SUPPLEMENTARY METHODS

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "SUPPLEMENTARY METHODS"

Transcription

1 SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde, embedded in paraffin, sectioned at 5 µm, and stained with hematoxylin and eosin (H&E). Histological scoring (at least 5 sections per mouse) was performed blindly by two investigators using established protocol as described previously 26,27,46. In brief, Crypt damage (0 4), area involved (1 4), inflammation (0 3) and extent (0 3) were performed and cumulative score was calculated. Quantitative RT-PCR. Total RNA from colonic explants was extracted with Trizol (Life Tecnologies) and the first-strand complementary DNA (cdna) was synthesized from 1 µg of total RNA with oligo(dt) 20 primerusing the PrimeScript RT reagent kit (Takara, Kusatsu, Japan) according to the manufacturer s instructions. Transcriptional expression levels were analyzed by using SYBR Premix Ex Taq II on Thermal Cycler Dice (Takara) with specific primer pairs (Supplementary Table 1) after normalization for the expression of Gapdh. Detection of cytokines. Cytokine concentrations were measured for IFN-, TNF-, IL-6, IL-12p40, CCL2 (ebioscience), IFN- and IFN- (Biolegend) using ELISA kit according to the manufacturer s instructions. Immunohistochemical analysis. Colonic tissue obtained on day 5 after the start of DSS treatment was embedded in OCT compound (Sakura Fineteck, Tokyo, Japan) and frozen in liquid N 2. The tissue block was sectioned with a cryostat at 5-7 µm. Frozen section was fixed with cold acetone and blocked in PBS containing 5% of normal rat serum. Subsequently, slide was stained with FITC-conjugated anti-cd11b mab (BD Biosciences) and mounted with Vectashield containing DAPI (Vector laboratories,

2 Burlingame, CA). The stained slides were analyzed with a BIOREVO fluorescence microscope (BZ-9000; KEYENCE, Osaka, Japan) and Cytoscketch software (Tomy Digital Biology, Tokyo, Japan).

3 Supplementary Table 1 RT-PCR primer GAPDH Sequence F-5 -AAATTCAACGGCACAGTCAAG-3 R-5 -TGGTGGTGAAGACACCAGTAG-3 CCL2 F-5 -AGCAGCAGGTGTCCCAAAGA-3 R-5 -GTGCTGAAGACCTTAGGGCAGA-3 CCL3 F-5 - GAAACCAGCAGCCTTTGCTC -3 R-5 - AGGCATTCAGTTCCAGGTCAGT-3 CCL5 F-5 - TGCCCACGTCAAGGAGTATTT-3 R-5 - TCTCTGGGTTGGCACACACTT-3 CCL7 F-5 -TCTGCCACGCTTCTGTGCC-3 R-5 -AACAGCTTCCCAGGGACACCG-3 CCL8 F-5 -TGCCCCATGGAAGCTGTGG-3 R-5 -ACGCAGCCCAGGCACCATC-3 CCL25 F-5 -GAGTGCCACCCTAGGTCATC-3 R-5 -CCAGCTGGTGCTTACTCTGA-3 CXCL9 F-5 -TTTTCCTCTTGGGCATCATC-3 R-5 -AGTCCGGATCTAGGCAGGTT-3 CXCL10 F-5 -ATATCGATGACGGGCCAGTGA-3 R-5 -TTTCATCGTGGCAATGATCTCA-3 CXCL11 F-5 -AGCTGCTCAAGGCTTCCTTATGT-3 R-5 -TCTGCCATTTTGACGGCTTT-3 IFN-α F-5 -TCTGATGCAGCAGGTGGG-3 R-5 -AGGGCTCTCCAGACTTCTGCTCTG-3 IFN-β F-5 -GCACTGGGTGGAATGAGACT-3 R-5 -AGTGGAGAGCAGTTGAGGACA-3

4 Supplementary Figure 1 Influences of the ablation of pdcs and cdcs on the development of DSS-induced acute colitis. (a) Bone marrow (BM)-derived pdc (BM-pDCs) were generated by the culture of BM cells with Fms-related tyrosine kinase 3 ligand (Flt3-L) for 8 days (left panel), and BM-pDCs as B220 + CD11b - population were sorted (right panel). Data are represented as a dot plot, and numbers represent the proportion of indicated population in each plot. (b) The expression of cell surface molecules on the sorted BM-pDCs was analyzed by flow cytometry. Data are represented as a histogram. (c,d) WT mice (n=10) and pdc-ablated mice (n=10) that had been treated with DT on 1 day before DSS treatment and on days 3 and 7 after the

5 start of the treatment were orally administrated with 2% DSS for 7 days, then switched to normal drinking water. The disease progression was monitored for 14 days. Changes in BW (c) and survival rate (d) were plotted. (e) The frequency of CD11c high BST2 - cdcs and CD11c int BST2 + pdcs in Spl, MLN, and colonic LP obtained from WT mice (n=3) and cdc-ablated mice (n=3) that had been treated with DT on 1 day before DSS treatment and on day 3 after the start of the treatment were analyzed by flow cytometry. Data are represented as a dot plot, and numbers represent the proportion of CD11c high BST2 - cdcs and CD11c int BST2 + pdcs among CD CD64 - leukocytes in each quadrant. (f,g) WT mice (n=4), pdc-ablated mice (n=4), and cdc-ablated mice (n=4) that had been treated with DT on 1 day before DSS treatment and on day 3 after the start of the treatment were orally administrated with 2% DSS for 7 days, and the disease progression was monitored. Changes in BW for 7 days (f) and on day 7 (g) were plotted. P < 0.01 compared with WT mice. All data are representative at least three independent experiments.

6 Supplementary Figure 2 Influence of the deficiency of IFNAR1 on the development of DSS-induced acute colitis. (a,b) WT mice (n=4) (a) and Ifnar1 -/- mice (n=4) (a,b), and Ifnar1 -/- pdc-ablated mice (b) were orally administrated with 2% DSS for 7 days, and the disease progression was monitored, and the changes in BW was plotted. (c) WT mice (n=4) and pdc-ablated mice (n=4) were orally administrated with or without 2% DSS for 7 days, and transcriptional expression levels of IFN-I in the middle colonic explants obtained from WT mice and pdc-ablated mice were measured by quantitative RT-PCR. Data are the mean ± s.d. from three individual samples in a single experiment. All data are representative at least three independent experiments.

7 Supplementary Figure 3 Flow cytometry analysis for identification of leukocytes in the colonic LP. LP cells were analyzed in the indicated sequential gates for forward scatter-area (FSC-A)/side scatter-area (SSC-A), propidium iodide (PI)/SSC-A to exclude dead cells, CD45.2/SSC-A to include leukocytes, FCS-height (FCS-H)/ FSC-width (FCS-W) to include singlet cells, and B220/CD11b to identify B220 + CD11b - CD11c int BST2 + pdcs (R1). For detection of myeloid cells, FCS-H/FCS-W-gated LP leukocytes were further analyzed for I-A/I-E and CD11b/SSC-A to identify I-A/I-E + CD11c high CD64 - cdcs (R2), I-A/I-E + CD11c + CD64 + macrophages (R3), I-A/I-E - CD11b + Ly6C high inflammatory monocytes (R4), I-A/I-E - CD11b + Ly6G + neutrophils (R5), and I-A/I-E - CD11b + Siglec-F + eosinophils (R6).

8 Supplementary Figure 4 Specific expression of Siglec-H on the pdcs in the LP and MLN during the development of DSS-induced acute colitis. WT mice (n=4) that had been treated with DT on 1 day before DSS treatment and on day 3 after the start of the treatment were orally administrated with 2% DSS, and the cell surface expression of Siglec-H on B220 + CD11b - CD11c int BST2 + pdcs, I-A/I-E + CD11c high CD64 - cdcs, I-A/I-E + CD11c + CD64 + macrophages (Mac), I-A/I-E - CD11b + Ly6C high inflammatory monocytes (Mono), I-A/I-E - CD11b + Ly6G + neutrophils (Neu), I-A/I-E - CD11b + Siglec-F + eosinophils, (Eo) CD3ε + T cells, and B220 + CD19 + B cells in colonic LP and MLN was analyzed by flow cytometry on day 0 and 5 after the start of DSS treatment. Data are represented as a histogram. All data are representative at least three independent experiments.

9 Supplementary Figure 5 Selective elimination of pdcs in pdc-ablated mice during the development of DSS-induced acute colitis. (a,b) pdc-ablated mice (n=4) that had been treated with or without DT on 4 day after the start of DSS treatment were orally administrated with 2% DSS. Absolute cell number of B220 + CD11b - CD11c int BST2 + pdcs, I-A/I-E + CD11c high CD64 - cdcs, I-A/I-E + CD11c + CD64 + macrophages, I-A/I-E - CD11b + Ly6C high inflammatory monocytes, I-A/I-E - CD11b + Ly6G + neutrophils, I-A/I-E - CD11b + Siglec-F + eosinophils, CD3ε + T cells, and B220 + CD19 + B cells in the colonic LP (a) and MLN (b) were analyzed by flow cytometry on day 5 after the start of DSS treatment. Data are the mean ± s.d. from three individual samples in a single

10 experiment. *P < 0.01 compared with WT mice. All data are representative at least three independent experiments.

11 Supplementary Figure 6 Cell surface expression of MHC and costimulatory molecules on pdcs. WT mice (n=4) that had been treated with DT on 1 day before DSS treatment and on day 3 after the start of the treatment were orally administrated with or without 2% DSS, and the expression of cell surface molecules on pdcs in Spl, MLN, and colonic LP was analyzed by flow cytometry on day 7 after the start of DSS treatment. Data are represented as a histogram. All data are representative at least three independent experiments.

12 Supplementary Figure 7 pdc does not affect the frequency of T-cell subsets in the inflamed colonic LP. WT mice (n=4) and pdc-ablated mice (n=4) that had been treated with DT on 1 day before DSS treatment and on day 3 after the start of the treatment were orally administrated with 2% DSS for 7 days. The proportion of intracellular IFN-γ- and IL-17-producing cells among gated CD4 + T cells (a) and CD4 + Foxp3 + cells among CD CD3ε + population (b) in the colonic LP obtained from DSS-fed WT mice and pdc-ablated mice were analyzed by flow cytometry on day 7 after the start of DSS treatment. Data are represented by a dot plot, and numbers represent the proportion of IFN-γ + cells and IL-17 + cells among gated CD4 + T cells (a) or CD4 + Foxp3 + cells (b) among CD CD3ε + population in each quadrant.

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Fisher et al. Supplemental Figure 1

Fisher et al. Supplemental Figure 1 Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Optimizing Intracellular Flow Cytometry:

Optimizing Intracellular Flow Cytometry: Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Supplemental materials

Supplemental materials Supplemental materials 1 Supplemental Fig. 1 Immunogram This immunogram summarizes patient clinical data and immune parameters at corresponding time points for Patient IMF-32. The top panel illustrates

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

Supporting Information

Supporting Information Supporting Information Aldridge et al. 10.1073/pnas.0900655106 Fig. S1. Flow diagram of sublethal (a) and lethal (b) influenza virus infections. (a) Infection of lung epithelial cells by influenza virus

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

Differential Response of Respiratory Dendritic Cell Subsets to Influenza Virus Infection

Differential Response of Respiratory Dendritic Cell Subsets to Influenza Virus Infection JOURNAL OF VIROLOGY, May 2008, p. 4908 4919 Vol. 82, No. 10 0022-538X/08/$08.00 0 doi:10.1128/jvi.02367-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Differential Response

More information

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV)

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV) A mln NK Cells(x ) 6 1 * ndln NK Cells (x ) ns C Lung NK Cells(x ) 1 1 7 * D LN NK Cells (x ) 1 7 1 7 Days post-infection (A/PR/8) * * E Liver NK Cells (x ) 1 7 Days post-infection (A/PR/8) * * * 1 7 Days

More information

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF A RT I C L E S Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL and GM-CSF Daniela F. Quail,7, Oakley C. Olson,7, Priya Bhardwaj, Logan A. Walsh, Leila Akkari,,,

More information

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Immunity, Volume 4 Supplemental Information Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Steven J. Van Dyken, Alexander Mohapatra,

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

Supplemental Information. Human CD1c + Dendritic Cells Drive. the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF-

Supplemental Information. Human CD1c + Dendritic Cells Drive. the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF- Immunity, Volume 38 Supplemental Information Human CD1c + Dendritic Cells Drive the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF- Chun I. Yu Christian Becker Yuanyuan

More information

Granulocyte and lymphocyte proteins

Granulocyte and lymphocyte proteins Granulocyte and lymphocyte proteins Hycult Biotech is a leading world-class manufacturer of research reagents in the field of innate immunity. We are a specialized partner in the development and manufacturing

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S.

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S. This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S., Weiss, S. Neutrophils responsive to endogenous IFN-β

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD) Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Tale i: Primers used for RT-PCR. References are provided under Source, except for primers

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.

More information

How plasma cells develop. Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft

How plasma cells develop. Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft How plasma cells develop Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft 1 Plasma cells develop from activated B cells Toll Like Receptor B Cell Receptor B cell B cell microbia

More information

Cell-mediated Immunity

Cell-mediated Immunity Cellular & Molecular Immunology Cell-mediated Immunity Nicholas M. Ponzio, Ph.D. Department of Pathology & Laboratory Medicine April 6, 2009 Today s Presentation: Overview Cellular Interactions In Humoral

More information

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation Research article Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation C. Andrew Stewart, 1 Hannah Metheny, 1 Noriho Iida, 1 Loretta Smith, 1 Miranda Hanson, 1 Folkert Steinhagen,

More information

Author's response to reviews

Author's response to reviews Author's response to reviews Title:CD14+ macrophages that accumulate in the colon of African AIDS patients express pro-inflammatory cytokines and are responsive to lipopolysaccharide Authors: Edana Cassol

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Lung Natural Helper Cells Are a Critical Source of Th2 Cell-Type Cytokines in Protease Allergen-Induced Airway Inflammation

Lung Natural Helper Cells Are a Critical Source of Th2 Cell-Type Cytokines in Protease Allergen-Induced Airway Inflammation Article Lung Natural Helper Cells Are a Critical Source of Th2 Cell-Type Cytokines in Protease Allergen-Induced Airway Inflammation Timotheus Y.F. Halim, 1,2 Ramona H. Krauß, 1, Ann C. Sun, 1 and Fumio

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214, Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Horizon 2020 Programme. SFS-01b Tackling losses from terrestrial animal diseases

Horizon 2020 Programme. SFS-01b Tackling losses from terrestrial animal diseases Horizon 2020 Programme SFS-01b-2014 Tackling losses from terrestrial animal diseases Strengthening Animal Production and Health through the Immune Response Project ID: 633184 D12.1 Age related innate responses

More information

Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell death-1 expression

Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell death-1 expression Zha et al. Journal of Neuroinflammation 2014, 11:65 JOURNAL OF NEUROINFLAMMATION RESEARCH Open Access Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell

More information

IFN-γ Secretion Assay Detection Kit (PE) human

IFN-γ Secretion Assay Detection Kit (PE) human Miltenyi Biotec GmbH Friedrich-Ebert-Straße 68 51429 Bergisch Gladbach, Germany Phone +49 2204 8306-0 Fax +49 2204 85197 macs@miltenyibiotec.de Miltenyi Biotec Inc. 12740 Earhart Avenue Auburn CA 95602,

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently Immunity, Volume 47 Supplemental Information Granulocyte-Monocyte Progenitors and Monocyte-endritic ell Progenitors Independently Produce Functionally istinct Monocytes lberto Yáñez, Simon G. oetzee, ndre

More information

Lung-resident eosinophils represent a distinct regulatory eosinophil subset

Lung-resident eosinophils represent a distinct regulatory eosinophil subset Lung-resident eosinophils represent a distinct regulatory eosinophil subset Claire Mesnil, 1,2 Stéfanie Raulier, 1 Geneviève Paulissen, 1 Xue Xiao, 2,3 Mark A. Birrell, 4 Dimitri Pirottin, 1,2 Thibaut

More information

Interleukin-20 is associated with delayed healing in diabetic wounds

Interleukin-20 is associated with delayed healing in diabetic wounds Interleukin-20 is associated with delayed healing in diabetic wounds Phillip Finley, PhD Integrated and Applied Sciences Program Biology and Statistics/Research Methodology Normal Healing Body s natural

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Getting Beyond the Flags: Quantitative assessment of immature granulocyte (IG) populations may improve the assessment of sepsis and inflammation.

Getting Beyond the Flags: Quantitative assessment of immature granulocyte (IG) populations may improve the assessment of sepsis and inflammation. Getting Beyond the Flags: Quantitative assessment of immature granulocyte (IG) populations may improve the assessment of sepsis and inflammation. Sysmex America White Paper One Nelson C. White Parkway,

More information

10/18/2012. A primer in HLA: The who, what, how and why. What?

10/18/2012. A primer in HLA: The who, what, how and why. What? A primer in HLA: The who, what, how and why What? 1 First recognized in mice during 1930 s and 1940 s. Mouse (murine) experiments with tumors Independent observations were made in humans with leukoagglutinating

More information

BALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION

BALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION BALANCE BETWEEN ESTROGE AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION Nadine Dragin 1, 2, 3,, Patrice Nancy 4, José Villegas 2, 3, 5, Régine

More information

Bihong Zhao, M.D, Ph.D Department of Pathology

Bihong Zhao, M.D, Ph.D Department of Pathology Bihong Zhao, M.D, Ph.D Department of Pathology 04-28-2009 Is tumor self or non-self? How are tumor antigens generated? What are they? How does immune system respond? Introduction Tumor Antigens/Categories

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD) SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

T Cell Effector Mechanisms I: B cell Help & DTH

T Cell Effector Mechanisms I: B cell Help & DTH T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide

More information

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmunity Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmune disease can be caused to primary defects in B cells, T cells and possibly

More information

Phenotype and function of nasal dendritic cells

Phenotype and function of nasal dendritic cells nature publishing group ARTICLES Phenotype and function of nasal dendritic cells H Lee 1,2, D Ruane 1,2,1, K Law 2,3,1,YHo 4, A Garg 1, A Rahman 2,5, D Esterházy 6, C Cheong 7, E Goljo 4, AG Sikora 8,

More information

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the

More information

Optimizing Intracellular Flow Cytometry

Optimizing Intracellular Flow Cytometry Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness

Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)

More information

Felix Yarovinsky. Department of Immunology, UT Southwestern Medical Center. Innate immune defense to Toxoplasma gondii

Felix Yarovinsky. Department of Immunology, UT Southwestern Medical Center. Innate immune defense to Toxoplasma gondii Felix Yarovinsky Department of Immunology, UT Southwestern Medical Center Innate immune defense to Toxoplasma gondii Pathogen recognition by innate immune cells Pathogen Parasites Viruses Bacteria Initiator

More information

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity

More information

Essential role of the TNF-TNFR2 cognate interaction in mouse dendritic cell natural killer cell crosstalk

Essential role of the TNF-TNFR2 cognate interaction in mouse dendritic cell natural killer cell crosstalk From www.bloodjournal.org by guest on April 11, 218. For personal use only. IMMUNOBIOLOGY Essential role of the TNF-TNFR2 cognate interaction in mouse dendritic cell natural killer cell crosstalk Jun Xu,

More information

Chapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues

Chapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues Allergy and Immunology Review Corner: Chapter 3, Part A (pages 37-45) of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 3, Part A (Pages

More information

Circulating Endothelial Cells and Their Clinical Significance Jaco Kraan

Circulating Endothelial Cells and Their Clinical Significance Jaco Kraan Circulating Endothelial Cells and Their Clinical Significance Jaco Kraan Department of Medical Oncology Erasmus MC Cancer Institute Rotterdam, The Netherlands ISLH 2016 - Milano, Italy Financial disclosure

More information

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures FastImmune Intracellular Cytokine Staining Procedures BD has developed protocols for the detection of intracellular cytokines in activated lymphocytes and in activated monocytes. The procedures have been

More information

GM CSF Bioactivity and IBD Phenotype. NIH, CCFA, BMRP NIH DHC Trapnell Lab Kugathasan/Plevy Labs MiOk Kim, PhD

GM CSF Bioactivity and IBD Phenotype. NIH, CCFA, BMRP NIH DHC Trapnell Lab Kugathasan/Plevy Labs MiOk Kim, PhD GM CSF Bioactivity and IBD Phenotype NIH, CCFA, BMRP NIH DHC Trapnell Lab Kugathasan/Plevy Labs MiOk Kim, PhD Defective Neutrophil Function in Crohn s Disease Marks et al Lancet 26 GM CSF in Active Crohn

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Categorical analysis of human T cell heterogeneity with One-SENSE

Categorical analysis of human T cell heterogeneity with One-SENSE 1 2 3 4 Supplementary Information Categorical analysis of human T cell heterogeneity with One-SENSE 5 6 Running title: T cell Analysis by One-SENSE 7 8 9 1 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 26

More information

Immune surveillance hypothesis (Macfarlane Burnet, 1950s)

Immune surveillance hypothesis (Macfarlane Burnet, 1950s) TUMOR-IMMUNITÄT A.K. Abbas, A.H. Lichtman, S. Pillai (6th edition, 2007) Cellular and Molecular Immunology Saunders Elsevier Chapter 17, immunity to tumors Immune surveillance hypothesis (Macfarlane Burnet,

More information

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary

More information

Licensing delineates helper and effector NK cell subsets during viral infection

Licensing delineates helper and effector NK cell subsets during viral infection Licensing delineates helper and effector NK cell subsets during viral infection Anthony E. Zamora, 1 Ethan G. Aguilar, 1 Can M. Sungur, 1 Lam T. Khuat, 1 Cordelia Dunai, 1 G. Raymond Lochhead, 2 Juan Du,

More information

qpcr-array Analysis Service

qpcr-array Analysis Service qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,

More information

CCR6 is required for IL-23 induced psoriasis-like inflammation in mice

CCR6 is required for IL-23 induced psoriasis-like inflammation in mice Research article CCR6 is required for IL-23 induced psoriasis-like inflammation in mice Michael N. Hedrick, 1 Anke S. Lonsdorf, 2,3 Aiko-Konno Shirakawa, 1 Chyi-Chia Richard Lee, 4 Fang Liao, 1 Satya P.

More information

The Programmed Death-1 and Interleukin-10 Pathways Play a Down-Modulatory Role in LP-BM5 Retrovirus-Induced Murine Immunodeficiency Syndrome

The Programmed Death-1 and Interleukin-10 Pathways Play a Down-Modulatory Role in LP-BM5 Retrovirus-Induced Murine Immunodeficiency Syndrome JOURNAL OF VIROLOGY, Mar. 2008, p. 2456 2469 Vol. 82, No. 5 0022-538X/08/$08.00 0 doi:10.1128/jvi.01665-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. The Programmed Death-1

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information