Serodiagnosis of Canine Babesiosis

Transcription

1 Serodiagnosis of Canine Babesiosis Xuenan XUAN, DVM, PhD National Research Center for Protozoan Diseases Obihiro University of Agriculture and Veterinary Medicine Obihiro, Hokkaido , Japan Tel.: ; Fax:

2 Babesia spp infections in dogs Introduction Taxonomic classification Morphology Life cycle Pathogenesis Clinical signs Host defenses Epidemiology Diagnosis Treatment Prevention

3 Introduction Canine babesiosis is tick-bone disease caused by two intraerythrocytic protozoan parasites, Babesia canis and Babesia gibsoni.

4 Morphology B.canis usually appears as paired pyri form organisms in canine red blood cells. B.gibsoni usually appears as single ring form organisms in canine red blood cells.

5 Taxonomic classification Phylum: Apicomplexa Class: Sporozoasida Order: Piroplasmida Family: Babesiidae Genus: Babesia

6 Life cycle Following attachment of an infected tick, Babesia spp. trophozoites are released into the blood, infecting erythrocytes. Within the erythrocytes, the parasite multiplies by binary fission, an asexual form of schizogony. Naïve ticks attach to the dog and become infected with Babesia ssp. when they ingest a blood meal.

7 Pathogenesis The transmission of parasites takes place after 2-3 days of attachment of the tick, at which time infective sporozoites migrate from the tick s salivary glands into the host s circulation. Babesia organisms are obligate intracellular parasites that invade, divide within, and rupture erythrocytes. An important pathogenic mechanism therefore is direct parasite-induced red cell damage resulting in an intravascular haemolysis, but the severity of this is usually not proportional to the low parasitemia that is typically observed. It is now recognised that other significant mechanisms are involved, including immun-mediated lysis and oxidative injury of the red cell membrane.

8 Clinical signs Acute infection: anemia with icterus, inappetence, thirst, pyrexia (>39 ). Chronic infection: irregular temperature, capricious appetite, and loss of conditions.

9 Host defenses Humoral responses Cell-mediated responses Nonspecific responses

10 Epidemiology B. canis canis: Europe, Asia B. canis rossi: South Africa B. canis vogeli: USA, tropical and subtropical areas B. gibsoni Asian type: Asia B. gibsoni Spanish type: Europe B. gibsoni California type: USA

11 Diagnosis Microscopic examination Serodiagnosis Molecular diagnosis

12 Microscopic examination

13 Enzyme-linked immunosorbent assay (ELISA)

14 Immunofluorescent-antibody test (IFAT)

15 1 2 3 Absorbent pad Control line Test line Conjugate pad Sample pad + Examples of the ICT strips pre- (1) and post- (2 and 3) tests. +, the positive result; -, the negative result. Immunochromatographic test (ICT)

16 M Polymerase chain reaction (PCR)

17 Loop-mediated isothermal amplification (LAMP)

18 Treatment Chemotherapy against canine babesiosis at the early phase of infection is very important to reduce the severity of disease and mortality, although it cannot completely eliminate the parasites. Diminazene acceturate, phenamicine isethionate, and pentamicine isethionate have been demonstrated to be effective against canine babesiosis. Supportive therapy, such as intravenous fluids and transfusions, is recommended for canine babesiosis, particularly for dogs with severe anemia.

19 Prevention For the control of canine babesiosis, vaccination is generally considered to be the most effective means. It is known that the inactivated whole parasite antigen or soluble parasite antigen that is derived from a supernatant of an in vitro culture of Babesia parasites is useful antigen for vaccination and induces partial protection against canine babesiosis. On the other hand, tick control is considered the most important means for prevention of canine babesiosis, since treatment is not always successful.

20 Cloning of a novel gene encoding a major surface antigen P50 of Babesia gibsoni and development of serodiagnostic methods using recombinant P50

21 Gene hunting Babesia-infected RBC mrna cdna library Immunoscreening Novel genes (P50) Vaccine development DNA vaccine Vector vaccine Subunit vaccine Diagnostic methods ELISA ICT PCR

22 Atgaatgtcgttcgttcattcctgtttttcccaatcgccttctccctggtaagggcaaatggtgaggggaagacggcagaggccacccctgcaggaacatcgaca MetAsnValValArgSerPheLeuPhePheProIleAlaPheSerLeuValArgAlaAsnGlyGluGlyLysThrAlaGluAlaThrProAlaGlyThrSerThr Cccactgaacctaaggcagctgaggctgctcccaaagcagtagacgcagctgctgttacctttaaacagtatctggactttgcaatgaagttaaacgaggccgtg ProThrGluProLysAlaAlaGluAlaAlaProLysAlaValAspAlaAlaAlaValThrPheLysGlnTyrLeuAspPheAlaMetLysLeuAsnGluAlaVal Acactccgtgaggaagacactaggaaaaagcttttggttaacttccctcttttcggagctcccccgttcgatggtgcatggggggatttgaaagacttattgaag ThrLeuArgGluGluAspThrArgLysLysLeuLeuValAsnPheProLeuPheGlyAlaProProPheAspGlyAlaTrpGlyAspLeuLysAspLeuLeuLys Aaagttactgagcttcgggcacttctacttaagggtcacacattcggtttaccagcggcaaccacaacagacaaacagcaacaggatgctaaccaaactgtcggt LysValThrGluLeuArgAlaLeuLeuLeuLysGlyHisThrPheGlyLeuProAlaAlaThrThrThrAspLysGlnGlnGlnAspAlaAsnGlnThrValGly Gctttatttgatttcattgtcggagtagcaactgatgcagtcaccgttgctgataaggctactagggctgttactggaatggaccccgataaagccgtgggattc AlaLeuPheAspPheIleValGlyValAlaThrAspAlaValThrValAlaAspLysAlaThrArgAlaValThrGlyMetAspProAspLysAlaValGlyPhe Cacgtcacaccagcaacggctgatgccctatttgagtttgttccagatctctatgaaaagttgaaggatttgcatagtaaggttggagagtgggttgaaattaag HisValThrProAlaThrAlaAspAlaLeuPheGluPheValProAspLeuTyrGluLysLeuLysAspLeuHisSerLysValGlyGluTrpValGluIleLys Tccacctttgatgacacgaaattggtaacccaagctggtgatcacaggccgaaacactggttaaggcagggtgggtttactgaccaggaggttaaaggtgatacc SerThrPheAspAspThrLysLeuValThrGlnAlaGlyAspHisArgProLysHisTrpLeuArgGlnGlyGlyPheThrAspGlnGluValLysGlyAspThr Accttggaaactttgaaaactaaactgggtgagctcgttggtcctactaagccttgtgagaaggttttgtgtacccttgcttcatatgcgcttatgaagacccct ThrLeuGluThrLeuLysThrLysLeuGlyGluLeuValGlyProThrLysProCysGluLysValLeuCysThrLeuAlaSerTyrAlaLeuMetLysThrPro Caagatgcagctggcaagcaggcatggatctttttattggcaagtgcaatgaataacaatgctatgaaagctaagcttgaggtagcagtaaacgcggttactccc GlnAspAlaAlaGlyLysGlnAlaTrpIlePheLeuLeuAlaSerAlaMetAsnAsnAsnAlaMetLysAlaLysLeuGluValAlaValAsnAlaValThrPro Ggtaagggagaaacctttgtcaaccaactaaaggaggttggcaaatcactccagcttcccaaggaacaagttcctaagcaatatcgtttccctggtgtctatgca GlyLysGlyGluThrPheValAsnGlnLeuLysGluValGlyLysSerLeuGlnLeuProLysGluGlnValProLysGlnTyrArgPheProGlyValTyrAla Aacctcgatgtgcaacacttttggactgtgttaaccggcgtctttggcactatactgactgaccttgaggttgacgaaaaggatgctcagggtaaagcaggacag AsnLeuAspValGlnHisPheTrpThrValLeuThrGlyValPheGlyThrIleLeuThrAspLeuGluValAspGluLysAspAlaGlnGlyLysAlaGlyGln Gttgctactagagttgcggagcttgtcaaggtggaaggtccacttcacagcctcactgtgcaagtagctgagatgactaaggctggagcgggtgctggtggtgaa ValAlaThrArgValAlaGluLeuValLysValGluGlyProLeuHisSerLeuThrValGlnValAlaGluMetThrLysAlaGlyAlaGlyAlaGlyGlyGlu Gctcctgctcaggcagctgctgggacagcaggagcacgtgcagaagctccagccaaggaaggccaaggtgaggatggtgcgcacttttgtggcatcggaatgaca AlaProAlaGlnAlaAlaAlaGlyThrAlaGlyAlaArgAlaGluAlaProAlaLysGluGlyGlnGlyGluAspGlyAlaHisPheCysGlyIleGlyMetThr gttttctttgtttctgtggttatcgctgtcttttaa 1401 ValPhePheValSerValValIleAlaValPhe*** 466 Nucleotide and amino acid sequences of P50 gene

23 Hydrophilicity Amino acid number P50f P50t nt aa nt aa Truncated P50 gene without SP and TM

24 kda M , rp50f-soluble 2, rp50f-insoluble 3, rp50t-soluble 4, rp50t-insoluble 20 Expression of rp50 in E. coli

25 kda M Purification of rp50 expressed in E. coli

26 (A) (B) ( C ) GST-P50t GST Antigenicity of rp50 expressed in E. coli

27 A kda 94 B. gibsoni nrbc B Anti-P50 DIC P50 30 Western blotting IFAT Identification of native P50 on parasites

28 The principle of ELISA:(1) Coat antigen; (2) Wash uncoated antigen; (3) Add serum samples; (4) Wash nonbound antibodies; (5) Add HRP-condugated anti-dog IgG antibody; (6) Wash un-bound 2nd antibody; (7) Add substrate (ABTS); (8) Positive result appears as blue color.

29 Procedure of ELISA with rp50 Materials GST-NcSAG1 (purified ) GST(purified ) Antigen coating buffer (50 mm carbonate-bicarbonate ph9.6) Antibody diluting buffer (PBS containing 3% skim milk) Substrate buffer (0.1 M citric-0.2 M sodium phosphate, ph4.0) Washing buffer (PBS containing 0.05% Tween 20) ABTS(2,2 -azino-bis(3-ethylbenz-thiazoline-6-sulfonic acid)) H 2 O 2 (30%) Substrate solution (substrate buffer containing 0.05% ABTS and 0.003% H 2 O 2 ) HRP-conjugated goat anti-dog IgG(ICN Biochemicals USA) ELISA plate(nunc, Denmark ) Add subatrate solution (100µl/well) RT, dark place, 1 h Read the absorbance at 415 nm Judge 4) 1) Add the diluted GST-rP50 (2 µg/ml) to lanes 2, 4, 6, 8, and 10; add the diluted control GST (2 µg/ml) to lanes 3, 5, 7, 9, and 11. Methods Coat antigens (50µl/well) 1) 4, overnight Wash once Add antibody diluting buffer (100µl/well ) 37, 1 h Wash once Add canine sera (1:100, 50µl/well) 2) 37, 1 h Wash six times Add HRP-conjugated goat anti-dog IgG (1:4000, 50µl/well) 3) 37, 1 h Wash six times 2) Add each sample to duplicate wells. Samples Positive control Negative control Blank 3) To check the optimal secondary antibody titers in advance. 4) The result is judged as positive when the OD value (substrate the average of 2 wells with GST from the average of 2 wells with GST-rP50) equal to or greater than 0.1.

30 1E Antibody titer 1E+05 1E+04 1E+03 1E+02 1E+01 ELISA titer Parasitemia Parasitemia (%) 1E Days-post infection Detection of antibody to P50 in a dog experimentally infected with B. gibsoni by the ELISA

31 OD 415 nm B. gibsoni-infected dog sera (n=22) 2. SPF dog sera (n=30) 3. B. canis canis-infected dog sera (n=2) 4. B. canis canis-infected dog sera (n=2) 5. B. canis vogeli-infected dog sera (n=2) 6. B. canis rossi-infected dog sera (n=2) 7. L. infantum-infected dog sera (n=2) Sensitivity and specificity of the ELISA

32

33 Immunochromatographic test (ICT) Easy performance Quick results (~15 min) Sensitive and specific as ELISA Colloidal gold particle-conjugated antigen Colloidal gold particle Antigen Conjugate pad Test line Nitrocellulose m embrane Absorbent pad The composition of ICT

34 Principle of ICT for B. gibsoni infection 1 Antibodies in serum rp50 conjugated with gold colloids rp50 Rabbit antirp50 IgG ) Pre-test 2) Positive serum 3) Negative serum

35 Absorbent pad Control line Test line Sample pad Conjugate pad The sensitivity and specificity of the ICT

36 3 10 Absorbance OD 415nm ELISA Parasitemia Parasitemia (%) Days post infection Days post infection Detection of antibodies to B. gibsoni in an experimentally infected dog by ELISA and ICT

37

38 6 ( n = 6, * P < 0.05 ) P50 Parasitemia (%) * * * * * * * NRS β-gal Days-post challenge Anti-rP50 antibodies significantly inhibited the growth of B. gibsoni in SCID mouse model

39 Immunization Challenge ( 2 x 10 8 parasites ) Absorbance ( OD at 415nm ) * * * * * * * ( n = 3, * P < 0.05 ) rp50t β-gal Con Days-post challenge Recombinant P50 could induce strong humoral immunity in dogs

40 12 ( n = 3, * P < 0.05 ) rp50t Parasitemia (%) * * β-gal Con Days-post challenge Recombinant P50 could induce protective immunity in dogs

41 Conclusions A gene encoding major surface protein P50 of B. gibsoni was cloned. P50 was identified as an immunodominant antigen in both acute and chronic B. gibsoni infections in dogs. Recombinant P50 expressed in E. coli is a promising diagnostic antigen for detection of specific antibodies to B. gibsoni in dogs. Recombinant P50 is a promising vaccine candidate to control B. gibsoni infection in dogs.

42 Publications about P50 of B. gibsoni 1. Fukumoto et al., J. Clin. Microbiol. 39: , Fukumoto et al., Clin. Diagn. Lab. Immunol. 10: , Fukumoto et al., Infect. Immun. 72: , Fukumoto et al., J. Parasitol. 90: , Verdida et al., J. Vet. Med. Sci. 66: , Verdida et al., Parasitology 131: Fukumoto et al., Clin. Diagn. Lab. Immunol. 12: , Fukumoto et al., Vaccine (in press)

43 Other ELISAs B. equi ELISA-BeEMA2 B. caballi ELISA-BcP48 B. bovis ELISA-BboRAP1 B. bigemina ELISA-BbiRAP1 T. gondii ELISA-TgSAG2 N. caninum ELISA-NcSAG1 C. parvum ELISA-CpP23

44 Other ICTs B. equi ICT-BeEMA2 B. caballi ICT-BcP48 B. bovis ICT-BboRAP1 B. bigemina ICT-BbiRAP1 T. gondii ICT-TgSAG2 N. caninum ICT-NcSAG1

45