Platelet-derived growth factor-a receptor activation is required for human cytomegalovirus infection

Size: px

Start display at page:

Download "Platelet-derived growth factor-a receptor activation is required for human cytomegalovirus infection"

Muriel Warner
6 years ago
Views:

1 Vol Septemer 28 doi:1.138/nture729 LETTERS Pltelet-derived growth fctor- receptor ctivtion is required for humn cytomeglovirus infection Lilin Sorocenu 1, Armin Akhvn 1 & Chrles S. Cos 1,2 Humn cytomeglovirus () is uiquitous humn herpesvirus tht cn cuse life-thretening disese in the fetus nd the immunocompromised host 1. Upon ttchment to the cell, the virus induces roust inflmmtory, interferon- nd growth-fctor-like signlling 2 9. The mechnisms fcilitting virl entry nd gene expression re not clerly understood 4. Here we show tht pltelet-derived growth fctor- receptor (PDGFR-) is specificlly phosphorylted y oth lortory nd clinicl isoltes of in vrious humn cell types, resulting in ctivtion of the phosphoinositide-3-kinse (PI(3)K) signlling pthwy. Upon stimultion y, tyrosine-phosphorylted PDGFR- ssocited with the p85 regultory suunit of PI(3)K nd induced protein kinse B (lso known s Akt) phosphoryltion, similr to the genuine lignd,. Cells in which PDGFR- ws geneticlly deleted 1 or functionlly locked were non-permissive to entry, virl gene expression or infectious virus production. Re-introducing humn PDGFRA gene into knockout cells restored susceptiility to virl entry nd essentil virl gene expression. Blockde of receptor function with humnized PDGFR- locking ntiody (IMC-3G3) 11 or trgeted inhiition of its kinse ctivity with smll molecule (Gleevec) 12 completely inhiited virl internliztion nd gene expression in humn epithelil, endothelil nd firolst cells. Virl entry in cells hrouring endogenous PDGFR- ws competitively inhiited y pretretment with. We further demonstrte tht glycoprotein B directly intercts with PDGFR-, resulting in receptor tyrosine phosphoryltion, nd tht glycoprotein B neutrlizing ntiodies 13 inhiit -induced PDGFR- phosphoryltion. Tken together, these dt indicte tht PDGFR- is criticl receptor required for infection, nd thus trget for novel nti-virl therpies., -herpesvirus, is the most common cuse of congenitl infection nd n importnt pthogen in immunocompromised individuls 1. Virl ttchment elicits potent cellulr interferon-like response 2,5,6,9,14 which ctivtes downstrem growth-fctor-like receptor tyrosine kinse (RTK) nd integrin signlling pthwys 4,15. modultion of the PI(3)K/Akt pthwy is n importnt mechnism of poptotic inhiition, ensuring long-term virus survivl 16. Prior evidence suggested tht ctivtion of humn epiderml growth fctor receptor (EGFR), in conjunction with integrin coreceptors, fcilittes ctivtion of downstrem signlling molecules such s PI(3)K/Akt, phospholipse Cc nd focl dhesion kinse 15,17,18. However, we nd others demonstrted tht EGFR is not required for cellulr expression of -essentil genes, or for virus-induced signlling 19,2. Insted, we found tht upon shortterm infection of humn cells, cused phosphoryltion of n pproximtely 18- protein, distinct from EGFR, tht could e co-immunoprecipitted with the p85 regultory suunit of PI(3)K 19. Therefore, we hypothesized tht nother, s yet undiscovered, RTK might e ctivted y nd medite virl entry nd expression. To identify this puttive RTK, we used humn phospho-specific RTK ntiody rry to screen humn emryonic lung firolsts () tht were either mock- or (Towne strin)-infected for 1 min. Only PDGFR- ws highly tyrosine phosphorylted upon infection with (Fig. 1). Western lot nlyses of these sme protein lystes using different phospho-specific ntiody for PDGFR- corroorted this oservtion (Fig. 1). Independent quntittive enzyme-linked immunosorent ssys (ELISAs) confirmed PDGFR- phosphoryltion y Towne, nd TR 21 strins (Fig. 1c). did not induce tyrosine phosphoryltion of the relted RTK, PDGFR- (Supplementry Fig. 1). Ultrvioletinctivted induced PDGFR- phosphoryltion, wheres virus inctivted y het did not (Supplementry Fig. 2). To determine whether the -induced PDGFR- phosphoryltion ws cell-type specific, we used U87 gliom (neuro-epithelil origin), HEL (firolst) nd humn umilicl vein endothelil cells (HUVECs, mesenchyml origin). In ll three cell types, infection with Towne induced PDGFR- phosphoryltion, similr to the genuine lignd (Fig. 1d). Bsed on these dt, we hypothesized tht PDGFR- ws the pproximtely 18 protein we previously identified ssocited with the p85 regultory suunit of PI(3)K, upon ttchment 19.To confirm this, we conducted co-immunoprecipittion experiments in or mock-infected cells. Immunolotting of p85 PI(3)K immunoprecipitted proteins nd whole-cell lystes with ntiodies specific for PDGFR- nd phosphotyrosine indicted tht PDGFR- ws tyrosine phosphorylted nd ssocited with p85 PI(3)K upon short-term stimultion (Fig. 2). Specificity of PDGFR- phosphoryltion y the Towne, nd TR strins ws exmined in the presence or sence of IMC-3G3, humnized PDGFR- locking ntiody (ImClone 11 ). Pretretment with IMC-3G3 significntly inhiited PDGFR- phosphoryltion induced y ll strins tested (Fig. 2). To investigte -induced ctivtion of the downstrem PI(3)K/Akt signlling pthwy, we used oth the IMC-3G3 ntiody nd PDGFR- kinse inhiitor, imtini mesylte (Gleevec 12 ), to lock either PDGFR- inding or its ctivtion. Akt phosphoryltion induced y either or ws olished y IMC-3G3 nd Gleevec (Fig. 2c). An isotype-mtched negtive control ntiody did not inhiit - or PDGF-induced PDGFR- or Akt phosphoryltion (not shown). Thus, locking PDGFR- or inhiiting its ctivity prevents -medited ctivtion of the PI(3)K/Akt signlling pthwy, n importnt pthwy in the virl life cycle 22. To determine whether PDGFR- is criticl for virl internliztion nd gene expression, we used well-chrcterized virl entry ssy to mesure internliztion of the pp65 virl tegument protein fter -treted cells were shifted from 4 uc to37uc 23. We used 1 Deprtment of Neurosciences, Cliforni Pcific Medicl Center Reserch Institute, Suite 22, 475 Brnnn Street, Sn Frncisco, Cliforni 9417, USA. 2 Deprtment of Neurologicl Surgery, University of Cliforni, Sn Frncisco, 787 Moffitt, 55 Prnssus Avenue, Sn Frncisco, Cliforni 94143, USA. 391

LETTERS NATURE Vol 455 18 Septemer 28 humn nd murine cells engineered to knockout, knockdown or overexpress PDGFR-. As shown in Fig.

Short interfering RNA (sirna)- medited knockdown of PDGFR- (Fig. 3, lowest two rows) cused ner-complete lockde of virl internliztion, compred with the non-trgeting, control sirna-treted cells (P,.

3, second row) wheres in firolsts from prentl strin (325S) over 25% of cells were pp65 positive (Fig. 3, third row).

3, P,.1, Student s t-test). To determine whether genetic ltion of PDGFR- prevents cellulr expression of essentil gene products, we mesured c.25 Asornce (ritrry units) d.2.15.1.5 U87MG HUVECs p- Towne TR 1 19 -.

Virl gene expression ws undetectle in the PDGFR- knockout murine cells (Fig. 3c) nd in the humn HEL cells pretreted with PDGFRA sirna(fig. 3d), compred with controls.

IE1 expression ws lso undetectle fter infection of the PDGFR- null mouse firolsts with the strin, indicting tht this effect is not strin specific (dt not shown).

2 LETTERS NATURE Vol Septemer 28 humn nd murine cells engineered to knockout, knockdown or overexpress PDGFR-. As shown in Fig. 3, 6 min fter shifting to 37 uc, HEL cells demonstrte evidence of virl internliztion, indicted y immunostining of nucler pp65 in over 65% of cells per microscopic field (top row). Short interfering RNA (sirna)- medited knockdown of PDGFR- (Fig. 3, lowest two rows) cused ner-complete lockde of virl internliztion, compred with the non-trgeting, control sirna-treted cells (P,.1, Fig. 3). Similrly, murine firolsts otined from emryos of Pdgfr knockout mice 1 (emryonic lethl) showed no pp65-positive nuclei (Fig. 3, second row) wheres in firolsts from prentl strin (325S) over 25% of cells were pp65 positive (Fig. 3, third row). Re-introducing humn PDGFRA into the knockout cells restored nd ugmented internliztion in these cells (Fig. 3, fourth row, 8% of cells re pp65 positive) even compred with positive control cells (Fig. 3, P,.1, Student s t-test). To determine whether genetic ltion of PDGFR- prevents cellulr expression of essentil gene products, we mesured c.25 Asornce (ritrry units) d U87MG HUVECs p- Towne TR MOI : 1 min : 1 min : 1 min 1 µm pp65cmv p- 25 pp65cmv p- 5 p- 1 pp65cmv p- expression of IE1 (UL123) in murine cells, s well s IE1 nd pp65 (UL83) in humn cells fter infection with. Virl gene expression ws undetectle in the PDGFR- knockout murine cells (Fig. 3c) nd in the humn HEL cells pretreted with PDGFRA sirna(fig. 3d), compred with controls. Prolonged ctivtion of humn PDGFR- y resulted in downregultion of receptor levels, consistent with recent report 24 (Fig. 3d, upper pnel, lne 2, in control sirna-treted cells). IE1 expression ws lso undetectle fter infection of the PDGFR- null mouse firolsts with the strin, indicting tht this effect is not strin specific (dt not shown). Pretretment with PDGFR- locking gents IMC-3G3 ntiody nd Gleevec completely inhiited IE1 protein expression in humn HEL nd U87 gliom cells (Fig. 3e) s well s in HUVECs (Supplementry Fig. 3). We next investigted whether PDGFR- expression ws required for production of infectious virus using sirna knockdown of PDGFR- in HEL cells nd Towne-green fluorescent protein (GFP)-expressing virus 25 for visuliztion of infected cells nd plque formtion. Forty-eight to sixty hours fter sirna trnsfection, HEL cells were exposed to for 1 h nd monitored dily under fluorescence microscope. Duplicte cultures were used for IE1 stining t 12 h fter infection, wheres third set of cultures ws used to mesure plque formtion (Supplementry Figs 4 nd 5). Six dys fter infection, superntnts of these cells were used to infect nive HEL cells nd ssess production of infectious virus (Fig. 3f nd Supplementry Fig. 4). We found ner-complete inhiition of oth c 59 - Asornce I.P.: p85 PI(3)K IMC-3G3 IMC-3G3+PDGF Towne IMC-3G3+Towne Cell lystes IMC-3G3 Western lot p-tyr IMC-3G3+ TR Gleevec pp65 P <.5 P <.5 IMC-3G3+ TR p-akt Akt Figure 1 induces tyrosine phosphoryltion of humn PDGFR-., Lystes of mock-or -treted cells were hyridized to humn phospho-rtk rry. phosphoryltes PDGFR- (rrow)., Western lot of stimulted with mock,, or, with indicted ntiodies. c, Phospho-PDGFR--specific ELISA of stimulted with indicted strins nd (dotted line corresponds to 4, pg ml 21 phospho-pdgfr-). Men sornce vlues (n 5 6) 6 s.d. re shown. d, Immunofluorescence of pp65 nd phospho-pdgfr- in indicted cells stimulted with mock, or PDGF. Nuclei re stined with 4,6-dimidino-2-phenylindole (DAPI). 392 Figure 2 ctivtes the PI(3)K/Akt pthwy in PDGFR-dependent mnner., HEL cells stimulted with or were sujected to immunoprecipittion nd western lot nlyses with indicted ntiodies., Phospho-PDGFR- ELISA of cells with or without pretretment with IMC-3G3 (1 mgml 21, 2 h) followed y (MOI 5 1) or PDGF (1 ng ml 21 ) for 1 min. Men vlues (n 5 6) 6 s.d. re shown. c, Western lot of HEL mock, or stimulted (1 min), with or without IMC-3G3 (2 mgml 21 ) or Gleevec (1 nm). The sme memrne ws used for p-akt Ser 473 nd Akt.

NATURE Vol 455 18 Septemer 28 LETTERS virl gene expression nd infectious virus production in cells tht did not express PDGFR- t the time of infection.

To determine the reltive importnce of PDGFR- versus downstrem PI(3)K ctivtion for virl gene expression nd infectious virus production, we performed series of experiments using p11 PI(3)K (lso known s

Suppression of the PI(3)K pthwy y p11 knockdown resulted in dely in virl gene expression, yet llowed virl entry nd infectious virus production, leit t lower levels thn controls, which is in greement

We next tested whether the uthentic PDGFR- lignd inhiits virl entry. Pretretment with significntly decresed entry in HEL cells, suggesting tht competes with n protein (Supplementry Fig. 7).

Using modified ttchment ssy, we found tht purified glycoprotein B peptide ws internlized in mouse cells overexpressing humn PDGFR-, ut not in PDGFR- null cells (Fig. 4).

3 NATURE Vol Septemer 28 LETTERS virl gene expression nd infectious virus production in cells tht did not express PDGFR- t the time of infection. Plque formtion in HEL cells ws lso completely locked y PDGFR- knockdown (Supplementry Fig. 5). To determine the reltive importnce of PDGFR- versus downstrem PI(3)K ctivtion for virl gene expression nd infectious virus production, we performed series of experiments using p11 PI(3)K (lso known s PIK3CA) sirna nd non-trgeting sirna-treted cells. Suppression of the PI(3)K pthwy y p11 knockdown resulted in dely in virl gene expression, yet llowed virl entry nd infectious virus production, leit t lower levels thn controls, which is in greement with previous studies using PI(3)K inhiitors 22 (Supplementry Fig. 6). These dt indicte tht lthough PI(3)K ctivtion is importnt for the life cycle, expression of functionl PDGFR- is essentil. We next tested whether the uthentic PDGFR- lignd inhiits virl entry. Pretretment with significntly decresed entry in HEL cells, suggesting tht competes with n protein (Supplementry Fig. 7). Becuse envelope glycoprotein B (UL55) medites virl entry nd cellulr signlling 26,27, we investigted whether glycoprotein B is the virl moiety directly intercting with PDGFR-. Using modified ttchment ssy, we found tht purified glycoprotein B peptide ws internlized in mouse cells overexpressing humn PDGFR-, ut not in PDGFR- null cells (Fig. 4). To demonstrte direct interction etween PDGFR- nd glycoprotein B, we performed co-immunoprecipittion experiments using HEL cells tht endogenously express PDGFR- nd purified recominnt full-length glycoprotein B 28. Reciprocl immunolot nlyses (Fig. 4, c) demonstrte tht glycoprotein B nd PDGFR- co-immunoprecipitte, indicting direct ssocition etween PDGFR nd glycoprotein B s on fide mechnism for ttchment/internliztion of into the host cells. Using phosphor-pdgfr- ELISA nd western lot pproches, we found tht full-length glycoprotein B induced PDGFR- phosphoryltion (Fig. 4d, e). Furthermore, two different glycoprotein B neutrlizing ntiodies 13 significntly inhiited -induced PDGFR- tyrosine phosphoryltion (Fig. 4d, e), indicting tht the PDGFR- glycoprotein B interction is functionlly relevnt. Isotype control null 325S null + h min 15 min 3 min 6 min 2 µm 1 µm pp65 -positive cells c 72- P <.1 null 325S null + h PDGFRA sirna IE1 PDGFRA sirna 4- Actin d PDGFRA sirna e IE1 pp65 Actin IE1 Actin U87 Figure 3 Humn PDGFR- is required for entry, IE1 expression nd infectious virus production., pp65 immunofluorescence fter tretment (1 h, 4 uc) followed y shifting to 37 uc for indicted times. Rows represent (top to ottom):, PDGFR- null firolsts, prentl firolsts, null firolsts overexpressing hpdgfr-, trnsfected with control or PDGFRA sirna. Nuclei were stined with DAPI., Averge 6 s.d. pp65 positive per 1 cells counted in triplicte from. c, - or -infected cells were nlysed y western lotting with the indicted ntiodies. Lnes 1 4 indicte, 325S, PDGFR- null nd PDGFR- null overexpressing hpdgfr-, respectively. d, trnsfected f Percentge IE1 positive cells TOWNE PDGFRA sirna TOWNE Primry infection Secondry infection PDGFRA sirna TR PDGFRA sirna with control or PDGFRA sirna were mock (lnes 1) or - treted (lnes 2) nd sujected to western lots with indicted ntiodies. e, Western lot of HEL nd U87 lystes fter infection with mock (lnes 1), (lnes 2) or pretreted with IMC-3G3 (1 mgml 21, 12 h, lnes 3) or Gleevec (1 nm, 1 h, lnes 4). f, PDGFRA sirna-treted cells infected with indicted strins nd immunostined for IE1 12 h fter infection (primry infection). Six dys fter infection, superntnts were used to infect nive HEL cells, followed y IE1 immunostining nd quntifiction (secondry infection). Averge (n 5 6) vlues 6 s.d. re shown. TR 393

LETTERS NATURE Vol 455 18 Septemer 28 IF: gb IF: Lyste gb I.P.

d Mximl stimultion (%) 12 1 8 6 4 2 OE/gB OE/mock KO/gB Western lot c Western lot gb 25 15 1 1 2 3 4 5 6 7 8 9 1 11 12 13 14 PDGF 7 17 Neut gb M 758 Neut gb + + + + + + + + + + + + + + + + + + + + +

4 LETTERS NATURE Vol Septemer 28 IF: gb IF: Lyste gb I.P. gb I.P. d Mximl stimultion (%) OE/gB OE/mock KO/gB Western lot c Western lot gb PDGF 7 17 Neut gb M 758 Neut gb P = M 758 PDGF+7 17 PDGF+M 758 gb (68) ntiodies or neutrlizing ntiodies ginst other virl glycoproteins (glycoproteins H nd N) did not prevent -induced receptor ctivtion (not shown). Overll, dt presented here indicte requires PDGFR- inding nd ctivtion for virl internliztion, expression of essentil virl genes, production of infectious virus nd ctivtion of downstrem PI(3)K/Akt signlling. These findings do not exclude potentilly importnt role for other co-receptors during internliztion nd expression, such s integrin receptors. We demonstrte tht virl interction with PDGFR- is fcilitted y direct inding of the virl glycoprotein B to PDGFR-. We further show tht lockde of the PDGFR- receptor pthwy with phrmceuticl gents currently in humn use my prove powerful ntivirl strtegy for the mngement of -relted disese. Becuse oth PDGFR- nd ply importnt roles in the pthophysiology of humn development, inflmmtion, vsculr disese nd cell-prolifertive disorders, n incresed understnding of their interction my elucidte novel moleculr mechnisms underlying these conditions. e PDGF gb M µm p Y754 - Figure 4 Glycoprotein B inds nd ctivtes PDGFR-., Immunofluorescence detection of glycoprotein B (upper pnels) nd PDGFR- (lower pnels) in PDGFR- knockout (KO) cells nd PDGFR- overexpressing (OE) cells, fter incution with the glycoprotein B peptide or mock tretment. Reduced PDGFR- surfce stining in glycoprotein-btreted cells is likely due to receptor internliztion., c, Immunoprecipittion of PDGFR- nd glycoprotein B from HEL lystes nd full-length solule glycoprotein B lone or pre-incuted together. Immunoprecipittes were sujected to western lot with the indicted ntiodies. d, ELISA mesurements of humn PDGFR- phosphoryltion fter stimultion with (MOI 5 1), PDGF (1 ng ml 21 ) or recominnt solule glycoprotein B (3 mgml 21 ) in the presence or sence of glycoprotein B neutrlizing ntiodies 7 17 nd M 758 (5 mgml 21 ); rs, 6 s.d. e. Portions of the sme lystes used in d were nlysed y western lot with indicted ntiodies. 394 METHODS SUMMARY Cells nd viruses. PDGFR- knockout nd prentl 325S mouse firolsts were gift from M. Tllquist (Southwestern University 1 ). Although is humnspecific virus nd cnnot e propgted in murine cells, internliztion nd immedite erly virl gene expression occur in murine cells 29.cDNA for humn PDGFRA ws otined from C. Heldin (Upsl University). strins nd Towne (Americn Type Culture Collection, ATCC) were propgted in for less thn five pssges. were infected t multiplicity of infection (MOI) of 1 (in serum-free medi) nd cell superntnt ws collected over period of 5 7 dys fter infection, when the cytopthic effect ws out 1%. Virus-contining medi were first centrifuged (1,5g) to remove cell deris nd further concentrted using sucrose grdient centrifugtion (8,g, 4uC) s descried 3. Virus stock liquots were kept t 28 uc. controls were generted in prllel y conditioning nd processing uninfected cultures identiclly. TR clinicl isolte nd GFP-CMV were otined from W. Britt. sirna experiments. were trnsfected with 1 nm of either the smrt Pool sirna to humn PDGFRA, humn p11 PI(3)K or the non-trgeting sirna pool (Dhrmcon) using stndrd Lipofectmine 2 regent protocol (Invitrogen). Seventy-two hours fter trnsfection, sirna-trnsfected cells were - or mock-infected. PDGFR- or p11 PI(3)K expression levels were mesured using stndrd western lot nd immunofluorescence nlyses (ntiodies from Cell Signlling). Full Methods nd ny ssocited references re ville in the online version of the pper t Received 15 My; ccepted 25 June 28. Pulished online 13 August Britt, W. J. & Alford, C. A. Fields Virology 3rd edn (Rven Press, 1996). 2. Andreoni, K. A., Wng, X., Hung, S. M. & Hung, E. S. Humn cytomeglovirus hyperimmune gloulin not only neutrlizes infectivity, ut lso inhiits -induced intrcellulr NF-kB, Sp1, nd PI3-K signling pthwys. J. Med. Virol. 67, 33 4 (22). 3. Boyle, K. A., Pietropolo, R. L. & Compton, T. Enggement of the cellulr receptor for glycoprotein B of humn cytomeglovirus ctivtes the interferon-responsive pthwy. Mol. Cell. Biol. 19, (1999). 4. Compton, T. Receptors nd immune sensors: the complex entry pth of humn cytomeglovirus. Trends Cell Biol. 14, 5 8 (24). 5. Netterwld, J. R. et l. Postttchment events ssocited with virl entry re necessry for induction of interferon-stimulted genes y humn cytomeglovirus. J. Virol. 78, (24). 6. Ozto, K., Tilor, P. & Kuot, T. The interferon regultory fctor fmily in host defense: mechnism of ction. J. Biol. Chem. 282, (27). 7. Simmen, K. A. et l. Glol modultion of cellulr trnscription y humn cytomeglovirus is initited y virl glycoprotein B. Proc. Ntl Acd. Sci. USA 98, (21). 8. Yurochko, A. D. et l. Induction of the trnscription fctor Sp1 during humn cytomeglovirus infection medites upregultion of the p65 nd p15/p5 NFkB promoters. J. Virol. 71, (1997). 9. Zhu, H., Cong, J. P. & Shenk, T. Use of differentil disply nlysis to ssess the effect of humn cytomeglovirus infection on the ccumultion of cellulr RNAs: induction of interferon-responsive RNAs. Proc. Ntl Acd. Sci. USA 94, (1997). 1. Andrews, A. et l. Pltelet-derived growth fctor plys key role in prolifertive vitreoretinopthy. Invest. Ophthlmol. Vis. Sci. 4, (1999). 11. Loizos, N. et l. Trgeting the pltelet-derived growth fctor receptor lph with neutrlizing humn monoclonl ntiody inhiits the growth of tumor xenogrfts: implictions s potentil therpeutic trget. Mol. Cncer Ther. 4, (25). 12. Sndler, C. et l. Imtini mesylte inhiits pltelet derived growth fctor stimulted prolifertion of rheumtoid synovil firolsts. Biochem. Biophys. Res. Commun. 347, (26). 13. Britt, W. J. Neutrlizing ntiodies detect disulfide-linked glycoprotein complex within the envelope of humn cytomeglovirus. Virology 135, (1984). 14. Wltenerger, J. et l. Different signl trnsduction properties of KDR nd Flt1, two receptors for vsculr endothelil growth fctor. J. Biol. Chem. 269, (1994). 15. Feire, A. L., Koss, H. & Compton, T. Cellulr integrins function s entry receptors for humn cytomeglovirus vi highly conserved disintegrin-like domin. Proc. Ntl Acd. Sci. USA 11, (24). 16. Coory, S. The pivotl role of phosphtidylinositol 3-kinse-Akt signl trnsduction in virus survivl. J. Gen. Virol. 85, (24). 17. Wng, X., Hung, D. Y., Huong, S. M. & Hung, E. S. Integrin v 3 is coreceptor for humn cytomeglovirus. Nture Med. 11, (25). 18. Wng, X. et l. Epiderml growth fctor receptor is cellulr receptor for humn cytomeglovirus. Nture 424, (23). 19. Cos, C. S. et l. Humn cytomeglovirus induces cellulr tyrosine kinse signling nd promotes gliom cell invsiveness. J. Neurooncol. 85, (27).

5 NATURE Vol Septemer 28 LETTERS 2. Iscson, M. K., Feire, A. L. & Compton, T. Epiderml growth fctor receptor is not required for humn cytomeglovirus entry or signling. J. Virol. 81, (27). 21. Murphy, E. et l. Coding potentil of lortory nd clinicl strins of humn cytomeglovirus. Proc. Ntl Acd. Sci. USA 1, (23). 22. Johnson, R. A. et l. Humn cytomeglovirus up-regultes the phosphtidylinositol 3-kinse (PI3-K) pthwy: inhiition of PI3-K ctivity inhiits virl repliction nd virus-induced signling. J. Virol. 75, (21). 23. English, E. P., Chumnov, R. S., Gellmn, S. H. & Compton, T. Rtionl development of et-peptide inhiitors of humn cytomeglovirus entry. J. Biol. Chem. 281, (26). 24. Gredmrk, S. et l. Humn cytomeglovirus downregultes expression of receptors for pltelet-derived growth fctor y smooth muscle cells. J. Virol. 81, (27). 25. Murphy, E. A., Strelow, D. N., Nelson, J. A. & Stinski, M. F. The humn cytomeglovirus IE86 protein cn lock cell cycle progression fter inducing trnsition into the S phse of permissive cells. J. Virol. 74, (2). 26. Boyle, K. A. & Compton, T. Receptor-inding properties of solule form of humn cytomeglovirus glycoprotein B. J. Virol. 72, (1998). 27. Crlson, C., Britt, W. J. & Compton, T. Expression, purifiction, nd chrcteriztion of solule form of humn cytomeglovirus glycoprotein B. Virology 239, (1997). 28. Wng, Z. et l. Recominnt modified vccini virus Ankr expressing solule form of glycoprotein B cuses durle immunity nd neutrlizing ntiodies ginst multiple strins of humn cytomeglovirus. J. Virol. 78, (24). 29. Thoms, B. Viruses nd the Cellulr Immune Response (Mrcel Dekker, 1993). 3. Hung, E. S., Chen, S. T. & Pgno, J. S. Humn cytomeglovirus. I. Purifiction nd chrcteriztion of virl DNA. J. Virol. 12, (1973). Supplementry Informtion is linked to the online version of the pper t Acknowledgements We thnk M. Tllquist for the PDGFR- knockout mouse firolsts, C. Heldin for the humn PDGFR- cdna, D. Dimond for providing the solule glycoprotein B, nd N. Loizos (ImClone) for the IMC-3G3 ntiody. We re grteful to W. Britt (University of Alm t Birminghm) for viruses, glycoprotein B neutrlizing ntiodies nd discussions. This study ws supported y n institutionl grnt from Cliforni Pcific Medicl Center Reserch Institute nd y the Arthur Flming Foundtion. Author Contriutions L.S. nd A.A. performed experiments; L.S., A.A. nd C.S.C. designed experiments, nlysed dt nd wrote the mnuscript. Author Informtion Reprints nd permissions informtion is ville t Correspondence nd requests for mterils should e ddressed to C.C. (chrles.cos@gmil.com). 395

6 doi:1.138/nture729 METHODS Cell culture, plsmids, trnsfection nd dditionl strins., U87 gliom nd HUVECs were otined from ATCC nd mintined in DMEM plus 1% FCS, except for HUVECs which were grown in endothelil cell medi (Cscde Biologicls), plus growth fctors. Mouse PDGFR- knockout cells were trnsfected with humn PDGFRA cdna using Lipofectmine 2 (Invitrogen) ccording to the mnufcturer s instructions. Towne-GFP (from W. Britt, University of Alm t Birminghm) is recominnt strin tht expresses GFP under the erly promoter UL127, s previously descried 31. Virus titres were determined y IE1 immunohistochemicl stining, s previously descried 32. Optimiztion of sirna cell delivery ws performed y cotrnsfecting with the trgeting sirna pools (for exmple, PDGFRA sirna) nd fluorescently lelled oligonucleotides (siglo-risc free, Dhrmcon) tht loclize to the nucleus nd llow ssessment of uptke into cells. Trgeting sirna oligonucleotides nd siglo were mixed 1:1 (5 nm ech) with different mounts of Lipofectmine 2. Twenty-four hours lter, cells were fixed, counterstined with DAPI nd counted. The verge numer of green fluorescent cells ( mesure of trnsfection efficiency) ws etween 72% nd 84% (from totl of 1% DAPI-positive nuclei). sirna sequences. The sequences re listed PI(3)K p11: GCGAAAUUCUCACACUAUU; GUGGUAAAGUUCCCAGAUA; GCUUAGA GUUGGAGUUUGA; GACCCUAGCCUUAGAUAAA. Humn PDGFRA: CG AGACUCCUGUAACCUUAUU; GAGCUUCACCUAUCAAGUUUU; GACAG UGGCCAUUAUACUAUU; GAAUAGGGAUAGCUUCCUGUU. Non-trgeting sequences: UGGUUUACUAGUCGACUAA; UGGUUUACAUGUUUUCUGA; UGGUUUACAUGUUGUGUGA; UGGUUUACAUGUUUUCCUA. Western lot, immunoprecipittion nd immunofluorescence nlyses. For stimultion experiments, cells were serum-strved for 24 h, followed y stimultion with (MOI 5.5), (5 1 ng ml 21, R&D Systems), or mock, for 1 min. In some cses, cells were pretreted with IMC-3G3 (N. Loizos, ImClone) t 1 mgml 21 (2 or 12 h) or Gleevec (1 nm, 1 h) efore exposure. Cell lystes were nlysed y SDS polycrylmide gel electrophoresis (SDS PAGE). Antiodies used were s follows: polyclonl nti-pdgfr- (1/ 5), phosphor-tyrosine clone 4G1 (1/1,) nd monoclonl nti-p85 PI(3)K (1/1,) (Upstte Biotechnology), nti IE1 MAB81 (Chemicon; 1/1,), nti pp65 (Novocstr, 1/1,), nti-phosphor-pdgfr- (1/5, ptyr 754), nti-phosphor-akt (Ser 473, 1/1,) nd totl Akt (1/ 1,; ll from Cell Signlling). Anti-ctin polyclonl control ntiody ws used (1/5, Sigm). Immunoprecipittions were performed using protein G (Pierce) ccording to the mnufcturer s instructions. For immunofluorescence, we used monoclonl pp65 nd phosphor-pdgfr- (p-tyr 754, Snt Cruz Biotechnology), overnight t 4 uc, followed y incution for 1 h with secondry ntiodies conjugted to Alex 488, or Alex 568 (1/5,, Moleculr Proes). Nuclei were counterstined with DAPI. Co-immunoprecipittion experiments were performed using full-length solule purified recominnt glycoprotein B (glycoprotein B 68, from D. Dimond, City of Hope, Cliforni) nd detergentsolule extrcts of HEL cells generted in lysis uffer (1% NP-4, 75 mm NCl nd 5 mm Tris-HCl). Protein (5 mg) from totl cell extrct ws incuted with 25 mg of glycoprotein B 68 in lysis uffer in the presence of n ntiglycoprotein B (Virusys) or nti-pdgfr- (R&D) ntiody overnight t 4 uc. Immune complexes were recovered with protein A Sephrose eds (2 h incution), dentured nd seprted on SDS PAGE for western lot with nti-glycoprotein B (Virusys) or nti-pdgfr- (Cell Signling Technology) ntiodies. Virl ttchment nd internliztion ssys. Mouse firolsts nd HEL cells (72 h fter sirna trnsfections) were incuted with (MOI 5.5) or mock treted for 1 h t 4 uc, fter which cells were returned to 37 uc for 15, 3 or 6 min. Cells were fixed using methnol (2 min) nd processed for pp65 immunofluorescence. Four low-power fields were counted for ech condition nd pp65 immunorective cells were recorded for ech 1 cells. Internliztion ssys were repeted twice. glycoprotein B (peptide) ttchment ssys. Glycoprotein B peptide inding experiments were performed similr to virl ttchment ssys. After incution for 1 h with the glycoprotein B peptide (1 nm, 4 uc), cells were returned to 37 uc for 6 min, wshed, fixed nd processed for doule immunofluorescence for glycoprotein B (1 mgml 21, monoclonl ntiody, Virusys) nd PDGFR- (2 mgml 21, Upstte). The glycoprotein B peptide (Ry Biotech) contins mino cids from the strin nd from the Towne strin. Humn phospho-pdgfr- ELISA. ELISA for humn phospho-pdgfr- ws performed with kit (R&D, ctlogue numer DYC2114-2). HEL cells were grown in 24-well pltes (4, cells per ml) nd serum-strved 48 h efore short-term (1 min) stimultion with vrious gents, s descried in Figs 2 nd 4d. Lysis of cells ws done s per kit instructions. The cpture ntiody ws mouse nti-humn PDGFR-; nti-phosphotyrosine-hrp ntiody ws used for detection. Recominnt humn phosphorylted PDGFR- ws used s positive control. Rection products were red using microplte reder set t 45 nm. All smples were run in triplicte nd ech experiment ws repeted t lest twice. For receptor-locking experiments, cells were pretreted with IMC- 3G3 (1 mgml 21, 12 h) or Gleevec (1 nm, 1 h). To test the effects of glycoprotein B neutrlizing ntiodies, (MOI 5 1) ws pre-incuted in serumfree medi with ntiodies specific for glycoprotein B 7 17, MAB 758 (ref. 33) or control isotype-mtched ntiodies (5 mgml 21 ) for 1 h efore cell stimultion. Additionl ntiodies tested included neutrlizing ntiody ginst glycoproteins N (ref. 34) nd H (ref. 35). Mesurements of infectious virus production. HEL cells (where indicted treted with sirna) were infected with Towne or CMV-GFP for 1 h, wshed nd grown for 6 dys t 37 uc. A duplicte set of cultures ws nlysed y immunofluorescence t 12 h fter infection to ssess the percentge of IE1 positive cells, s mesure of primry infection. Six dys fter infection, superntnt from these cells were centrifuged to exclude cell deris nd used to infect nive HEL cultures s descried ove. Cells t 12 h fter infection were stined for IE1, nd IE1-positive cells were counted mong totl of 1 cells per low-mgnifiction microscopic field, four fields per condition. These counts were used to determine the level of secondry infection : tht is, infectious virus production from the primry infected cells. Where indicted, CMV GFP infected cells were monitored dily under fluorescence microscope. Ech condition ws ssyed in triplicte. Plque formtion ssys. Plque formtion ws ssyed s previously descried 36. Briefly, confluent HEL cells in six-well cluster pltes were incuted with CMV-GFP (MOI 5 1, 1 h) in.5 ml growth medi. Cells were wshed nd returned to 37 uc (in complete growth medi). Twenty-four hours lter, superntnt ws hrvested nd used to infect nive HEL cultures, which were monitored for plque formtion for 6 14 dys. Plque formtion ws photogrphed dily using n inverted fluorescence microscope. At dy 14, plques in ten lowmgnifiction fields/conditions were counted (ech experimentl condition ws tested in six independent wells). Sttisticl nlyses. A two-tiled pired Student s t-test ws used to compre dt sets nd otin P vlues for ll comprisons; P vlues re indicted on figure pnels. 31. Isomur, H. & Stinski, M. F. The humn cytomeglovirus mjor immedite-erly enhncer determines the efficiency of immedite-erly gene trnscription nd virl repliction in permissive cells t low multiplicity of infection. J. Virol. 77, (23). 32. Chn, G., Stinski, M. F. & Guilert, L. J. Humn cytomeglovirus-induced upregultion of intercellulr cell dhesion molecule-1 on villous syncytiotropholsts. Biol. Reprod. 71, (24). 33. Britt, W. J., Jrvis, M. A., Drummond, D. D. & Mch, M. Antigenic domin 1 is required for oligomeriztion of humn cytomeglovirus glycoprotein B. J. Virol. 79, (25). 34. Shimmur, M., Mch, M. & Britt, W. J. Humn cytomeglovirus infection elicits glycoprotein M (gm)/gn-specific virus-neutrlizing ntiody response. J. Virol. 8, (26). 35. Li, L., Coelingh, K. L. & Britt, W. J. Humn cytomeglovirus neutrlizing ntiodyresistnt phenotype is ssocited with reduced expression of glycoprotein H. J. Virol. 69, (1995). 36. Mr, E. C., Cheng, Y. C. & Hung, E. S. Effect of 9-(1,3-dihydroxy-2- propoxymethyl)gunine on humn cytomeglovirus repliction in vitro. Antimicro. Agents Chemother. 24, (1983).

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+