Supplementary Materials for

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary Materials for"

Transcription

1 Supplementary Materials for The adhesion molecule PECAM-1 enhances the TGF- mediated inhibition of T cell function Debra K. Newman,* Guoping Fu, Tamara Adams, Weiguo Cui, Vidhyalakshmi Arumugam, Theresa Bluemn, Matthew J. Riese* *Corresponding author. (D.K.N.); (M.J.R.) The PDF file includes: Published 8 March 216, Sci. Signal. 9, ra27 (216) DOI: /scisignal.aad1242 Fig. S1. PECAM-1 enhances the TGF- mediated inhibition of mouse T cells stimulated with anti-cd3 and anti-cd28 antibodies. Fig. S2. PECAM-1 enhances the inhibition of mouse T cell function by low, but not high, concentrations of TGF-. Fig. S3. PECAM-1 enhances the TGF- mediated inhibition of human T cells stimulated with OKT3 and anti-cd28. Fig. S4. PECAM-1 enhances the inhibition of human T cell function by low, but not high, concentrations of TGF-. Fig. S5. The ability of PECAM-1 to enhance the TGF- mediated inhibition of human T cells requires the binding of TGF- to its receptor and activation of the kinase activity of TGF- RI/II. Fig. S6. Colocalization of PECAM-1 and TGF- RI requires the binding of TGF- to its receptor and activation of the kinase activity of TGF- RI/II. Fig. S7. PECAM-1 is expressed on the surface of T cells purified from wild-type, but not PECAM-1 /, mice.

2 Peak (Undivided Cells) % CFSE-positive Events % Granzyme B- positive Events A [TGF-b] (ng/ml) PECAM-1 +/+ PECAM-1 -/- Granzyme B Fluorescence B 1 1 ** C % Granzyme-B positive *** [TGF-b] (ng/ml) TGFb (ng/ml) 1.5 PECAM-1 +/+ PECAM-1 -/- 4.5 PECAM-1 +/+ PECAM-1 -/- Peak 4 Peak 3 Peak 2 Peak 1 Peak D Peak (Undivided cells) % CFSE-positive CFSE Fluorescence PECAM-1 +/+ PECAM-1 -/ *** +/+ -/ [TGF-b] (ng/ml) TGFb (ng/ml)

3 Fig. S1. PECAM-1 enhances the TGF-β mediated inhibition of mouse T cells stimulated with anti-cd3 and anti-cd28 antibodies. (A to D) CD8 + T cells (A and B) and CD4 + T cells (C and D) purified from PECAM-1 +/+ and PECAM-1 -/- mice were stimulated for 72 hours with plate-bound anti-cd3 antibody (1 g/ml for CD8 + T cells; 2.5 g/ml for CD4 + T cells) and anti- CD28 (1 g/ml) in the presence of the indicated concentrations of TGF-β. (A and B) Granzyme B synthesis by CD8 + T cells was analyzed by flow cytometry. Numbers in the histograms (A) indicate the percentages of cells that fell within the indicated gates. (B) Quantitative analysis of the percentages of cells that were positive for granzyme B. Data are means ± SD of three independent experiments. (C and D) The proliferation of CD4 + T cells was analyzed by flow cytometry. Numbers in the histograms (C) indicate the percentages of cells associated with the indicated peaks. (D) Quantitative analysis of the percentage of CFSE-positive (undivided) cells. Data are means ± SD of two independent experiments. **P <.1, ***P <.1, P <.1.

4 Fig. S2. PECAM-1 enhances the inhibition of mouse T cell function by low, but not high, concentrations of TGF-β. (A and B) CD8 + T cells purified from PECAM-1 +/+ mice (closed bars) and PECAM-1 -/- mice (open bars) were stimulated for 72 hours with plate-bound anti-cd3 in the presence of the indicated concentrations of TGF-β. (A) Granzyme B synthesis was analyzed by flow cytometry. Quantitative analysis of the percentages of cells that were positive for granzyme B. Data are means ± SD of three independent experiments. (B) Cell culture medium was analyzed by ELISA to determine the concentration of secreted IFN-. Data are means ± SD of two independent experiments. *P <.5, **P <.1, ***P <.1, P <.1.

5 Peak (Undivided Cells) % CFSE-positive Events % Granzyme B- positive Events A [TGF-b] (ng/ml) PECAM-1-positive PECAM-1-negative Granzyme B Fluorescence B ** [TGF-b] (ng/ml) C PECAM-1-positive Peak Peak 2 Peak 1 Peak 3 PECAM-1-negative CFSE Fluorescence D 1 * * * PECAM-positive PECAM-negative *** [TGF-b] (ng/ml)

6 Fig. S3. PECAM-1 enhances the TGF-β mediated inhibition of human T cells stimulated with OKT3 and anti-cd28. (A to D) CD8 + T cells (A and B) and CD4 + T cells (C and D) purified from the peripheral blood of healthy adult volunteers were separated into PECAM-1 positive (closed bars) and PECAM-1 negative (open bars) populations and then were stimulated for 72 hours with plate-bound OKT3 (2.5 g/ml) and anti-cd28 (2.5 g/ml) in the presence of the indicated concentrations of TGF-β. (A and B) Granzyme B synthesis by CD8 + T cells was analyzed by flow cytometry. Numbers in the histograms (A) indicate the percentages of cells that fell within the indicated gates. (B) Quantitative analysis of the percentages of cells that were positive for granzyme B. Data are means ± SD of three independent experiments. (C and D) The proliferation of CD4 + T cells was analyzed by flow cytometry. Numbers in the histograms (C) indicate the percentages of cells associated with the indicated peaks. (D) Quantitative analysis of the percentage of CFSE-positive (undivided) cells. Data are means ± SD of three independent experiments. *P <.5, **P <.1, P <.1.

7 Fig. S4. PECAM-1 enhances the inhibition of human T cell function by low, but not high, concentrations of TGF-β. (A and B) Human PECAM-1-positive (closed bars) and PECAM-1- negative (open bars) CD8 + T cells were purified from peripheral blood and stimulated for 72 hours with plate-bound anti-cd3 in the presence of the indicated concentrations of TGF-β. (A) Granzyme B synthesis was analyzed by flow cytometry. Quantitative analysis of the percentages of cells that were positive for granzyme B. Data are means ± SD of three independent experiments. (B) Cell culture medium was analyzed by ELISA to determine the concentration of secreted IFN-. Data are means ± SD of three independent experiments. **P <.1, ***P <.1, P <.1.

8 (Fig. S5)

9 Fig. S5. The ability of PECAM-1 to enhance the TGF-β mediated inhibition of human T cells requires the binding of TGF-β to its receptor and activation of the kinase activity of TGF-βRI/II. (A to D) Human PECAM-1-positive (closed bars) and PECAM-1-negative (open bars) CD8 + T cells (A and B) and CD4 + T cells (C and D) were cultured in the presence or absence of plate-bound anti-cd3 (2.5 g/ml) and the indicated concentrations of TGF-β in the

10 absence of inhibitors or in the presence of the ALK5 inhibitor SB (5 g/ml) or the antihtgfβ-iga neutralizing monoclonal antibody maba-htgfβ (5 ng/ml), as indicated. (A and C) Cell culture medium was analyzed by ELISA to determine the concentration of secreted IFN-. Data are means ± SD of two independent experiments. (B) Granzyme B synthesis was analyzed by flow cytometry. Quantitative analysis of the percentages of cells that were positive for granzyme B. Data are means ± SD of three independent experiments. (D) The proliferation of T cells was analyzed by flow cytometry. Data are means ± SD of the percentages of CFSE-positive (undivided) cells from two independent experiments. *P <.5, **P <.1, ***P <.1, P <.1.

11 Unactivated anti-cd3 + TGF-b anti-cd3 + TGF-b + SB anti-cd3 + TGF-b + maba-htgf-b Fig. S6. Colocalization of PECAM-1 and TGF-βRI requires the binding of TGF-β to its receptor and activation of the kinase activity of TGF-βRI/II. Human T cells were cultured in the presence or absence of plate-bound anti-cd3 (2.5 g/ml) and TGF-β (4.5 ng/ml) alone or in the presence of SB (5 g/ml) or maba-htgfβ (5 ng/ml). Cells were fixed and subjected to PLA with oligonucleotide-tagged antibodies specific for PECAM-1 (PECAM-1.3) and TGFβRI. Red indicates PECAM-1- and TGFβR-specific antibodies within 4 nm of each other. Data are representative of three independent experiments.

12 A) CD4+ B) CD8+ WT KO PECAM-1 Fluorescence Fig. S7. PECAM-1 is expressed on the surface of T cells purified from wild-type, but not PECAM-1 /, mice. (A and B) Representative histograms of CD4 + T cells (A) and CD8 + T cells (B) T cells purified from wild-type (WT) and PECAM-1 / (KO) mice and stained with an antibody specific for mouse PECAM-1. Data are representative of six independent experiments.

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/8/333/333ra47/dc1 Supplementary Materials for Androgen receptor antagonists compromise T cell response against prostate cancer leading to early tumor

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Examples of questions for Cellular Immunology/Cellular Biology and Immunology

Examples of questions for Cellular Immunology/Cellular Biology and Immunology Examples of questions for Cellular Immunology/Cellular Biology and Immunology Each student gets a set of 6 questions, so that each set contains different types of questions and that the set of questions

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplemental Information. Human CD1c + Dendritic Cells Drive. the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF-

Supplemental Information. Human CD1c + Dendritic Cells Drive. the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF- Immunity, Volume 38 Supplemental Information Human CD1c + Dendritic Cells Drive the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF- Chun I. Yu Christian Becker Yuanyuan

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

The Adaptive Immune Responses

The Adaptive Immune Responses The Adaptive Immune Responses The two arms of the immune responses are; 1) the cell mediated, and 2) the humoral responses. In this chapter we will discuss the two responses in detail and we will start

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

CD4 + CD25 high Foxp3 + T regulatory cells kill autologous CD8(+) and CD4(+) T cells using Fas/FasL- and Granzyme B- mediated pathways

CD4 + CD25 high Foxp3 + T regulatory cells kill autologous CD8(+) and CD4(+) T cells using Fas/FasL- and Granzyme B- mediated pathways CD4 + CD25 high Foxp3 + T regulatory cells kill autologous CD8(+) and CD4(+) T cells using Fas/FasL- and Granzyme B- mediated pathways Laura Strauss, Christoph Bergmann, Theresa L. Whiteside University

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Optimizing Intracellular Flow Cytometry:

Optimizing Intracellular Flow Cytometry: Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription

More information

VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses. Li Wang. Dartmouth Medical School

VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses. Li Wang. Dartmouth Medical School VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses Li Wang Dartmouth Medical School The B7 Immunoglobulin Super-Family immune regulators APC T cell Co-stimulatory:

More information

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Maia Tato, Santhosh V. Kumar, Yajuan Liu, Shrikant R. Mulay, Solange Moll, Bastian Popper,

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Supplementary Figure 1 Maschalidi et al.

Supplementary Figure 1 Maschalidi et al. a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells

Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells Research article Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells Chen Wang, 1 Tai Yi, 1 Lingfeng Qin, 2 Roberto A. Maldonado, 3 Ulrich H. von Andrian, 3

More information

Simultaneous correlation of cytokine production with Treg and Th17 cell proliferation

Simultaneous correlation of cytokine production with Treg and Th17 cell proliferation Simultaneous correlation of cytokine production with Treg and Th17 cell proliferation Jurg Rohrer, PhD Director, R&D BD Biosciences 23-11773-00 For Research Use Only. Not for use in diagnostic or therapeutic

More information

Chemotherapy enhances tumor cell susceptibility to CTL-mediated killing during cancer immunotherapy in mice

Chemotherapy enhances tumor cell susceptibility to CTL-mediated killing during cancer immunotherapy in mice Chemotherapy enhances tumor cell susceptibility to CTL-mediated killing during cancer immunotherapy in mice Rupal Ramakrishnan,, Esteban Celis, Dmitry I. Gabrilovich J Clin Invest. 2010;120(4):1111-1124.

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn. Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal

More information

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

Recombinant Integrins

Recombinant Integrins Recombinant Integrins Ligand INTEGRIN α subunit S S β subunit Recombinant Integrins Integrins are heterodimeric integral membrane proteins that play key roles in regulating cell-cell and cell-extracellular

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Fisher et al. Supplemental Figure 1

Fisher et al. Supplemental Figure 1 Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000

More information

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Cytotoxicity assays Rory D. de Vries, PhD 1 1 Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Anti-influenza immunity Humoral / CD4+ / CD8+ / NK? Function of CTL Elimination of virus-infected cells?

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Kelly A. Curtis, M. Susan Kennedy, Kevin Delaney, Man Charurat, and S. Michele Owen

Kelly A. Curtis, M. Susan Kennedy, Kevin Delaney, Man Charurat, and S. Michele Owen Kelly A. Curtis, M. Susan Kennedy, Kevin Delaney, Man Charurat, and S. Michele Owen Division of HIV/AIDS Prevention, Centers for Disease Control and Prevention, Atlanta, GA Advantages: Obvious evolution

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Inflammatory IL-15 is required for optimal memory T cell responses

Inflammatory IL-15 is required for optimal memory T cell responses The Journal of Clinical Investigation Research article Inflammatory IL-15 is required for optimal memory T cell responses Martin J. Richer, 1 Lecia L. Pewe, 1 Lisa S. Hancox, 1 Stacey M. Hartwig, 1 Steven

More information

A second type of TCR TCR: An αβ heterodimer

A second type of TCR TCR: An αβ heterodimer How s recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about function was known, but the receptor genes had not been identified Recall

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Naive, memory and regulatory T lymphocytes populations analysis

Naive, memory and regulatory T lymphocytes populations analysis Naive, memory and regulatory T lymphocytes populations analysis Jaen Olivier, PhD ojaen@beckmancoulter.com Cellular Analysis application specialist Beckman Coulter France Introduction Flow cytometric analysis

More information

Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma

Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma Pei-Song Gao, MD, PhD Division of Allergy & Clinical Immunology Johns Hopkins University School

More information

Essential role of the TNF-TNFR2 cognate interaction in mouse dendritic cell natural killer cell crosstalk

Essential role of the TNF-TNFR2 cognate interaction in mouse dendritic cell natural killer cell crosstalk From www.bloodjournal.org by guest on April 11, 218. For personal use only. IMMUNOBIOLOGY Essential role of the TNF-TNFR2 cognate interaction in mouse dendritic cell natural killer cell crosstalk Jun Xu,

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different

More information

See external label 2 C 8 C 96 tests B-HCG (Total) Cat #

See external label 2 C 8 C 96 tests B-HCG (Total) Cat # DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite D/E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external

More information

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.

More information

IMMUNITY AND DISEASE II

IMMUNITY AND DISEASE II IMMUNITY AND DISEASE II A. Evolution of the immune system. 1. Figure 1--57.25, p. 1167 from Raven and Johnson Biology 6 th ed. shows how the immune system evolved. Figure 1. How the immune system evolved.

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Additional file 6. Summary of experiments characterizing development of adaptive immune response

Additional file 6. Summary of experiments characterizing development of adaptive immune response Additional file 6. Summary of experiments characterizing development of adaptive immune response Tests performed to evaluate the development of adaptive immunity in patients are summarized in Table 1.

More information

Categorical analysis of human T cell heterogeneity with One-SENSE

Categorical analysis of human T cell heterogeneity with One-SENSE 1 2 3 4 Supplementary Information Categorical analysis of human T cell heterogeneity with One-SENSE 5 6 Running title: T cell Analysis by One-SENSE 7 8 9 1 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 26

More information

Cell-mediated Immunity

Cell-mediated Immunity Cellular & Molecular Immunology Cell-mediated Immunity Nicholas M. Ponzio, Ph.D. Department of Pathology & Laboratory Medicine April 6, 2009 Today s Presentation: Overview Cellular Interactions In Humoral

More information

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes Diabetes Volume 64, April 2015 1341 Subha Karumuthil-Melethil, 1 M. Hanief Sofi, 2 Radhika Gudi, 3 Benjamin M. Johnson, 2 Nicolas Perez, 1 and Chenthamarakshan Vasu 2,3 TLR2- and Dectin 1 Associated Innate

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Patients with knee OA and with joint pain, stiffness and/or functional impairment interfering

Patients with knee OA and with joint pain, stiffness and/or functional impairment interfering Supplementary Material to Alunno et al. Platelets Contribute to the Accumulation of Matrix Metalloproteinase Type 2 in Synovial Fluid in Osteoarthritis (https://doi.org/10.1160/th17-06-0379) Supplemental

More information

Pathogenic virus-specific T cells cause disease during treatment with the calcineurin inhibitor FK506: implications for transplantation

Pathogenic virus-specific T cells cause disease during treatment with the calcineurin inhibitor FK506: implications for transplantation Pathogenic virus-specific T cells cause disease during treatment with the calcineurin inhibitor FK506: implications for transplantation Koichi Araki, Emory University Shivaprakash Gangappa, Emory University

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,

More information

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV)

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV) A mln NK Cells(x ) 6 1 * ndln NK Cells (x ) ns C Lung NK Cells(x ) 1 1 7 * D LN NK Cells (x ) 1 7 1 7 Days post-infection (A/PR/8) * * E Liver NK Cells (x ) 1 7 Days post-infection (A/PR/8) * * * 1 7 Days

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa

More information

Normally occurring NKG2D + CD4 + T cells are immunosuppressive and inversely correlated with disease activity in juvenileonset

Normally occurring NKG2D + CD4 + T cells are immunosuppressive and inversely correlated with disease activity in juvenileonset ARTICLE Normally occurring NKG2D + CD4 + T cells are immunosuppressive and inversely correlated with disease activity in juvenileonset lupus Zhenpeng Dai, 1 Cameron J. Turtle, 1 Garrett C. Booth, 1 Stanley

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

7-AAD/CFSE Cell-Mediated Cytotoxicity Assay Kit

7-AAD/CFSE Cell-Mediated Cytotoxicity Assay Kit 7-AAD/CFSE Cell-Mediated Cytotoxicity Assay Kit Item No. 600120 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Control of Virus-Specific CD8 T-Cell Exhaustion and Immune-Mediated Pathology by E3 Ubiquitin Ligase Cbl-b during Chronic Viral Infection

Control of Virus-Specific CD8 T-Cell Exhaustion and Immune-Mediated Pathology by E3 Ubiquitin Ligase Cbl-b during Chronic Viral Infection JOURNAL OF VIROLOGY, Apr. 2008, p. 3353 3368 Vol. 82, No. 7 0022-538X/08/$08.00 0 doi:10.1128/jvi.01350-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Control of Virus-Specific

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice SUPPLEMENTAL METHODS T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice Florian Wiede 1, Benjamin J. Shields 1, Sock Hui Chew 1, Konstantinos Kyparissoudis 2,

More information

Optimizing Intracellular Flow Cytometry

Optimizing Intracellular Flow Cytometry Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles

More information