr anscriptiona l Promoter Start TAR CFP Coding S equenc e Transcriptiona l Terminatio n Sequenc e Gene B Promote r Tr anscriptional Start CFP Coding Sequenc e TAR Transcriptiona l Termination Sequenc e Gene C a) If you express genes A, B, and C separately in UNINFECTED human cells, which if any will lead to enhanced transcription of CFP? Explain your answer. b) If you express genes A, B and C separately in HIV-infected human cells, which if any will lead to enhanced transcription of CFP? Explain your answer. 5

6 c) In an effort to develop methods to block HIV replication, researchers synthesized a chemically modified RNA analog that is complementary in sequence to TAR. They found that HIV-infected cells injected with this analog replicated HIV RNA poorly. Propose a mechanism for this inhibition. d) In another attempt to block HIV replication, researchers created a gene that contains a promoter followed by DNA encoding 50 copies of TAR in a row and a termination sequence. Cells infected with HIV and possessing this gene also transcribed viral RNA poorly. Propose a mechanism for this inhibition. 4. Vibrio cholerae is a bacterium that secretes a toxic protein called cholera toxin (CT). When a person consumes drinking water contaminated by Vibrio cholerae, the bacteria secrete the CT protein, which is able to enter the cytoplasm of cells lining the intestine, causing the symptoms that characterize the disease cholera. Remarkably, CT enters the cytoplasm of intestinal cells by moving backwards through the secretory pathway. The major transport events are labeled i-iv in the schematic illustration below. Plasma membrane CT i ii iii iv endosomes Golgi ER cytoplasm When cells are briefly treated with fluorescently labeled CT and visualized 30 minutes later, all of the CT is observed in the Golgi. When cells are visualized 120 minutes after CT treatment, all of the CT is observed in the ER. a) Why is the location of the CT fluorescence different at 30 minutes versus 120 minutes after treatment? 6

7 You want to determine which of the transport processes involve COP I protein coats. To investigate which of the transport steps, i-iv, require COP I protein coats, you inject antiβcop, a protein that interferes with COP I coat formation prior to treatment with CT. After 120 minutes, you observe CT in the Golgi. b) Based on this experiment, complete the chart below to indicate what you can conclude about the COP I-dependence of processes i-iv. Step COP I required COP I not required can't tell i: Uptake ii: Endosome to Golgi transport iii: Golgi to ER transport iv: ER to cytoplasm transport c) In your next experiment, you treat the cells briefly with CT, and wait 30 minutes before injecting them with anti-βcop. When you visualize the cells after 120 minutes, you observe that CT is located in the Golgi. Based on this experiment, can you make any additional conclusions to those made in part (b)? Briefly explain. d) (*extra*) As you learned in lecture, traffic through the secretory pathway occurs in both directions. However, as noted in the introduction to this question, 120 minutes after treatment with CT, all of the CT is observed in the ER. What property of the CT protein could account for this observed unidirectionality of transport? Briefly explain. e) CT is able to pass from the ER into the cytoplasm, where it exerts its toxic effect. The drug Brefeldin A is known to inhibit COP I coat formation. When cells are treated with Brefeldin A, they become resistant to the toxic effects of CT because CT gets trapped in the Golgi and never enters the cytoplasm. However, Brefeldin A is not used therapeutically for treating cholera patients. Why not? 7

8 5. Hi! My name s Alisa, and I m a senior Biochemical Sciences concentrator in Adams House. I ve been through it all chemistry, biology, physics. If your first test didn t go as well as you wanted, I know how you feel. Life sciences can be overwhelming. My first test in sophomore chemistry was horrendous, but I learned valuable lessons that semester that helped me understand the material and do well at the end. Here are some tips that could help you: 1. Don t have time to do all the reading and practice problems? Do the problems. You ll learn concepts along the way. Don t get me wrong. You still need to go to all the lectures and do some reading (especially for biology) but don t let the textbook bog you down. 2. What do I mean by *do* the problems. First try the problem yourself. If you don t get it immediately don t panic. Write down everything you know. Then grab your notes/textbook and identify the general topics and come up with an answer. Write the answer out fully. Afterwards, check your answers with others. 3. Redo the problems. 4. Here s how to take a practice midterm. Get a black pen and fill out all the answers you can without looking at your notes/book. Don t be afraid to guess! Take a break. Then get a blue pen and use your books to answer or correct questions until you feel like you ve gone through everything and marked something down. Take another break. Then get a red pen and go through all the answers and write them down in your own words if you got a question wrong. This is how I would approach life sciences weekly: Sun Mon Tues Wed Thurs Fri Sat Attend Attend Lecture Lecture Try first 2-3 pset problems on your own. Check with others at Study Network 7-9 PM Try 2 more pset problems on your own. Spend ½ to 1 hour going over lecture notes. Finish last few pset problems on your own.. Work with other students at Study Network. Here s what I would do the week before the midterm: Review all lecture notes for 1 hour Print out a blank pset and redo it. Study Network Study 1 st third of lectures. Print out a blank pset and redo it. Study 2 nd third of lectures. Do practice problem sheets given out at study network. Spend ½ hour to 1 hour going over lecture notes. Print out a blank pset and redo it. Take Practice Midterm 2 and check answers. (see advice #4) PSET Due Relax! (seriously) Tues Wed Thurs Fri Sat Sun Mon Attend Lecture Take Practice Midterm 1 Attend Lecture Check answers for Study final 3 rd Review (see advice midterm 1 of lectures. #4) Midterm! Print out any remaining psets and redo them. Sleep at least 8 hours. Who loves life sciences?! You do! 8

9 You have to find what works best for you. Here are the approaches of two of the other LS1a facilitators. Penny (a junior Biology concentrator) on a normal week Sun Mon Tues Wed Thurs Fri Sat Look over answers to pset (write down what I missed next to each Q) Read book for lecture, highlight Go to lecture Start the pset do as much as I can Read book for lecture, highlight Go to lecture Compare, finish pset with friends Do some practice problems Check course website for announcements Read through lecture notes, watch parts of lecture videos to fill in gaps in notes Make list of specific points I do not understand (to ask TF) Former LS1a student (sophomore) on a normal week Early evening: talk through lecture notes to myself, cover up and redo examples Look through short video segments of parts I didn t understand in class Penny the week before an exam Tues Wed Thurs Fri Sat Sun Mon Go to lecture Do practice Go to lecture problems (2 hours) Midterm Read the textbook; write down any questions from the text on a paper to ask my TF. Redo psets by glancing over and saying the answer (about 20 min/pset) Do practice midterm w/o looking at notes until the end, go through answers (2 hours) Read through what I ve circled and highlighted in the lecture notes, look back over problems I ve missed, check course website for midterm announcments Go to review session and ask the questions I ve written down (2.5 hours), look over formulas Sun Mon Tues Wed Thurs Fri Sat Attend Flip through Attend lecture lecture the pset, armed with start it, find a Compare or the printed group to do finish pset with slides to take it with. friends or at notes on. Study Network Early evening: talk through lecture notes to myself, and review my slides with the notes I took that week. Look over section problems and other practice problems, if there s time, and re-do anything I couldn t do the first time (without looking at the answers). Former LS1a student the week before an exam Tues Wed Thurs Fri Sat Sun Mon Attend lecture Make a list of everything I need to get done (specifically, listing all the reading and everything) before Midterm. Read again through the lecture slides with my notes, writing any questions on a piece of paper. Attend lecture Read through my lecture notes (with the professors notes). Write questions down. Do practice problems posted online, check. Do any missed textbook reading. Re-do all section problems and pset problems without looking at answers. Practice Midterm 1. Check all answers. *** Review anything I feel I need to. Practice Midterm 2. Check. Ask questions to TF. Get a good night s sleep. *** Eat a good dinner. Take midterm *** Definitely go the Review Sessions offered to you before a midterm, but don t expect that by themselves they ll be sufficient. In fact, Review Sessions work best if you ve done your studying already, so you can gauge how much you know your material and what concepts you re still struggling to tackle. Want to know more? Visit us at Study Network on Sunday, Wednesday, and Thursday evenings! 9

10 And now for you.(note: this is not an extra problem!!!!!!) How do you approach life sciences weekly?: Sun Mon Tues Wed Thurs Fri Sat What did you do the week before the first midterm: Tues Wed Thurs Fri Sat Sun Mon 10