SUPPLEMENTARY METHODS

Transcription

1 SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde, embedded in paraffin, sectioned at 5 µm, and stained with hematoxylin and eosin (H&E). Histological scoring (at least 5 sections per mouse) was performed blindly by two investigators using established protocol as described previously 26,27,46. In brief, Crypt damage (0 4), area involved (1 4), inflammation (0 3) and extent (0 3) were performed and cumulative score was calculated. Quantitative RT-PCR. Total RNA from colonic explants was extracted with Trizol (Life Tecnologies) and the first-strand complementary DNA (cdna) was synthesized from 1 µg of total RNA with oligo(dt) 20 primerusing the PrimeScript RT reagent kit (Takara, Kusatsu, Japan) according to the manufacturer s instructions. Transcriptional expression levels were analyzed by using SYBR Premix Ex Taq II on Thermal Cycler Dice (Takara) with specific primer pairs (Supplementary Table 1) after normalization for the expression of Gapdh. Detection of cytokines. Cytokine concentrations were measured for IFN-, TNF-, IL-6, IL-12p40, CCL2 (ebioscience), IFN- and IFN- (Biolegend) using ELISA kit according to the manufacturer s instructions. Immunohistochemical analysis. Colonic tissue obtained on day 5 after the start of DSS treatment was embedded in OCT compound (Sakura Fineteck, Tokyo, Japan) and frozen in liquid N 2. The tissue block was sectioned with a cryostat at 5-7 µm. Frozen section was fixed with cold acetone and blocked in PBS containing 5% of normal rat serum. Subsequently, slide was stained with FITC-conjugated anti-cd11b mab (BD Biosciences) and mounted with Vectashield containing DAPI (Vector laboratories,

2 Burlingame, CA). The stained slides were analyzed with a BIOREVO fluorescence microscope (BZ-9000; KEYENCE, Osaka, Japan) and Cytoscketch software (Tomy Digital Biology, Tokyo, Japan).

3 Supplementary Table 1 RT-PCR primer GAPDH Sequence F-5 -AAATTCAACGGCACAGTCAAG-3 R-5 -TGGTGGTGAAGACACCAGTAG-3 CCL2 F-5 -AGCAGCAGGTGTCCCAAAGA-3 R-5 -GTGCTGAAGACCTTAGGGCAGA-3 CCL3 F-5 - GAAACCAGCAGCCTTTGCTC -3 R-5 - AGGCATTCAGTTCCAGGTCAGT-3 CCL5 F-5 - TGCCCACGTCAAGGAGTATTT-3 R-5 - TCTCTGGGTTGGCACACACTT-3 CCL7 F-5 -TCTGCCACGCTTCTGTGCC-3 R-5 -AACAGCTTCCCAGGGACACCG-3 CCL8 F-5 -TGCCCCATGGAAGCTGTGG-3 R-5 -ACGCAGCCCAGGCACCATC-3 CCL25 F-5 -GAGTGCCACCCTAGGTCATC-3 R-5 -CCAGCTGGTGCTTACTCTGA-3 CXCL9 F-5 -TTTTCCTCTTGGGCATCATC-3 R-5 -AGTCCGGATCTAGGCAGGTT-3 CXCL10 F-5 -ATATCGATGACGGGCCAGTGA-3 R-5 -TTTCATCGTGGCAATGATCTCA-3 CXCL11 F-5 -AGCTGCTCAAGGCTTCCTTATGT-3 R-5 -TCTGCCATTTTGACGGCTTT-3 IFN-α F-5 -TCTGATGCAGCAGGTGGG-3 R-5 -AGGGCTCTCCAGACTTCTGCTCTG-3 IFN-β F-5 -GCACTGGGTGGAATGAGACT-3 R-5 -AGTGGAGAGCAGTTGAGGACA-3

4 Supplementary Figure 1 Influences of the ablation of pdcs and cdcs on the development of DSS-induced acute colitis. (a) Bone marrow (BM)-derived pdc (BM-pDCs) were generated by the culture of BM cells with Fms-related tyrosine kinase 3 ligand (Flt3-L) for 8 days (left panel), and BM-pDCs as B220 + CD11b - population were sorted (right panel). Data are represented as a dot plot, and numbers represent the proportion of indicated population in each plot. (b) The expression of cell surface molecules on the sorted BM-pDCs was analyzed by flow cytometry. Data are represented as a histogram. (c,d) WT mice (n=10) and pdc-ablated mice (n=10) that had been treated with DT on 1 day before DSS treatment and on days 3 and 7 after the

5 start of the treatment were orally administrated with 2% DSS for 7 days, then switched to normal drinking water. The disease progression was monitored for 14 days. Changes in BW (c) and survival rate (d) were plotted. (e) The frequency of CD11c high BST2 - cdcs and CD11c int BST2 + pdcs in Spl, MLN, and colonic LP obtained from WT mice (n=3) and cdc-ablated mice (n=3) that had been treated with DT on 1 day before DSS treatment and on day 3 after the start of the treatment were analyzed by flow cytometry. Data are represented as a dot plot, and numbers represent the proportion of CD11c high BST2 - cdcs and CD11c int BST2 + pdcs among CD CD64 - leukocytes in each quadrant. (f,g) WT mice (n=4), pdc-ablated mice (n=4), and cdc-ablated mice (n=4) that had been treated with DT on 1 day before DSS treatment and on day 3 after the start of the treatment were orally administrated with 2% DSS for 7 days, and the disease progression was monitored. Changes in BW for 7 days (f) and on day 7 (g) were plotted. P < 0.01 compared with WT mice. All data are representative at least three independent experiments.

6 Supplementary Figure 2 Influence of the deficiency of IFNAR1 on the development of DSS-induced acute colitis. (a,b) WT mice (n=4) (a) and Ifnar1 -/- mice (n=4) (a,b), and Ifnar1 -/- pdc-ablated mice (b) were orally administrated with 2% DSS for 7 days, and the disease progression was monitored, and the changes in BW was plotted. (c) WT mice (n=4) and pdc-ablated mice (n=4) were orally administrated with or without 2% DSS for 7 days, and transcriptional expression levels of IFN-I in the middle colonic explants obtained from WT mice and pdc-ablated mice were measured by quantitative RT-PCR. Data are the mean ± s.d. from three individual samples in a single experiment. All data are representative at least three independent experiments.

7 Supplementary Figure 3 Flow cytometry analysis for identification of leukocytes in the colonic LP. LP cells were analyzed in the indicated sequential gates for forward scatter-area (FSC-A)/side scatter-area (SSC-A), propidium iodide (PI)/SSC-A to exclude dead cells, CD45.2/SSC-A to include leukocytes, FCS-height (FCS-H)/ FSC-width (FCS-W) to include singlet cells, and B220/CD11b to identify B220 + CD11b - CD11c int BST2 + pdcs (R1). For detection of myeloid cells, FCS-H/FCS-W-gated LP leukocytes were further analyzed for I-A/I-E and CD11b/SSC-A to identify I-A/I-E + CD11c high CD64 - cdcs (R2), I-A/I-E + CD11c + CD64 + macrophages (R3), I-A/I-E - CD11b + Ly6C high inflammatory monocytes (R4), I-A/I-E - CD11b + Ly6G + neutrophils (R5), and I-A/I-E - CD11b + Siglec-F + eosinophils (R6).

8 Supplementary Figure 4 Specific expression of Siglec-H on the pdcs in the LP and MLN during the development of DSS-induced acute colitis. WT mice (n=4) that had been treated with DT on 1 day before DSS treatment and on day 3 after the start of the treatment were orally administrated with 2% DSS, and the cell surface expression of Siglec-H on B220 + CD11b - CD11c int BST2 + pdcs, I-A/I-E + CD11c high CD64 - cdcs, I-A/I-E + CD11c + CD64 + macrophages (Mac), I-A/I-E - CD11b + Ly6C high inflammatory monocytes (Mono), I-A/I-E - CD11b + Ly6G + neutrophils (Neu), I-A/I-E - CD11b + Siglec-F + eosinophils, (Eo) CD3ε + T cells, and B220 + CD19 + B cells in colonic LP and MLN was analyzed by flow cytometry on day 0 and 5 after the start of DSS treatment. Data are represented as a histogram. All data are representative at least three independent experiments.

9 Supplementary Figure 5 Selective elimination of pdcs in pdc-ablated mice during the development of DSS-induced acute colitis. (a,b) pdc-ablated mice (n=4) that had been treated with or without DT on 4 day after the start of DSS treatment were orally administrated with 2% DSS. Absolute cell number of B220 + CD11b - CD11c int BST2 + pdcs, I-A/I-E + CD11c high CD64 - cdcs, I-A/I-E + CD11c + CD64 + macrophages, I-A/I-E - CD11b + Ly6C high inflammatory monocytes, I-A/I-E - CD11b + Ly6G + neutrophils, I-A/I-E - CD11b + Siglec-F + eosinophils, CD3ε + T cells, and B220 + CD19 + B cells in the colonic LP (a) and MLN (b) were analyzed by flow cytometry on day 5 after the start of DSS treatment. Data are the mean ± s.d. from three individual samples in a single

10 experiment. *P < 0.01 compared with WT mice. All data are representative at least three independent experiments.

11 Supplementary Figure 6 Cell surface expression of MHC and costimulatory molecules on pdcs. WT mice (n=4) that had been treated with DT on 1 day before DSS treatment and on day 3 after the start of the treatment were orally administrated with or without 2% DSS, and the expression of cell surface molecules on pdcs in Spl, MLN, and colonic LP was analyzed by flow cytometry on day 7 after the start of DSS treatment. Data are represented as a histogram. All data are representative at least three independent experiments.

12 Supplementary Figure 7 pdc does not affect the frequency of T-cell subsets in the inflamed colonic LP. WT mice (n=4) and pdc-ablated mice (n=4) that had been treated with DT on 1 day before DSS treatment and on day 3 after the start of the treatment were orally administrated with 2% DSS for 7 days. The proportion of intracellular IFN-γ- and IL-17-producing cells among gated CD4 + T cells (a) and CD4 + Foxp3 + cells among CD CD3ε + population (b) in the colonic LP obtained from DSS-fed WT mice and pdc-ablated mice were analyzed by flow cytometry on day 7 after the start of DSS treatment. Data are represented by a dot plot, and numbers represent the proportion of IFN-γ + cells and IL-17 + cells among gated CD4 + T cells (a) or CD4 + Foxp3 + cells (b) among CD CD3ε + population in each quadrant.