Isolation of a Broadly Neutralizing Antibody with Low Somatic Mutation from a Chronically Infected HIV-1 Patient

Save this PDF as:

Size: px
Start display at page:

Download "Isolation of a Broadly Neutralizing Antibody with Low Somatic Mutation from a Chronically Infected HIV-1 Patient"


1 Isolation of a Broadly Neutralizing Antibody with Low Somatic Mutation from a Chronically Infected HIV-1 Patient Amanda Fabra García, Carolina Beltrán Pavez, Alberto Merino Mansilla, Cristina Xufré, Isabel Crespo, Josep M Gatell, Felipe García, Eloísa Yuste, Víctor Sánchez Merino. AIDS research group: Retrovirology and Viral Immunopathology Laboratory. IDIBAPS/Hospital Clínic. Barcelona The AIDS Immunopathology Unit. National Center of Microbiology. National Institute of Health Carlos III (ISCIII)

2 Broadly Neutralizing Antibodies (BnAbs) against HIV-1 BnAbs are capable to neutralize diferent HIV-1 isolates from differents clades. Unmutated Have high SHM Common Between Ancestor 10% and 50% of individuals, depending upon the but definition are not broad of (Germnline) potency and breadth, develop a broadly neutralizing capacity against diverse HIV-1 strains. Burton, D. R., & Hangartner, L. (2016). Annual rev Time of immunol). BnAbs are able to PREVENT and CONTROL infection in animal models. Somatic Hypermutation (SHM) (Gautam R, Nature 2016 ) bnabs mature to Certain neutralizing antibodies are able to CONTROL recognize infection multiple in Clinical viral Trials. (Caskey, Nature 2016; Scheid, Nature 2016; Bar, N Engl J Med 2016) variants Dead-end antibodies do not evolve They cannot tolerate viral escape mutations ANTIBODY BREAD/POTENCY 0-2 year 2-4 years Moore P et al. Immunol Rev 2017

3 Broadly Neutralizing Antibodies Characteristics V1/V2 CD4bs V3 gp120 gp41 gp120- gp41 interface V1/V2 CD4 V3 N-glycans binding-site MPER region epitopes directed High Long SHM gp120-gp41 HCDR3 (Somatic Autoreactivity long HCDR3 (heavy interface High Mutation) chain complementarity-determining (PGT151, High 35022, SHM SHM 8ANC195) region 3) (b12, VRC01, VRC07, (2G12, (PG16,PG9, , 3BNC117, (10E8, 4E10, PGDM1400) PGT121, PGV04) 2F5) PGT128, PGT135) MPER region Viral membrane HIV-1 envelope glycoprotein (Env) is the sole target of bnabs

4 Usually bnabs have long HCDR3. High SOMATIC HYPERMUTATION (SHM). BnAbs have long maduration periods with the antigen Difficult to reproduce through conventional vaccination High SHM: Anti-Antibody responses

5 Vector-mediated gene transfer: long-term systemic production of bnabs rhesus monkeys study SHM SHM Distance from germline (High SHM) correlates with the magnitude of the anti-antibody response Martinez-Navio, et al. Molecular Therapy 2016

6 Our work focus Viral load 100% Non-neutralizing antibodies until 50% Broadly Neutralizing Antibodies(bNAbs) T CD4 + cells CD4 T cells 100% Autologous Neutralizing Antibodies Adapted from Euler et al, Front Immunol. 2012

7 Main objetive Isolation and characterization of antibodies against HIV-1 Env in the patients previously described

8 Isolation of individual Env-specific B cells We have adapted to the laboratory a method described in 2008 by Dr. Nussenzweig's group

9 Sorting of Env-specific B cells 293F co-transfection: + GFP Env+ HIV-1 63,5% 293F B cells PBMCS from patients with broadly neutralizing response CD19+ IgG+ Cytometry Plataform IDIBAPS In colaboration with Dr. Cristina Xufré CD19+ IgG+ Klein et al,. Science 2012; 209: FACS sorting doblets

10 Env+ IgG+ Gating Strategy Env-GFP+ IgG-APC+ CD19-PerCP Cy5.5+ CD19+

11 Cell Doublets Amnis Imaging Flow Cytometers - EMD Millipore

12 Antibody production CD19+ IgG+ Cell doublets sorting Single B-cell Variable region-igg RT-PCR IgH Ig Ig Cloning VH DH JH V J V J 1 HC Constant region 1 Human LC Constant region 1 Human LC Constant region 1 Human Nussenzweig s plasmids H + L co-transfection (293F cell) Ab purification

13 We have found 3 gp120 +IgGs from chronic patients rgp120 AC10.0 ELISA

14 We have got one Broadly Neutralizing Antibody The antibody A is capable to neutralize 5 virus from the minipanel Virus Minipanel Virus Subtype Tier Tropism J G F1 F2 92UG024 (D) VSV H D CM244 AE 2 K NL43(B) CCR5 CM 224(AE) AC10 B 2 CCR5 B AC10(B) A2 V1 191(A) 92BR025(C) 92UG024 D 2 C CXCR4 A1 NL4.3 B 1A CXCR4 92BR025 C 1B CCR5 VI191 A 2 CCR5 IC 50 N 0.1 O Medina-Ramírez M et al., J virol. (2011);12:

15 Epitope mapping (in progress) Recognizes rgp120 (MPER negative) Recognizes a conformational epitope (SDS-PAGE negative) Does not recognizes the CD4bs RSC3 RSC3 P363N RSC3 G367R A 7 V R C E Dra. Nuria Gonzalez A Concentration (µg/ml)

16 % Infectivity Patient cart patient VSV CM244 AC10 92UG024 NL4-3 92BR025 V Purified IgG g/ml 10 1 Patient on ART Low viral load 4.5 years A isolation Serum crosses 4 subtypes

17 A genetic characterization 3BNC117 VRC01 Known bnabs A V-gene hypermutation: 7.9 and 6.7 % for the heavy and light chains respectively (average chronic babs 21% and 15%) Infant bnabs displayed low levels of somatic mutations (2.0%-6.6%) Simonich, Cassandra A., et al. Cell (2016): A Close to the germ line: low Somatic Hypermutation

18 Conclusions We have isolated a new bnab with a low level of somatic hypermutation, A , from a patient with chronic HIV-1 infection. Isolation of bnabs with low hypermutation is feasible and they could be very interesting for their potential low ability to induce anti-antibody responses

19 Amanda Fabra García Eloísa Yuste Víctor Sánchez-Merino Alberto Merino Acknowledgment Nuria González José Alcamí Clinic Researchers: Josep Mª Gatell Felipe García Cytometry plataform: Cristina Xufré Isabel Crespo Collaborators: Anke Schultz Andreas Meyerhans

Spike Trimer RNA. dsdna

Spike Trimer RNA. dsdna Spike Trimer RNA dsdna Spike Trimer RNA Spike trimer subunits xxx gp120: receptor and coreceptor binding xxxxxxx gp41: membrane anchoring and target cell fusion dsdna Spike Trimer HIV gp120 binds to host

More information

Broadly Neutralizing Antibodies for HIV Eradication

Broadly Neutralizing Antibodies for HIV Eradication DOI 10.1007/s11904-016-0299-7 HIV PATHOGENESIS AND TREATMENT (AL LANDAY, SECTION EDITOR) Broadly Neutralizing Antibodies for HIV Eradication Kathryn E. Stephenson 1,2 & Dan H. Barouch 1,2 # The Author(s)

More information

Antibody gene transfer for HIV immunoprophylaxis

Antibody gene transfer for HIV immunoprophylaxis Antibody gene transfer for HIV immunoprophylaxis Alejandro B Balazs & Anthony P West Jr Antibody gene transfer, which involves the delivery of genes that encode potent, broadly neutralizing antibodies

More information

Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies

Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies Michael Seaman, Ph.D. Center for Virology and Vaccine Research Beth Israel Deaconess Medical Center Harvard Medical School J. Virol.

More information

Maturation and Diversity of the VRC01-Antibody Lineage over 15 Years of Chronic HIV-1 Infection

Maturation and Diversity of the VRC01-Antibody Lineage over 15 Years of Chronic HIV-1 Infection Article Maturation and Diversity of the VRC01-Antibody Lineage over 15 Years of Chronic HIV-1 Infection Graphical Abstract Authors Xueling Wu, Zhenhai Zhang,..., John R. Mascola, Lawrence Shapiro Correspondence

More information

Title: Neutralization resistance of HIV-1 virological synapse-mediated infection is. Running Title: Virological-synapse neutralization resistance

Title: Neutralization resistance of HIV-1 virological synapse-mediated infection is. Running Title: Virological-synapse neutralization resistance JVI Accepts, published online ahead of print on 2 May 2012 J. Virol. doi:10.1128/jvi.00230-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Title: Neutralization resistance

More information

Dissecting the Neutralizing Antibody Specificities of Broadly Neutralizing Sera from Human Immunodeficiency Virus Type 1-Infected Donors

Dissecting the Neutralizing Antibody Specificities of Broadly Neutralizing Sera from Human Immunodeficiency Virus Type 1-Infected Donors JOURNAL OF VIROLOGY, June 2007, p. 6548 6562 Vol. 81, No. 12 0022-538X/07/$08.00 0 doi:10.1128/jvi.02749-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Dissecting the Neutralizing

More information

NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2013 October 25.

NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2013 October 25. NIH Public Access Author Manuscript Published in final edited form as: Nature. 2013 April 25; 496(7446): 469 476. doi:10.1038/nature12053. Co-evolution of a broadly neutralizing HIV-1 antibody and founder

More information

Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys

Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys Dan H. Barouch, M.D., Ph.D. Center for Virology and Vaccine Research Beth Israel Deaconess Medical Center Ragon Institute of MGH, MIT,

More information


DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED Viv Peut Kent Laboratory, University of Melbourne, Australia WHY ENVELOPE? Env subject to both humoral and cellular immune responses Perhaps

More information

Immunization with Single-Cycle SIV Significantly Reduces Viral Loads After an Intravenous Challenge with SIV mac 239

Immunization with Single-Cycle SIV Significantly Reduces Viral Loads After an Intravenous Challenge with SIV mac 239 Immunization with Single-Cycle SIV Significantly Reduces Viral Loads After an Intravenous Challenge with SIV mac 239 Bin Jia 1, Sharon K. Ng 1, M. Quinn DeGottardi 1, Michael Piatak Jr. 2, Eloísa Yuste

More information

Immunization with single-cycle SIV significantly reduces viral loads after an intravenous challenge with SIV(mac)239

Immunization with single-cycle SIV significantly reduces viral loads after an intravenous challenge with SIV(mac)239 University of Massachusetts Medical School escholarship@umms Preventive and Behavioral Medicine Publications and Presentations Preventive and Behavioral Medicine 1-23-2009 Immunization with single-cycle

More information

HIV and Challenges of Vaccine Development

HIV and Challenges of Vaccine Development Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health HIV and Challenges of Vaccine Development Richard A. Koup, MD INTEREST

More information

We are IntechOpen, the first native scientific publisher of Open Access books. International authors and editors. Our authors are among the TOP 1%

We are IntechOpen, the first native scientific publisher of Open Access books. International authors and editors. Our authors are among the TOP 1% We are IntechOpen, the first native scientific publisher of Open Access books 3,350 108,000 1.7 M Open access books available International authors and editors Downloads Our authors are among the 151 Countries

More information

Immunotypes of a Quaternary Site of HIV-1 Vulnerability and Their Recognition by Antibodies

Immunotypes of a Quaternary Site of HIV-1 Vulnerability and Their Recognition by Antibodies JOURNAL OF VIROLOGY, May 2011, p. 4578 4585 Vol. 85, No. 9 0022-538X/11/$12.00 doi:10.1128/jvi.02585-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Immunotypes of a Quaternary

More information

Immunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group

Immunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group report Immunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group John Mascola, C Richter King & Ralph Steinman on behalf of a Working Group convened by the Global HIV

More information

Identification and Characterization of CD4 T cells actively transcribing HIV RNA in Peripheral Blood

Identification and Characterization of CD4 T cells actively transcribing HIV RNA in Peripheral Blood Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Identification and Characterization of CD4 T cells actively transcribing

More information

A Human Antibody to the CD4 Binding Site of gp120 Capable of Highly Potent but Sporadic Cross Clade Neutralization of Primary HIV-1

A Human Antibody to the CD4 Binding Site of gp120 Capable of Highly Potent but Sporadic Cross Clade Neutralization of Primary HIV-1 A Human Antibody to the CD4 Binding Site of gp120 Capable of Highly Potent but Sporadic Cross Clade Neutralization of Primary HIV-1 Johannes S. Gach 1,2 *., Heribert Quendler 1., Tommy Tong 3, Kristin

More information


2005 LANDES BIOSCIENCE. DO NOT DISTRIBUTE. [Human Vaccines 1:2, 45-60; March/April 2005]; 2005 Landes Bioscience Review Role of Neutralizing Antibodies in Protective Immunity Against HIV Indresh K. Srivastava* Jeffrey B. Ulmer Susan W. Barnett

More information

Antibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity

Antibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity Antibodies and T Cell Receptor Genetics 2008 Peter Burrows 4-6529 Generation of Antigen Receptor Diversity Survival requires B and T cell receptor diversity to respond to the diversity of

More information



More information

Glycosylation of the ENV Spike of Primate Immunodeficiency Viruses and Antibody Neutralization

Glycosylation of the ENV Spike of Primate Immunodeficiency Viruses and Antibody Neutralization Current HIV Research, 2004, 2, 243-254 243 Glycosylation of the ENV Spike of Primate Immunodeficiency Viruses and Antibody Neutralization Cheryl A. Pikora *1,2 1 Department of Infectious Diseases, Children

More information

The RV144 vaccine trial in Thailand demonstrated an estimated

The RV144 vaccine trial in Thailand demonstrated an estimated Antigenicity and Immunogenicity of RV144 Vaccine AIDSVAX Clade E Envelope Immunogen Is Enhanced by a gp120 N-Terminal Deletion S. Munir Alam, a Hua-Xin Liao, a Georgia D. Tomaras, a Mattia Bonsignori,

More information

ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3*

ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3* ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3* 1 Department of Microbiology, Li Ka Shing Faculty of Medicine, University

More information

Chapter 14 Part One Biotechnology and Industry: Microbes at Work

Chapter 14 Part One Biotechnology and Industry: Microbes at Work Chapter 14 Part One Biotechnology and Industry: Microbes at Work Objectives: After reading Chapter 14, you should understand How biotechnology has resulted in numerous pharmaceutical products to help lessen

More information

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Cytotoxicity assays Rory D. de Vries, PhD 1 1 Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Anti-influenza immunity Humoral / CD4+ / CD8+ / NK? Function of CTL Elimination of virus-infected cells?

More information


Clinical Education Initiative HIV CONTROLLERS: IMPLICATIONS FOR HIV CURE/REMISSION. Bruce Walker, MD Clinical Education Initiative HIV CONTROLLERS: IMPLICATIONS FOR HIV CURE/REMISSION Bruce Walker, MD 6/23/2017 HIV Controllers: Implications for HIV Cure/Remission [video transcript]

More information

Rabies virus-like particles expressed in HEK293 cells

Rabies virus-like particles expressed in HEK293 cells Engineering Conferences International ECI Digital Archives Vaccine Technology IV Proceedings Spring 5-21-2012 Rabies virus-like particles expressed in HEK293 cells Diego Fontana Cell Culture Laboratory

More information

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation IMMUNOLOGICAL MEMORY CD4 T Follicular Helper Cells Memory CD8 T Cell Differentiation CD4 T Cell Differentiation Bcl-6 T-bet GATA-3 ROR t Foxp3 CD4 T follicular helper (Tfh) cells FUNCTION Provide essential

More information

Antigenic and Immunogenic Study of Membrane-Proximal External Region-Grafted gp120 Antigens by a DNA Prime-Protein Boost Immunization Strategy

Antigenic and Immunogenic Study of Membrane-Proximal External Region-Grafted gp120 Antigens by a DNA Prime-Protein Boost Immunization Strategy JOURNAL OF VIROLOGY, Apr. 2007, p. 4272 4285 Vol. 81, No. 8 0022-538X/07/$08.00 0 doi:10.1128/jvi.02536-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Antigenic and Immunogenic

More information

A global approach to HIV-1 vaccine development

A global approach to HIV-1 vaccine development A global approach to HIV-1 vaccine development The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published Version Accessed

More information

The HIV Prevention Toolbox: More Tools Needed

The HIV Prevention Toolbox: More Tools Needed The HIV Prevention Toolbox: More Tools Needed Z Mike Chirenje MD FRCOG University of Zimbabwe, College of Health Sciences, Dept. of Obstetrics and Gynaecology Avondale, Harare, Zimbabwe

More information

HVTN P5 Vaccine Trials

HVTN P5 Vaccine Trials HVTN P5 Vaccine Trials Erica Andersen-Nissen, PhD Director, Cape Town HVTN Immunology Laboratory Considerations for a Pan-African HIV Vaccine Development Agenda Kigali, Rwanda 16-17 March 2015 HVTN Mission

More information

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The

More information


TOWARDS A UNIVERSAL INFLUENZA VIRUS VACCINE TOWARDS A UNIVERSAL INFLUENZA VIRUS VACCINE Peter Palese Icahn School of Medicine at Mount Sinai New York OPTIONS IX 8-26-16 ISIRV - Options IX for the Control of Influenza Peter Palese, PhD Professor

More information

HVTN Laboratory Program: Immunogenicity and Research Assays

HVTN Laboratory Program: Immunogenicity and Research Assays HVTN Laboratory Program: Immunogenicity and Research Assays Erica Andersen-Nissen, PhD Director, Cape Town HVTN Immunology Laboratory Considerations for a Pan-African HIV Vaccine Development Agenda Kigali,

More information

Slow Human Immunodeficiency Virus (HIV) Infectivity Correlated with Low HIV Coreceptor Levels

Slow Human Immunodeficiency Virus (HIV) Infectivity Correlated with Low HIV Coreceptor Levels CLINICAL AND DIAGNOSTIC LABORATORY IMMUNOLOGY, Sept. 2001, p. 932 936 Vol. 8, No. 5 1071-412X/01/$04.00 0 DOI: 10.1128/CDLI.8.5.932 936.2001 Copyright 2001, American Society for Microbiology. All Rights

More information

HIV Vaccine: Recent Advances, Current Roadblocks, and Future Directions

HIV Vaccine: Recent Advances, Current Roadblocks, and Future Directions Florida International University FIU Digital Commons Department of Health Promotion and Disease Prevention Robert Stempel College of Public Health & Social Work 10-5-2015 HIV Vaccine: Recent Advances,

More information

Antigen-Independent B-Cell Development Bone Marrow

Antigen-Independent B-Cell Development Bone Marrow Antigen-Independent B-Cell Development Bone Marrow 1. DNA rearrangements establish the primary repertoire, creating diversity 2. Allelic exclusion ensures that each clone expresses a single antibody on

More information

7/14/2014. Multiple immune effector mechanisms contribute to protection influenza. What is a correlate of protection?

7/14/2014. Multiple immune effector mechanisms contribute to protection influenza. What is a correlate of protection? What is a correlate of protection? Immunological Assessment of Influenza Vaccines and Correlates of Protection Jacqueline Katz Influenza Division Centers for Disease Control and Prevention Defined immune

More information

An Evolutionary Story about HIV

An Evolutionary Story about HIV An Evolutionary Story about HIV Charles Goodnight University of Vermont Based on Freeman and Herron Evolutionary Analysis The Aids Epidemic HIV has infected 60 million people. 1/3 have died so far Worst

More information

ADRL Advanced Diagnostics Research Laboratory

ADRL Advanced Diagnostics Research Laboratory ADRL Advanced Diagnostics Research Laboratory John DeCoteau, MD FRCP Department of Pathology, Division of Hematopathology University of Saskatchewan Saskatchewan Cancer Agency ADRL Project Objectives New

More information

Eradication of HIV Bonaventura Clotet Hospital Universitàri Germans Trias i Pujol Badalona. Barcelona. Catalonia

Eradication of HIV Bonaventura Clotet Hospital Universitàri Germans Trias i Pujol Badalona. Barcelona. Catalonia Eradication of HIV Bonaventura Clotet Hospital Universitàri Germans Trias i Pujol Badalona. Barcelona. Catalonia Dr Bonaventura Clotet Transparency declaration I have served during the past 2 years as

More information

5. Over the last ten years, the proportion of HIV-infected persons who are women has: a. Increased b. Decreased c. Remained about the same 1

5. Over the last ten years, the proportion of HIV-infected persons who are women has: a. Increased b. Decreased c. Remained about the same 1 Epidemiology 227 April 24, 2009 MID-TERM EXAMINATION Select the best answer for the multiple choice questions. There are 60 questions and 9 pages on the examination. Each question will count one point.

More information

Massive infection and loss of memory CD4 + T cells in multiple tissues during acute SIV infection

Massive infection and loss of memory CD4 + T cells in multiple tissues during acute SIV infection Massive infection and loss of memory CD4 + T cells in multiple tissues during acute SIV infection Joseph J. Mattapallil 1, Daniel C. Douek 2, Brenna Hill 2, Yoshiaki Nishimura 3, Malcolm Martin 3 & Mario

More information

This is the authors final peered reviewed (post print) version of the item published as: Available from Deakin Research Online:

This is the authors final peered reviewed (post print) version of the item published as: Available from Deakin Research Online: This is the authors final peered reviewed (post print) version of the item published as: Yang, Hongbing, Yorke, Elizabeth, Hancock, Gemma, Clutton, Genevieve, Sande, Nellia, Angus, Bryan, Smyth, Redmond,

More information

What are ADCC antibodies? Work on influenza ADCC antibodies Greenberg et al, Hashimoto et al. First describes Fluspecific

What are ADCC antibodies? Work on influenza ADCC antibodies Greenberg et al, Hashimoto et al. First describes Fluspecific 14/7/214 Acknowledgement antibodies against diverse influenza strains: Implications for universal vaccination Sinth Jegaskanda PhD Prof Stephen Kent University of Melbourne What are antibodies? Work on

More information

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD) Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

More information

La risposta immune all infezione da virus ebola. Chiara Agrati, PhD

La risposta immune all infezione da virus ebola. Chiara Agrati, PhD La risposta immune all infezione da virus ebola Chiara Agrati, PhD Pathogenetic mechanisms This virus infection is able to: - disable the immune system, preventing an effective protective immune response

More information

HIV life cycle revisited: What s new in basic science? Theresa Rossouw

HIV life cycle revisited: What s new in basic science? Theresa Rossouw HIV life cycle revisited: What s new in basic science? Theresa Rossouw Outline of the Presentation Lifecycle overview New drugs & therapies Cell entry Co-receptor binding Attachment Keeping it Simple

More information

Cent Gardes Conference: HIV Vaccines. Organized by Fondation Mérieux Les Pensières Center for Global Health Veyrier du Lac - France

Cent Gardes Conference: HIV Vaccines. Organized by Fondation Mérieux Les Pensières Center for Global Health Veyrier du Lac - France Cent Gardes Conference: HIV Vaccines Organized by Fondation Mérieux Les Pensières Center for Global Health Veyrier du Lac - October 6th to 8th, 2017 Steering Committee Members Françoise Barré-Sinoussi

More information

of Nebraska - Lincoln

of Nebraska - Lincoln University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Virology Papers Virology, Nebraska Center for 2007 Characterization of Human Immunodeficiency Virus Type 1 Monomeric and

More information

Induction of Immunity to Human Immunodeficiency Virus Type-1 by Vaccination

Induction of Immunity to Human Immunodeficiency Virus Type-1 by Vaccination Induction of Immunity to Human Immunodeficiency Virus Type-1 by Vaccination M. Juliana McElrath 1, * and Barton F. Haynes 2, * 1 Vaccine and Infectious Disease Division, Fred Hutchinson Cancer Research

More information

Boosts Following Priming with gp120 DNA

Boosts Following Priming with gp120 DNA Neutralizing Antibody Responses Induced with V3-scaffold Protein Boosts Following Priming with gp120 DNA Susan Zolla-Pazner NYU School of Medicine Problems with Whole Env Immunogens Poor induction of Abs

More information

Laboratory Diagnosis of Viral Infections. G. Jamjoom 2005

Laboratory Diagnosis of Viral Infections. G. Jamjoom 2005 Laboratory Diagnosis of Viral Infections G. Jamjoom 2005 Five Main Techniques: Virus Culture and Isolation Serology Rapid Detection of Viral Antigens Detection of Viral Nucleic Acid Electron Microscopy

More information

The History of HIV Vaccine Development

The History of HIV Vaccine Development The History of HIV Vaccine Development a short story on 30 years of research å Dr. Jill Gilmour International AIDS Vaccine Initiative Barcelona, 6 October 2013 IAVI is a product-development partnership

More information

Directed Evolution of Peptide Inhibitors of HIV-1 Entry

Directed Evolution of Peptide Inhibitors of HIV-1 Entry Directed Evolution of Peptide Inhibitors of HIV-1 Entry The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Accessed Citable

More information

Innate and humoral immune responses to HIV-1. Kathryn Ann Kastor Finton. A dissertation. submitted in partial fulfillment of the

Innate and humoral immune responses to HIV-1. Kathryn Ann Kastor Finton. A dissertation. submitted in partial fulfillment of the Innate and humoral immune responses to HIV-1 Kathryn Ann Kastor Finton A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington

More information

The inherent resistance of human immunodeficiency virus type

The inherent resistance of human immunodeficiency virus type A Novel Assay for Antibody-Dependent Cell-Mediated Cytotoxicity against HIV-1- or SIV-Infected Cells Reveals Incomplete Overlap with Antibodies Measured by Neutralization and Binding Assays Michael D.

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Objective 3. Develop new and improved diagnostic tools, vaccines, and novel management approaches

Objective 3. Develop new and improved diagnostic tools, vaccines, and novel management approaches Objective 3. Develop new and improved diagnostic tools, vaccines, and novel management approaches Development of novel nanoparticle-base vaccines for infectious bronchitis PI, Mazhar I. Khan; CoPI, Peter

More information

Immunity and Infection. Chapter 17

Immunity and Infection. Chapter 17 Immunity and Infection Chapter 17 The Chain of Infection Transmitted through a chain of infection (six links) Pathogen: Disease causing microorganism Reservoir: Natural environment of the pathogen Portal

More information

Magnitude and Breadth of a Nonprotective Neutralizing Antibody Response in an Efficacy Trial of a Candidate HIV-1 gp120 Vaccine

Magnitude and Breadth of a Nonprotective Neutralizing Antibody Response in an Efficacy Trial of a Candidate HIV-1 gp120 Vaccine MAJOR ARTICLE Magnitude and Breadth of a Nonprotective Neutralizing Antibody Response in an Efficacy Trial of a Candidate HIV-1 gp120 Vaccine Peter Gilbert, 1 Maggie Wang, 1 Terri Wrin, 2 Chris Petropoulos,

More information

Comprehensive Mapping of HIV-1 Escape from a Broadly Neutralizing Antibody

Comprehensive Mapping of HIV-1 Escape from a Broadly Neutralizing Antibody Resource Comprehensive Mapping of HIV-1 Escape from a Broadly Neutralizing Antibody Graphical Abstract Authors Adam S. Dingens, Hugh K. Haddox, Julie Overbaugh, Jesse D. Bloom Correspondence

More information

The ineffectiveness of human immunodeficiency virus (HIV)

The ineffectiveness of human immunodeficiency virus (HIV) Neutralizing Capacity of Monoclonal Antibodies That Recognize Peptide Sequences Underlying the Carbohydrates on gp41 of Simian Immunodeficiency Virus José M. Martinez-Navio and Ronald C. Desrosiers Department

More information

The humoral immune responses to IBV proteins.

The humoral immune responses to IBV proteins. The humoral immune responses to IBV proteins. E. Dan Heller and Rosa Meir The Hebrew University of Jerusalem, Israel COST FA1207 meeting WG2 + WG3, Budapest, Jan. 2015 1 IBV encodes four major structural

More information

Heterologous Tier 1 R5 SHIV-C Challenges: Correlates of Protection

Heterologous Tier 1 R5 SHIV-C Challenges: Correlates of Protection Heterologous Tier 1 R5 SHIV-C Challenges: Correlates of Protection Enterprise Meeting: The Appropriate Use of Tiered Virus Panels when Assessing HIV-1 Vaccine-elicited Neutralizing Antibodies" July 7 th,

More information

HIV Vaccine Conference

HIV Vaccine Conference HIV Vaccine Conference The B cell response to HIV and HIV vaccines: From broadly neutralizing to non-neutralizing antibodies In memory of Dr. Charles Mérieux Organized by Fondation Mérieux Les Pensières

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

Received 24 October 2004/Accepted 11 January 2005

Received 24 October 2004/Accepted 11 January 2005 JOURNAL OF VIROLOGY, June 2005, p. 6957 6968 Vol. 79, No. 11 0022-538X/05/$08.00 0 doi:10.1128/jvi.79.11.6957 6968.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. Cryptic Nature

More information

Received 21 January 2000/Accepted 2 May 2000

Received 21 January 2000/Accepted 2 May 2000 JOURNAL OF VIROLOGY, Aug. 2000, p. 6893 6910 Vol. 74, No. 15 0022-538X/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Use of Inhibitors To Evaluate Coreceptor Usage

More information

Passive immunization of macaques with polyclonal anti-shiv IgG against a heterologous tier 2 SHIV: outcome depends on IgG dose

Passive immunization of macaques with polyclonal anti-shiv IgG against a heterologous tier 2 SHIV: outcome depends on IgG dose Passive immunization of macaques with polyclonal anti-shiv IgG against a heterologous tier SHIV: outcome depends on IgG dose Anton M Sholukh, Texas Biomedical Research Institute Siddappa N. Byrareddy,

More information

Vif Proteins of Human and Simian Immunodeficiency Viruses Require Cellular CBFβ to Degrade APOBEC3 Restriction Factors

Vif Proteins of Human and Simian Immunodeficiency Viruses Require Cellular CBFβ to Degrade APOBEC3 Restriction Factors JVI Accepts, published online ahead of print on 28 December 2011 J. Virol. doi:10.1128/jvi.06950-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13

More information

T cell Vaccine Strategies for HIV, the Virus. With a Thousand Faces

T cell Vaccine Strategies for HIV, the Virus. With a Thousand Faces JVI Accepts, published online ahead of print on 13 May 2009 J. Virol. doi:10.1128/jvi.00114-09 Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG

More information

The Discovery of SIV and Development of Monkey Models for the Study of HIV/AIDS. Ronald C Desrosiers University of Miami Miller School of Medicine

The Discovery of SIV and Development of Monkey Models for the Study of HIV/AIDS. Ronald C Desrosiers University of Miami Miller School of Medicine The Discovery of SIV and Development of Monkey Models for the Study of HIV/AIDS Ronald C Desrosiers University of Miami Miller School of Medicine 10 FEBRUARY 1984 Infectious Diseases Branch, National

More information



More information

Department of Animal and Poultry Sciences October 16, Avian Leukosis Virus Subgroup J. Héctor L. Santiago ABSTRACT

Department of Animal and Poultry Sciences October 16, Avian Leukosis Virus Subgroup J. Héctor L. Santiago ABSTRACT Department of Animal and Poultry Sciences October 16, 2000 Avian Leukosis Virus Subgroup J Héctor L. Santiago ABSTRACT The avian leukosis viruses (ALV) are a class of retroviruses belonging to the avian

More information

DNA Vaccines against Human Immunodeficiency Virus Type 1 in the Past Decade

DNA Vaccines against Human Immunodeficiency Virus Type 1 in the Past Decade CLINICAL MICROBIOLOGY REVIEWS, Apr. 2004, p. 370 389 Vol. 17, No. 2 0893-8512/04/$08.00 0 DOI: 10.1128/CMR.17.2.370 389.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. DNA

More information

Reviewing the Clinical Development of Zika and Chikungunya Vaccines

Reviewing the Clinical Development of Zika and Chikungunya Vaccines Reviewing the Clinical Development of Zika and Chikungunya Vaccines Stephen J. Thomas, MD Division of Infectious Diseases State University of New York Upstate Medical University October 2017 Discussion

More information

Enhanced clearance of HIV-1-infected cells by broadly neutralizing antibodies against HIV-1 in vivo

Enhanced clearance of HIV-1-infected cells by broadly neutralizing antibodies against HIV-1 in vivo Enhanced clearance of HIV-1-infected cells by broadly neutralizing antibodies against HIV-1 in vivo The MIT Faculty has made this article openly available. Please share how this access benefits you. Your

More information

Tumor responses (patients responding/ patients treated)

Tumor responses (patients responding/ patients treated) Table 1. ACT clinical trial tumor responses and toxicities. a Target antigen Cancer(s) Receptor type Tumor responses (patients responding/ patients treated) Immune-mediated toxicities (patients experiencing

More information

A novel gene therapy strategy using secreted multifunctional anti-hiv proteins to confer protection to gene-modified and unmodified target cells

A novel gene therapy strategy using secreted multifunctional anti-hiv proteins to confer protection to gene-modified and unmodified target cells 1 Gene Therapy (2013) in press. A novel gene therapy strategy using secreted multifunctional anti-hiv proteins to confer protection to gene-modified and unmodified target cells A Falkenhagen, 1 M Ameli,

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

Distinct Mechanisms of Entry by Envelope Glycoproteins of Marburg and Ebola (Zaire) Viruses

Distinct Mechanisms of Entry by Envelope Glycoproteins of Marburg and Ebola (Zaire) Viruses JOURNAL OF VIROLOGY, May 2000, p. 4933 4937 Vol. 74, No. 10 0022-538X/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Distinct Mechanisms of Entry by Envelope Glycoproteins

More information

Chapter 23 Immunity Exam Study Questions

Chapter 23 Immunity Exam Study Questions Chapter 23 Immunity Exam Study Questions 1. Define 1) Immunity 2) Neutrophils 3) Macrophage 4) Epitopes 5) Interferon 6) Complement system 7) Histamine 8) Mast cells 9) Antigen 10) Antigens receptors 11)

More information

on April 26, 2018 by guest

on April 26, 2018 by guest JVI Accepted Manuscript Posted Online 20 July 2016 J. Virol. doi:10.1128/jvi.00853-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 Induction of heterologous

More information

Table S1. X-ray data collection and refinement statistics

Table S1. X-ray data collection and refinement statistics Table S1. X-ray data collection and refinement statistics Data collection H7.167 Fab-Sh2/H7 complex Beamline SSRL 12-2 Wavelength (Å) 0.97950 Space group I2 1 3 Unit cell parameters (Å, º) a = b = c=207.3,

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Factors Associated with the Development of Cross-Reactive Neutralizing Antibodies during Human Immunodeficiency Virus Type 1 Infection

Factors Associated with the Development of Cross-Reactive Neutralizing Antibodies during Human Immunodeficiency Virus Type 1 Infection JOURNAL OF VIROLOGY, Jan. 2009, p. 757 769 Vol. 83, No. 2 0022-538X/09/$08.00 0 doi:10.1128/jvi.02036-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. Factors Associated with

More information


HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES. Elizabeth Susan Russell HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES Elizabeth Susan Russell A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial

More information

Received 14 April 2010/Accepted 2 August 2010

Received 14 April 2010/Accepted 2 August 2010 JOURNAL OF VIROLOGY, Nov. 2010, p. 11200 11209 Vol. 84, No. 21 0022-538X/10/$12.00 doi:10.1128/jvi.00790-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. Mutation at a Single

More information


ACQUIRED IMMUNE DEFICIENCY SYNDROME ACQUIRED IMMUNE DEFICIENCY SYNDROME DEFINITION. The definition of this illness kept changing as we learned more about its course and causes. Originally it was Any occurrence of an opportunistic infection

More information

NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2009 July 1.

NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2009 July 1. NIH Public Access Author Manuscript Published in final edited form as: Nature. 2009 January 1; 457(7225): 87 91. doi:10.1038/nature07469. Immune Control of an SIV Challenge by a T Cell-Based Vaccine in

More information

Vaccine nanoparticles for protection against HIV infection

Vaccine nanoparticles for protection against HIV infection Special Report For reprint orders, please contact: Vaccine nanoparticles for protection against HIV infection The development of a successful vaccine against HIV is a major

More information

Structure of HIV. Virion contains a membrane envelope with a single viral protein= Env protein. Capsid made up of Gag protein

Structure of HIV. Virion contains a membrane envelope with a single viral protein= Env protein. Capsid made up of Gag protein Structure of HIV Virion contains a membrane envelope with a single viral protein= Env protein Important in receptor recognition Capsid made up of Gag protein (group-specific antigen) Icosahedral Interior

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response Ivana FELLNEROVÁ E-mail:, mob. 732154801 Basic immunogenetic terminology innate and adaptive immunity specificity and polymorphism immunoglobuline gene superfamily immunogenetics MHC

More information

Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System Multiple-Choice Questions

Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System Multiple-Choice Questions Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System 24.1 Multiple-Choice Questions 1) The body's innate defenses against infection include A) several nonspecific

More information

Pre-made Lentiviral Particles for Fluorescent Proteins

Pre-made Lentiviral Particles for Fluorescent Proteins Pre-made Lentiviral Particles for Fluorescent Proteins Catalog# Product Name Amounts Fluorescent proteins expressed under sucmv promoter: LVP001 LVP001-PBS LVP002 LVP002-PBS LVP011 LVP011-PBS LVP012 LVP012-PBS

More information