All Serotypes of Dengue Viruses Circulating in Kuala Lumpur, Malaysia

Transcription

1 Current Research Journal of Biological Sciences 4(2): , 2012 ISSN: Maxwell Scientific Organization, 2012 Submitted: December 22, 2011 Accepted: January 21, 2012 Published: March 10, 2012 All Serotypes of Dengue Viruses Circulating in Kuala Lumpur, Malaysia 1 M.H. Chew, 2 M.M. Rahman, 3 J. Jelip, 4 M.R. Hassan and 5 I. Isahak 1 Public Health Laboratory, Kota Kinabalu, Ministry of Health, Kota Kinabalu, 88850, Sabah, Malaysia 2 Deptartment of Medical Microbiology and Immunology, Faculty of Medicine, The National University of Malaysia, Cheras, Kuala Lumpur, Malaysia 3 Department Health of Sabah, Kota Kinabalu, 88818, Sabah, Malaysia 4 Department of Community Health, Faculty of Medicine, The National University of Malaysia, Cheras, Kuala Lumpur, Malaysia 5 Faculty of Medicine and Health Sciences, Islamic Science University of Malaysia, Pandan Indah, 55100, Kuala Lumpur, Malaysia Abstract: Dengue is a severe disease caused by dengue virus (DENV), transmitted to human being by infected Aedes mosquitoes. It is a major public health concern in Southeast Asia due to its fatality in the form of Dengur Hemorrhagic Fever (DHF) and Dengue Shock Syndrome (DSS). The objective of the study was to isolate and identify dengue virus serotypes prevalent in endemic areas of Kuala Lumpur and Selangor in Malaysia by virus culture, indirect immunoflurecent assay and molecular techniques. A total number of 232 sera samples were obtained from patients with clinical manifestations of dengue fever reported to University Kebangsaan Malaysia Medical Centre (UKMMC). The sera samples collected, were analyzed for IgM/IgG detection for the assessment of primary and secondary dengue fever, propagation in cell-line C36/36, Indirect Immunoflurecent Assay (IFA) and RT-PCR. The study confirmed 46 dengue cases where 15 (32.61%) were dual infections with DENV-1 and DENV- 4, 12 (26.09%) dual infections with DENV-3 and DENV-4, and 11 (23.91%) were dual infection with DENV-2 and DENV-4. Only 1 (2.17%) was dengue infection with DENV-3 and 7 (15.22%) were with DENV-4. Dengue serotype 4 was the most common serotype identified in the present study.the highest number of dengue cases detected in Cheras, Kuala Lumpur where all 4 types of dengue virus were prevalent. All serotypes of dengue viruses circulation only in Kuala Lumpur and Selangor Malaysia, needs further strengthening of the dengue preventive measure in the city areas and in the country. Key words: Dengue fever, dengue hemorrhagic fever, DENV, RT-PCR, serotypes INTRODUCTION Dengue virus belongs to the genus flavivirus and the family Flaviviridae. There are four serotypes of DENV (DENV-1, DENV-2, DENV-3 and DENV-4, respectively). The virus causes fatal disease of human being is known as dengue fever. It poses great threat to global health.throughout the world, an estimated 50 million dengue infections occur annually and approximately 2.5 billion people live in dengue endemic countries (WHO, 2008). The number of dengue fever (DF) and dengue haemorrhagic fever (DHF) has increased dramatically during the last few years. The global trend for the increasing number of dengue cases became almost double from the figure to (WHO, 2008). In Malaysia, Dengue virus was first reported in 1902 in Penang (Skae, 1902) and since then it became a major public health problem, especially with the appearance of the first DHF outbreak, also in Penang, in 1962 (Rudnick et al., 1965). To date, rapid industrialization and economic development and massive migration of people from rural to urban areas and air travel international have brought massive infrastructure development that led to the creation of man-made habitats for the breeding of Aedes aegypti and Aedes albopictus, as vector of dengue virus. Recently incidence rate of has been recorded 63.6 per population in Malaysia (Ministry of Health Malaysia, 2011). Most of the dengue cases reported in the urban population (70-80%), with the highest incidence in the working and school-going age group, correlating with the high Aedes Index in construction sites, factories and schools (Ministry of Health Malaysia, ). Corresponding Author: M.H. Chew, Public Health Laboratory Kota Kinabalu, Ministry of Health, Kota Kinabalu, 88850, Sabah, Malaysia 229

2 Table 1: Primer sequence used for the present study for the detection of 4 types of dengue viruses No Primer Primer sequence Specifity Serotype Primer set Product size (bp) 1 md1 TCAATATGCTGAAACGCGAGAGAAACCG DENV (all) 2 D2 TTGCACCAACAGTCAATGTCTTCAGGTTC DENV (all) md1-d rts1 CCCGTAACACTTTGATCGCT DENV-1 DENV-1 md1-rts mts2 CGCCACAAGGGCCATGAACAGTTT DENV-2 DENV-2 md1-mts TS3 TAACATCATCATGAGACAGAGC DENV-3 DENV-3 Md1-TS rts4 TTCTCCCGTTCAGGATGTTC DENV-4 DENV-4 md1-rts4 260 Prevalence of dengue virus based on molecular detection has been performed extensively in Malaysia. It is prerequisite to know the status of the circulating dengue virus serotypes for effective preventive measure. Vaccination development needs information of circulating serotypes of DENV in an area, locality and country. Keeping the above in view the present study was aimed to detect and identify serotypes of dengue viruses by, virus culture, IFA and conventional RT-PCR MATERIALS AND METHODS Study design: A cross sectional study was carried out at the University Kebangsaan Malaysia Medical Centre, Kuala Lumpur from June to November The patients suspected with Dengue Fever (DF), Dengue Hemorrhagic Fever (Dhf) and Dengue Shock Syndrome (DSS) were provided provisional clinical diagnosis of acute dengue illness and selected for this study. Ethical approval: The study was approved by Ethical Committee of the University Kebangsaan Malaysia Medical Centre (FF ). Specimen collection: A total number of 232 specimens were collected as calculated to determine the sample size. Acute phase venous blood sample were collected from patients. The 3-5 ml of venous blood was collected from each patient and was allowed to clot for the separation of serum into the plain tube for 1hr at room temperature. The clotted bloods were centrifuged at 3500 rpm for 10 min at 4ºC to separate serum from clotted blood. The collected sera specimens were kept in small aliquots and stored at -21ºC for virological, serological and molecular technique. Virus culture: Cell-line C6/36 clone with 10% heatinactivated fetal bovine serum (Gibco, USA) in 25cm 2 cell culture flask was used for the cultivation of DENV. The plates were incubated at 30ºC and 10 days incubation for growth of dengue virus / development of Cyto-Pathic Effect cell (CPE). Indirect immunoflourescene assay: It was performed using serotype specific monoclonal antibodies to identify dengue virus serotype as per the procedure of Henchal et al. (1983), Briefly, slides were prepared with 10 ul of infected cell suspension. The slides were incubated in humidified chamber at 37ºC for 30 min. Initially the slides were screened by group specific flavivirus antibodies, later on tested by commercially monoclonal mouse antidengue type 1 (Hawaiian), mouse anti-dengue type 2 (New Guinea C), mouse dengue type 3 (H87) and mouse anti-dengue type 4 (H241) from Millipore, USA. Slides were then observed under fluorescent microscope for the detection of dengue virus. RNA extraction: RNA was extracted from 140 ul of virus-infected tissue culture fluid using a QIAmp viral RNA kit (QIAGEN, Inc., Germany) according to the manufacturer s protocol. Primer selection: Primers from C-prM amplimers of Dengue virus sequence was initially designed by Lanciotti et al. (1992) and later on modified and redesigned by Chien et al. (2006). The primers listed in Table 1 were used in this study. One-step RT-PCR was used to identify all four serotypes of dengue viruses. This protocol involved two sequential amplifications. The initial RT-PCR amplification assay was: 25 ul reaction mixture containing 5 ul of RNA, 25 pmol of the md1 and D2 primers, and components of a one-step RT-PCR kit (QIAGEN). The amplification involved the following steps: Reverse transcription at 50ºC for 30 min; one cycle of initial denaturation of the reverse transcriptase and activation of the HotStart Taq polymerase at 95ºC for 15 min, 55ºC for 15 s, and 72ºC for 30 s; 34 cycles at 95ºC for 15 s, 55ºC for 15 s, and 72ºC for 30 s, and a 10 min, 72ºC extension. The nested PCR was performed using HotStart Taq master mix kit (QIAGEN) with 5 ul of RT- PCR product from a previous reaction and 25 pmol of each primer (md1, rts1, mts2, TS3, and rts4, respectively) in a 25 ul total reaction mixture. The amplification involved 1 cycle for 15 min at 95ºC for polymerase activation and 25 cycles at 95/ºC for 15 s, 55ºC for 15 s, and 72ºC for 30 s. Gel electrophoresis was used for visualization of the PCR product. A 5 ul of the RT-PCR product was analyzed on 2.5% agarose gel electrophoresis, stained with gel red (Biotium, USA) and visualized under ultraviolet radiation. The size of the RT-PCR products with resulted from the amplification of DEN-1, DEN-2, DEN-3 and DEN-4 was 208 bp, 119 bp, 288 bp, and 260 bp, respectively. RESULTS AND DISCUSSION Detection of four dengue serotypes (DENV-1, DENV-2, DENV-3 and DENV-4, respectively) by virus 230

3 Table 2: Detection of dengue serotypes in different localities of Kuala Lumpur and its adjacent areas with disease severity and serologic response Serotype identified No Patient no. Locality Date collected Disease severity Serologic response IFA RT-PCR 1 MS Cheras DSS S DEN-1/DEN-4 DEN-1/ DEN-4 2 MS ? DF P DEN-1/DEN-4 DEN-1/ DEN-4 3 MS Serdang DHF S DEN-3/ DEN-4 DEN-3/ DEN-4 4 MS ? DF P DEN-3 DEN-3 5 MS Cheras DF P DEN-3/ DEN-4 DEN-3/ DEN-4 6 MS Cheras DHF P DEN-3/ DEN-4 DEN-3/ DEN-4 7 MS Kuala lumpur DF S DEN-2/ DEN-4 DEN-2/ DEN-4 8 MS Cheras DF * DEN-2/ DEN-4 DEN-2/ DEN-4 9 MS Cheras DF P DEN-3/ DEN-4 DEN-3/ DEN-4 10 MS Sungai besi DF S DEN-1/ DEN-4 DEN-1/ DEN-4 11 MS Ampang DHF P DEN-1/ DEN-4 DEN-1/ DEN-4 12 MS Cheras DF P DEN-3/ DEN-4 DEN-3/ DEN-4 13 MS Cheras DHF S DEN-1/ DEN-4 DEN-1/ DEN-4 14 MS Kuala lumpur DF P DEN-3/ DEN-4 DEN-3/ DEN-4 15 MS Cheras DF P DEN-1/ DEN-4 DEN-1/ DEN-4 16 MS Sri petaling DF P DEN-2/ DEN-4 DEN-2/ DEN-4 17 MS Kajang DF P DEN-3/ DEN-4 DEN-3/ DEN-4 18 MS Cheras DF * DEN-1/ DEN-4 DEN-1/ DEN-4 19 MS Balakong DF P DEN-1/ DEN-4 DEN-1/ DEN-4 20 MS Sungai besi DF P DEN-1/ DEN-4 DEN-1/ DEN-4 21 MS Pudu DF P DEN-2/ DEN-4 DEN-2/ DEN-4 22 MS Cheras DF P DEN-1/ DEN-4 DEN-1/ DEN-4 23 MS Sungai besi DF P DEN-2/ DEN-4 DEN-2/ DEN-4 24 MS Cheras DSS S DEN-4 DEN-4 25 MS Cheras DF P DEN-4 DEN-4 26 MS Kajang DF P DEN-4 DEN-4 27 MS Puchong DF S DEN-2/ DEN-4 DEN-2/ DEN-4 28 MS Cheras DF P DEN-3/ DEN-4 DEN-3/ DEN-4 29 MS Cheras DF P DEN-3/ DEN-4 DEN-3/ DEN-4 30 MS Pudu DF P DEN-4 DEN-4 31 MS Serdang DHF P DEN-2/ DEN-4 DEN-2 /DEN-4 32 MS Cheras DF P DEN-4 DEN-4 33 MS Cheras DF * DEN-3/ DEN-4 DEN-3/ DEN-4 34 MS ? DF * DEN-3/ DEN-4 DEN-3/ DEN-4 35 MS Bukit bintang DF P DEN-1 / DEN-4 DEN-1/ DEN-4 36 MS Cheras DHF S DEN-3/ DEN-4 DEN-3/ DEN-4 37 MS ? DF S DEN-4 DEN-4 38 MS Sungai besi DF S DEN-3/ DEN-4 DEN-3/ DEN-4 39 MS Cheras DF * DEN-2/ DEN-4 DEN-2/ DEN-4 40 MS ? DF * DEN-2/ DEN-4 DEN-2/ DEN-4 41 MS Cheras DF * DEN-1/ DEN-4 DEN-1/ DEN-4 42 MS Kuala lumpur DF S DEN-2/ DEN-4 DEN-2/ DEN-4 43 MS Sri petaling DF * DEN-2/ DEN-4 DEN-2/ DEN-4 44 MS Cheras DHF P DEN-1/ DEN-4 DEN-1/ DEN-4 45 MS ? DF * DEN-1/ DEN-4 DEN-1/ DEN-4 46 MS Cheras DF P DEN-1/ DEN-4 DEN-1/ DEN-4 DF: Dengue Fever; DHF: Dengue Hemorrhagic Fever; DSS: Dengue Shock Syndrome; P: Primary dengue (IgM); S: Secondary dengue (IgG); *: not done;?: no record found in patient file culture and RT-PCR confirmed that multiple of dengue virus serotypes have been circulating in hyper-endemic area Kuala Lumpur. This study confirmed that 46 positive dengue cases (Table 2) were 15 (32.6%) dual infections of DENV-1 and DENV- 4, 12 (26.1%) dual infections of DENV-3 and DENV-4, and 11 (23.9%) dual infection of DENV-2 and DENV-4. Only 8 (17.4%) patients were identified as single infections; one was with DENV-3 and 7 were with DENV-4. In this study, DENV-4 was the most common serotype dengue virus among DENV-1, DENV-3 and DENV-2, respectively. It reveals (Table 2) that of the 46(19.8%) positive dengue cases identified during study period only 7 (15.2%) Identified as DHF and 2(4.3%) as DSS and rest 37(80.4%) showing the symptoms of DF as per classification of Clinical Practice Guidelines by Ministry of Health Malaysia (2010). Sera from dengue patients were also tested for the detection of IgM and IgG to differential between primary and secondary infections. It was observed that out of the 46 cases 26 (56.5%) were primary infections of dengue where only IgM detected, 11 (23.9%) were secondary infections of dengue in those 231

4 Fig. 1: Detection dengue virus by indirect immunoflourescence assay 511bp 260bp 208bp M NC (a) (b) (c) M: ladder 50bp (NEB); Lanes 1, 2, 3 and 4: sample; NC: Negative Control; DENV-1: 208 bp; DENV-2: 119 bp; DENV- 3: 288 bp; DENV-4: 260 bp; DENV positive of previous One Step RT-PCR: 511 bp, (A) showing detection of DENV-1 and DENV-4, (B) DENV-2 and DENV-4, and (C) DENV-3 and DENV-4 by semi-nested PCR, respectively Fig. 2: Detection of dengue serotypes by nested PCR No. of DEN serotypes Ampang Balakong Cheras Kajang Kuala lumpur city Serdang Sri petaling DEN-4 DEN-1/DEN-4 DEN-2/DEN-4 DEN-3/DEN Localities Sungai besi Pudu Bukit bintang Puchong Fig. 3: Detection of dengue serotypes in different localities of Kuala Lumpur and Selangor case IgG was detected and sera of 9(19.6%) patients both IgM and IgG could not be detected due to acute phase of infection from where DENV was identified. Figure 1 and 2 confirmed the identification of all serotypes of dengue virus by Indirect Immunoflourescence Assay (IFA) and RT-PCR, respectively. Locality wise distribution of dengue virus serotypes shows (Fig. 3) that the highest number (22) of DENV identified from Cheras area of Kuala Lumpur where all four dengue serotypes (DENV-1, DENV-2, DENV-3 and DENV-4, respectively) were identified, next was Sungai Besi area where four cases identified in which all four dengue serotypes of dengue present., 3 DENV were identified from the city area of Kuala Lumpur in which serotypes DENV-2, DENV-3 and DENV-4 were prevalent, In Serdang area DENV were identified in two patients of which three dengue serotypes (DENV-2, DENV-3 and DENV-4, respectively) were present, In the area of Sri Petaling, Pudu and Puchong DENV were identified and the serotypes were DENV-2 and DENV-4. In other areas of Kuala Lumpur (Balakong and Ampang) DENV were identified and serotypes were DENV-1 and DENV4. Its reveals from the present study, all four dengue serotypes are circulating now in only in the capital city in Malaysia, with the predominance of DENV 4. In Malaysia also mosquito is the vector for the transmission of DENV, Aedes albopictus is found more in peri-urban setting on the other hand Aedes aegypti is commonly associated with DF/DHF in urban areas but there is no convincing evidence of the association of Aedes albopictus with severe dengue (Lam, 1993). In a study by Lam (1993) reported that DENV-3 was the predominant circulated during 1985 and The author reported that in 1987 and 1988 DENV was replaced by 232

5 DENV-1 and from 1989 to 1991, the predominant serotype was DENV-2 and this serotype accounted for a serious outbreak during these three years. Lam (1993) also reported that between , all four dengue serotypes were isolated in Malaysia, the most common serotype being DENV-1, while the least common being DENV-4. In Abu Bakar et al. (2002) observed in a study that DENV-4 was the predominant serotype isolated from DF patients in Malaysia during the period 1967 to 1969 and presence of all dengue virus serotypes in Malaysia with none of the serotypes being the dominant serotype in the period 1971 to However, in 2006, common serotypes were DENV-1 and DENV-3, in 2007 were DENV-1, DENV-2 and DENV-3 and in 2008 and in 2009 was DENV-3 (Vinomarlini et al., 2011). In the present study it has been observed scenario of DENV serotypes again changed here with the presence of all serotypes DENV4 is the predominant. The massive multiple co-circulating of four dengue serotypes in hyperendemic areas in Kuala Lumpur and Selangor, might possible cause be several factors of transmission dengue infections. In our report Cheras area in Kuala Lumpur capital was the highest infected area with multiple co-circulating of four serotypes, follow by areas Sungai Besi, City Kuala Lumpur, Sri Petaling, Serdang, Pudu, Kajang, Ampang, Balakong Bukit Bintang and Puchong (Fig. 3). The possible reason for the detection of high percent of dengue viruses with all serotypes only in the capital city may be explained from the observation of Gubler (1998b) who mentioned that transmissions of dengue infection are influenced by several factors; among them increase of population growth, rapid urbanization, rural-urban migration inadequacies in urban infrastructure, including solid waste disposal and rise in domestic and international air travelling. Besides that, transmission of dengue viruses is also influenced by climate, such as high rainfall, high temperature or global warming (Patz et al., 1996). Climate change such as high rainfall and global warming can lead to an increase in transmission of mosquitoes and create new opportunities for the survival of pathogens and vectors (Barclay, 2008). In addition to the co-circulation of multiple virus serotypes in a community, opportunities for infections of humans are also increased by the feeding behavior of Ae.aegypti. This mosquito frequently feeds multiple times during a single gonotropic cycle (Scott et al., 1997) Aedes aegypti mosquitoes experimentally infected with dengue viruses spend a longer time probing to acquire a blood meal compared with uninfected mosquitoes (Platt et al., 1997). Longer feeding periods increase the chance of host defensive behavior against blood-seeking mosquitoes, and increase the possibility that mosquitoes will feed on more hosts to complete their blood meals. This type of Aedes aegypti feeding behavior may thus increase the chances that they will become dually infected and subsequently transmit multiple viruses to a single host (Lorono-Pino et al., 1999; Weaver and Vasilakis, 2009). The exact cause of high prevalence of multiple serotypes in the capital city of Malaysia has yet to be determined thorough epidemiological investigation and phylogenetic analysis of the genome of isolated dengue virus serotypes. In this regard a follow up study is being conducted to find out the origin of the causal agent and cause for the high incidence of all serotypes in single locality. In conclusion, out of 232 dengue suspected specimens processed in the study 46 (19.82%) were positive for dengue virus where all 4 serotypes of DENV were present only in capital city Kuala Lumpur, Malaysia with the commonest type DENV4. It is interesting to note that in spite of large number of dual infections only 9 cases DHF/DSS were observed. ACKNOWLEDGMENT Authors acknowledge for the partial financial support provided by the UKMMC in the form of research grant FF REFERENCES Abu Bakar, S., P.F. Wong and Y.F. Chan, Emergence of dengue virus type 4 genotype IIA in Malaysia. J. Gen. Virol., 83: Barclay, E., Is Climate Change Affecting Dengue in the Americas World Report March, Reterived from: 22: 371. Chien, L.J., T.L. Liao, P.Y. Shu, J.H. Huang, D.J. Gubler and G.J. Chang, Development of real-time reverse transcriptase PCR assay to detect and serotype dengue viruses. J. Clin. Microbial, 44: Gubler, D.J., 1998b. Dengue and dengue hemorrhagic fever. Clin. Microbiol. Rev., 11: Henchal, E.A., J.M.M. Cown, M.C. Seguin, M.K. Gentry and W.E. Brandt, Rapid identification of dengue virus isolates by using monoclonal antibodies in an indirect immunofluorescence assay. Am. J. Trop. Med. Hyg., 32: Lam, S.K., Two decades of dengue in Malaysia. Trop. Biomed., 10: Lanciotti, R.S., C.H. Calisher, D.J. Gubler, G.J. Chang and A.V. Vordam, Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J. Clin. Microbial., 30:

6 Lorono-Pino, M.A., C.B. Cropp, J.A. Farfán, A.V. Vorndam, E.M. Rodriguez-Angulo, E.P. Rosado-Paredes, L.F. Flores-Flores, B.J. Beaty and D.J. Gubler, Common occurrence of concurrent infections by multiple dengue virus serotypes. Am. J. Trop. Med. Hyg., 61(5): Ministry of Health Malaysia, Clinical Practice Guidelines on Management of Dengue Infection in Adults. Revised 2nd Edn., Virology, pp: 3. Ministry of Health Malaysia, Press Release of Dengue Fever Situation in Malaysia Week 48. Reterived from: " my/ press _releases/ 127" gov.my/press_releases/127, (Accessed on: 27 November, 3 December 2011). Ministry of Health Malaysia, Annual Reports of Vector-borne Disease Control Programme. Patz, J.A., P.R. Epstein, T.A. Burke and J.M. Balbus, Global climate change and emerging infectious diseases. JAMA, 275: Platt, K.B., K.J. Linthicum, K.S. Myint, B.L. Innis, K. Lerdthusnee and D.W. Vaughn, Impact of dengue virus infection on feeding behavior of Aedes aegypti. Am. J. Trop. Med. Hyg., 57: Rudnick, A., E.E. Tan, J.K. Lucas and M.B. Omar, Mosquito-borne haemorrhagic fever in Malaysia. Br. Med. J., 1: Scott, T.W., A. Naksathit, J.F. Day, P. Kittayapong and J.D. Edman, A fitness advantage for Aedes aegypti and the viruses it transmits when females feed only on human blood. Am. J. Trop. Med. Hyg., 57: Skae, F.M., Dengue fever in penang. Br. Med. J., 2: Vinomarlini, G., T. Rogayah, T.S. Saraswathy, R. Thayan, M. Apandi, M.K. Fauziah and Z. Saat, Molecular typing of dengue viruses circulating on the east coast of peninsular Malaysia from 2005 to Southeast Asian J. Trop. Med. Public Health, 42(1): Weaver, S.C. and N. Vasilakis, Molecular evolution of dengue viruses: Contributions of phylogenetics to understand the history and epidemiology of the preeminent arboviral disease. Infect. Genet. Evol.,9: World Health Organization, WHO, Dengue and Dengue Haemorrhagic Fever. Factsheet No 117, Revised May Geneva, World Health Organization, Reterived from: http: // factsheets/fs117/en/. 234