Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-"

Transcription

1 Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen c CD11b+/Gr1+ cells [%] 1 5 b T cells [%] controls Pten pc-/- n=4 n=3 n=3 n=3 n=4 n=4 n=3 n=3 n=3 n=5 n=4 n=3 n=3 n=3 n=4 n=4 n=3 n=3 n=3 n=2 controls T cells 3 months Tumor Pten pc-/- ** * *** * pc-/- n=6 n=3 n=4 n=5 n=4 T cells [%] controls B cells [%] Pten pc-/- controls B cells [%] B cells 3 months Tumor Pten pc-/- n=6 n=3 n=4 n=5 n= controls Pten pc-/- Macrophages [%] controls Pten pc-/- SSC FSC FSC Gr-1 Macrophages [%] Macrophages 3 months Tumor controls Pten pc-/- n=4 n=3 n=5 n=5 n=4 FSC DAPI CD45.2 CD11b d CD11b CD11b CD11b 1 Nature Medicine: doi:1.138/nm.4463

2 Supplementary Figure 1. Infiltration of the immune cells in spleen and the prostate tissue of respective mouse models at 3 months of age. (a) Percentage of Gr- 1+/CD11b+ cells, T cells (CD3+), B cells (CD19+/B22+) and macrophages (CD11b+/F4/8+) in spleen of control mice and respective prostate tumor models at 3 months of age. (b) Percentage of T cells (CD3+), B cells (CD19+/B22+) and macrophages (CD11b+/F4/8+) in the tumor of control mice and respective prostate tumor models at 3 months of age. The number of mice analyzed for (a) and (b) is indicated in the figure. All data in (a) and (b) are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by twotailed unpaired Student s t-test. (c) Gating strategy used for our immune landscape analysis. (d) Gating strategy for Gr-1+/CD11b+ cells. Representative flow cytometry blots of Gr-1+/CD11b+ cells in the prostate, and mice at 3 months of age. 2 Nature Medicine: doi:1.138/nm.4463

3 F4/8 CD4 FoxP3 CD44 Bezzi et al., Supplementary Figure 2 a Gr1-CD11b 6 months Spleen T cells 6 months Spleen B cells 6 months Spleen Macrophages 6 months Spleen CD11b+/Gr1+ cells [%] T cells [%] B cells [%] Macrophages [%] n=3 n=3 n=3 n=3 n=3 n=3 n=3 n=3 n=3 n=3 n=3 n=3 b CD11b+/Gr1+ cells [%] Gr1-CD11b 6 months Tumor T-cells 6 months Tumor ** p =.22 * p =.488 * p = * p =.228 T cells [%] B cells [%] B-cells 6 months Tumor Macrophages [%] Macrophages 6 months Tumor * p =.434 * p = n=4 n=5 n=3 n=4 n=5 n=3 n=4 n=3 n=3 n=4 n=4 n=3 c d e f DAPI negative, CD11b+ cells DAPI negative, CD3+ cells DAPI negative, CD45+ cells DAPI negative, CD8+ cells CD26 CD8 CD4 CD62L CD26+ of F4/8 cells (%) Ptenpc-/-; Trp53pc-/- % of CD3 + cells CD4+ CD3 cells CD8+ CD3 cells 3 FoxP3+ of CD45+ CD4+ cells (%) Ptenpc-/-; Trp53pc-/- CD44+ CD62L - of CD8+ cells (%) Ptenpc-/-; Trp53pc-/- Nature Medicine: doi:1.138/nm.4463

4 Supplementary Figure 2. Infiltration of the immune cells in spleen and the prostate tissue of respective mouse models at 6 months of age. (a) Percentage of Gr- 1+/CD11b+ cells, T cells (CD3+), B cells (CD19+/B22+) and macrophages (CD11b+/F4/8+) in spleen of prostate tumor models at 6 months of age. (b) Percentage of Gr-1+/CD11b+ cells, T cells (CD3+), B cells (CD19+/B22+) and macrophages (CD11b+/F4/8+) in the tumor of prostate cancer models at 6 months of age. The number of mice analyzed for (a) and (b) is indicated in the figure. (c,d,e,f) Representative flow cytometry blots (upper panel) and quantification of the indicated cell populations (lower panel) isolated from the prostate tumor of 6 months old Pten pc-/- ; mice (n=3). All data are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by two-tailed unpaired Student s t-test. Nature Medicine: doi:1.138/nm

5 Bezzi et al., Supplementary Figure 3 Ptenpc-/-;Zbtb7apc-/- Ptenpc-/-;Trp53pc-/- Ptenpc-/-;Zbtb7apc-/- Ptenpc-/-;Trp53pc-/- IHC:Ly6G a IHC: CD3 IHC: CD45R (B22) b 5 Nature Medicine: doi:1.138/nm.4463

6 Supplementary Figure 3. Localization of immune cells in prostate tumor tissues. (a) IHC of the Ly6G epitope in and prostate tumors (anterior prostate lobes, at 3 month of age) shows that Ly6G+ cells are mainly localized in the lumen of prostate glands and are in close proximity to cancer cells (black arrows). Scale bars,.5 mm. (b) IHC of the CD45R (B22) and CD3 epitope in Pten pc-/- ; and prostate tumors at 3 months of age (anterior prostate lobes) shows that B cells and T cells are mainly localized in the stroma of prostate tumor tissue. Scale bars,.5 mm. Similar stainings have been observed in two mice for each genotype. Nature Medicine: doi:1.138/nm

7 Bezzi et al., Supplementary Figure 4 a S1A8 b S1A9 IL1b S1A8 expression [AU] expression [AU] **p =.28 expression [AU] *p =.458 expression [AU] Peripheral Blood Intra-tumoral Pten pc-/- c S1A9 IL1b S1A8 6 *p = ***p =.2 3 expression [AU] 4 2 expression [AU] expression [AU] 2 1 CD11b+Gr1+ Tumor (CD45-/CD49f+) CD11b+Gr1+ Tumor (CD45-/CD49f+) CD11b+Gr1+ Tumor (CD45-/CD49f+) d 25K 25K 2K 2K SSC-A 15K FSC-A 15K 1K 53 1K 5K 5K SSC 5K 1K 15K 2K 25K FSC-A FSC FSC <Pacific Blue-A> DAPI 25K FSC-A 2K 15K 1K <PE-A> FSC 3.6 5K CD11b <PE-Cy7-A> Ly6C Ly6G <APC-Cy7-A> 7 Nature Medicine: doi:1.138/nm.4463

8 Supplementary Figure 4. Gr-1+/CD11b+ cells show a differential tumor promotive activity in and tumors. (a) Expression analysis of sorted Gr-1+/CD11b+ cells from Pten pc-/- (n=2), (n=2) and Pten pc-/- ; (n=2) tumors shows a specific upregulation of S1A8 in granulocytes from tumors. Data are represented as mean ± SEM. (b) Expression analysis of sorted Gr-1+/CD11b+ cells from peripheral blood (blood) (n=4) or Pten pc-/- ; tumors shows increase in expression of S1a9 (n=3), S1a8 (n=3) and Il1b (n=4) in granulocytes from the primary tumor site. (c) Expression analysis of sorted CD11b+/Gr1+ cells and tumor cells (CD45-/CD49f+) from tumors (n=3) shows specific expressions of S1a9, Il1b and S1a8 in Gr-1+/CD11b+ cells. All data are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by two-tailed unpaired Student s t-test. (d) Gating strategy for positivity of the Ly6G and Ly6C epitopes. Nature Medicine: doi:1.138/nm

9 Bezzi et al., Supplementary Figure 5 a 1 8 log FC Cxcl1 Cxcl2 Cxcl5 Cxcl1 Cxcl13 Cxcl14 Cxcl15 Cxcl16 Cxcl17 Pten pc-/- log FC 4 2 b Ccl2 Ccl6 Ccl12 Ccl7 Ccl8 Ccl9 Ccl2 Ccl28 Pten pc-/- Gene Symbol LogFC 1 Spink Reg3b Reg Reg3b Mia Muc Clca H Onecut Cxcl Onecut Krt Car Onecut F13Rik d c CXCL5 mrna expression expression [AU] CXCL5 **p =.22 Gr-1+/CD11b+ tumor cells (CD45-/CD49f+) ***p =.4 *p =.1 control Nature Medicine: doi:1.138/nm.4463

10 Supplementary Figure 5. CXCL5 expression is upregulated in tumors. (a) Expression analysis of chemokines from the CXC and CC family using microarray data obtained from prostate tumors (anterior lobes) from 3 months old Pten pc- /- and mice. (b) Gene rank list of upregulated genes in Pten pc-/- ; vs Pten pc-/- mice at 3 months measured by microarray. (c) Expression analysis of sorted intratumoral CD11b+/Gr1+ cells (n=2) and tumor cells (CD45- /CD49f+) (n=3) from tumors shows specific expressions of CXCL5 in tumor cells. (d) Expression analysis of CXCL5 in the prostate tissues of control (n=3), (n=3) mice and in prostate tumor tissue (anterior lobes) from Zbtb7a pc- /- (n=3) mice at 3 months of age by qrt-pcr. All data in (c) and (d) are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by two-tailed unpaired Student s t-test. Nature Medicine: doi:1.138/nm

11 Ly6C Ly6C Bezzi et al., Supplementary Figure 6 a 6 Bone Marrow (BM) Cells Control % of live cells 4 2 GM-CSF + IL6 GM-CSF + IL6 +CXCL5 GM-CSF + IL6 +CXCL17 Ly6G + Ly6C + Ly6G - Ly6C + b Bone Marrow (BM) Cells Gr1+ cells isolated from BM Relative Expression level (qpcr) Arg1 inos S1A8 S1A9 GM-CSF + IL6 GM-CSF + IL6 +CXCL5 GM-CSF + IL6 +CXCL17 IL1b IL1 CD4 Relative Expression level (qpcr) Arg1 inos S1A8 S1A9 GM-CSF + IL6 GM-CSF + IL6 +CXCL5 GM-CSF + IL6 +CXCL17 IL1b IL1 CD4 c Gr1+ cells isoleated from BM DAPI neg, CD11b+ gating Monocytes isolated from BM DAPI neg, CD11b+ gating Ly6G Ly6G 11 Nature Medicine: doi:1.138/nm.4463

12 Supplementary Figure 6. CXCL5 and CXCL17 are not major determinants of immature myeloid cell phenotype. (a) Ly6G+/Ly6C+ and Ly6G-/Ly6C+ flow analysis of BM cells culture for 4 days in GM-CSF, IL-6 supplemented medium plus either recombinant CXCL5 or recombinant CXCL17 (n=2 cell culture replicates). (b) qrt-pcr gene expression analysis of BM and Gr1+ cells from experiment in Supp. Fig. 6a and Fig.4a. Data are represented as mean of 3 cell culture replicates ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by twotailed unpaired Student s t-test. (c) Representative flow cytometry blots of Gr1+ cells and monocytes isolated from the bone marrow of healthy mice. Nature Medicine: doi:1.138/nm

13 Bezzi et al., Supplementary Figure 7 a IgG Pten pc-/-; 1A8 (3 ug) H&E b CXCR2i Vehicle Pten pc-/-; Pten pc-/-; Vehicle c Foxp3+ cells (%) **p = Vehicle CXCR2i 13 Nature Medicine: doi:1.138/nm.4463 CXCR2i

14 Supplementary Figure 7. Depletion of Gr-1+/CD11b+ cells decreases tumor burden in and mice. (a) mice (4 months of age) were treated with Ly6G-depletion antibody or control IgG antibody every other day for 1 days by intraperitoneal injection (3 ug/mouse) and tumor tissue was subjected to histological analysis. Black arrows show regions of reduced tumor burden. Scale bars,.2 mm. (b) Histological Analysis of and Trp53 pc- /- tumors (anterior prostate lobes) treated with Vehicle or SB2252 (CXCR2i) shows reduced tumor burden after CXCR2 inhibition (black arrows). Scale bars,.2 mm. (c) Flow cytometry analysis of prostate tumors after treatment with SB2252 (CXCR2i) (n=5) and vehicle (n=4) every day for 1 days by intraperitoneal injection. Data are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by two-tailed unpaired Student s t- test. Nature Medicine: doi:1.138/nm

15 Bezzi et al., Supplementary Figure 8 a b pirak4 IKBalpha 3 *p=.392 **p= *p =.15 ***p =.2 c normalized value [AU] Pten pc-/- IKBalpha normalized value [AU] d Pten pc-/- CXCL5 *p =.111 *p= normalized value [AU] expression [AU] Vehicle CXCR2i. vehicle CXCR2i 15 Nature Medicine: doi:1.138/nm.4463

16 Supplementary Figure 8. NFkB pathway is markedly activated through Gr- 1+/CD11b+ cells in tumors. (a) Gene Set Enrichment Analysis for NFkB targets using microarray data obtained from tumors derived from 3 month old Pten pc-/- and mice. (b) Protein level of pirak4 (normalized with total IRAK4) and IkBa (normalized with b-actin) in the prostate tumors of 3 month old Pten pc-/-,, and mice (n=3 for each genotype). (c) Protein level of IkBa (normalized with b-actin) in the prostate tumors treated with vehicle (n=2) or SB2252 (CXCR2i) (n=3) in mice. Full scans of the blots for (b) and (c) are in Supp. Figure 1a-d. (d) Expression of CXCL5 in the prostate tumors treated with vehicle (n=3) or SB2252 (CXCR2i) (n=4) in mice. All data in (b), (c) and (d) are represented as mean ± SEM. Values of p<.5 were considered statistically significant. *P<.5; **P<.1; ***P<.1 by two-tailed unpaired Student s t- test. Nature Medicine: doi:1.138/nm

17 Bezzi et al., Supplementary Figure 9 a phospho ERK B-catenin Pten pc-/- b Early stage Later stage 17 Nature Medicine: doi:1.138/nm.4463

18 Supplementary Figure 9. Upregulation of phosho-erk and B-Catenin in Pten pc-/- ; mice. (a) Representative IHC of phospho-erk and b-catenin in Pten pc-/- (n=3) and (n=3) prostate tumors at 3 months of age (anterior prostate lobes). Scale bars,.1 mm. (b) Schematic representation of the three different immune landscapes observed in the, and mice. 18 Nature Medicine: doi:1.138/nm.4463

19 Bezzi et al., Supplementary Figure 1 a e b f c g h d 19 Nature Medicine: doi:1.138/nm.4463

20 Supplementary Figure 1. Full scans of all the blots. (a) Actin western blot for Figure 3b and Supp. Figure 8b and c. Protein lysates of prostate tumors were loaded in the following order: n=3, n=3, n=3 Pten pc-/- mice. For Figure 3b, the cropped image was horizontally flipped. (b) Upper blot: pirak4 western blot for Supp. Figure 8b. Lower blot: CXCL5 western blot for Figure 3b. Protein lysates of prostate tumors were loaded as in (a). For Figure 3b, the cropped image was horizontally flipped. (c) Left blot: IKBalpha western blot for Supp. Figure 8b. Right blot: IRAK4 western blot for Supp. Figure 8b. Protein lysates of prostate tumors were loaded as in (a). (d) Actin and IKBalpha western blot for Supp. Figure 8c. Protein lysates of prostate tumors were loaded in the following order: n=2 treated with vehicle, n=3 treated with SB2252 (CXCR2i). (e) Upper blot: HSP9 western blot for Figure 4d. Lower blot: ZBTB7a western blot for Figure 4d. Protein lysates of prostate organoids were loaded in the following order: wild type,, and. (f) Trp53 western blot for Figure 4d. Protein lysates of prostate organoids were loaded as in (d). (g) p21 western blot for Figure 4d. Protein lysates of prostate organoids were loaded as in (d). (h) PTEN western blot for Figure 4d. Protein lysates of prostate organoids were loaded as in (d). Nature Medicine: doi:1.138/nm

21 Supplementary Table 1. Tumor volumes (mm 3 ) of all the experiments in Figure 5. Genotype Treatment Age at baseline MRI (weeks) Baseline Volume Volume 2 weeks treatment Volume 4 weeks treatment Pten-Zbtb7a IgG Pten-Zbtb7a IgG Pten-Zbtb7a IgG Pten-Zbtb7a IgG Pten-Zbtb7a IgG Pten-Zbtb7a IgG Pten-Zbtb7a IgG Pten-Zbtb7a Anti-CXCL Pten-Zbtb7a Anti-CXCL Pten-Zbtb7a Anti-CXCL Pten-Zbtb7a Anti-CXCL Pten-Zbtb7a Anti-CXCL Pten-Zbtb7a Anti-CXCL Pten-Zbtb7a Anti-CXCL Pten-Zbtb7a Anti-CXCL Pten-Zbtb7a Anti-CXCL Genotype Treatment Age at baseline MRI (weeks) Baseline Volume Volume 3 weeks treatment Pten-Trp53 IgG Pten-Trp53 IgG Pten-Trp53 IgG Pten-Trp53 IgG Pten-Trp53 Anti-Gr Pten-Trp53 Anti-Gr Pten-Trp53 Anti-Gr Pten-Trp53 Anti-Gr Nature Medicine: doi:1.138/nm.4463

22 Genotype Treatment Age at baseline MRI (weeks) Baseline Volume Volume 3 weeks treatment Pten-Zbtb7a Vehicle Pten-Zbtb7a Vehicle Pten-Zbtb7a Vehicle Pten-Zbtb7a Vehicle Pten-Zbtb7a CXCR2i Pten-Zbtb7a CXCR2i Pten-Zbtb7a CXCR2i Pten-Zbtb7a CXCR2i Pten-Zbtb7a CXCR2i Pten-Zbtb7a CXCR2i Genotype Treatment Age at baseline MRI (weeks) Baseline Volume Volume 2 weeks treatment Pten-Pml Vehicle Pten-Pml Vehicle Pten-Pml Vehicle Pten-Pml CXCR2i Pten-Pml CXCR2i Pten-Pml CXCR2i Genotype Treatment Age at baseline MRI (weeks) Baseline Volume Volume 2 weeks treatment Pten-Trp53 Vehicle Pten-Trp53 Vehicle Pten-Trp53 Vehicle Pten-Trp53 Vehicle Pten-Trp53 Vehicle Pten-Trp53 CXCR2i Pten-Trp53 CXCR2i Pten-Trp53 CXCR2i Pten-Trp53 CXCR2i Pten-Trp53 CXCR2i Pten-Trp53 CXCR2i Pten-Trp53 CXCR2i Nature Medicine: doi:1.138/nm.4463

23 Supplementary Table 2. Gene signatures used for the analysis in Figure 6. PMN- Signature Mo-MDSC/M2 Macrophages-signature T Cell Signature CXCR4 CD14 CD8A CXCR2 CD124 CCL2 ITGAM CD45 CCL3 ITGAX CD11B CCL4 ANPEP CD33 CXCL9 CD14 ARG1 CXCL1 FUT4 IL1 ICOS CD33 CD4 GZMK CD34 CD32 IRF1 CD38 CD163 HLA-DMA ENTPD1 CD23 HLA-DMB PTPRC CD2R HLADOA CEACAM8 PD-L2 HLA-DOB CD8 CD68 CSF1R CD115 IL4R HLA-DR CSF3 CD25 CSF2 CCR2 CXCL8 CCL2 TNF FOXP3 CXCL12 CSF1R S1A8 S1A9 STAT1 STAT3 STAT5A ARG1 NOS2 CD274 TLR3 TLR4 TGFB1 IL1 IDO1 PDCD1 Nature Medicine: doi:1.138/nm

24 Supplementary Table 3. SNP analysis of 3 mice for each genotype analyzed. Nature Medicine: doi:1.138/nm

25 Supplementary Table 4. Primer sequences targeting mouse genes used for qrt- PCR. Gene Forward Reverse Actin CGTCGACAACGGCTCCGGCA TGGGCCTCGTCACCCACATAGG CCL1 CAGGATGTTGACAGCAAGAG CATCTTTCTGTAACACTGG CCL2 GGCCTGCTGTTCACAGTTG CTGCTGGTGATCCTCTTGTAG CCL3 CTGCAACCAAGTCTTCTCAG GCCGGTTTCTCTTAGTCAGG CCL4 CTTCTGTGCTCCAGGGTTCTC CTGTCTGCCTCTTTTGGTCAG CCL5 GCTGCTTTGCCTACCTCTCC TCGAGTGACAAACACGACTGC CCL7 GCTTTCAGCATCCAAGTGTG GACTACTGGTGATCCTTCTG CCL2 GCCTCTCGTACATACAGACGC CCAGTTCTGCTTTGGATCAGC CCL28 GTGTGTGGCTTTTCAAACCTCA TGCATGAACTCACTCTTTCCAG CXCL1 ACTGCACCCAAACCGAAGTC TGGGGACACCTTTTAGCATCTT CXCL2 CCAACCACCAGGCTACAGG GCGTCACACTCAAGCTCTG CXCL3 GATTTTGAGACCATCCAGAGC CTCTTCAGTATCTTCTTGATG CXCL5 TGCATTCCGCTTAGCTTTCT CAGAAGGAGGTCTGTCTGGA CXCL7 CACTTCATAACCTCCAGATC CACAGTGAACTCCTGGCCTGTAC CXCL9 GGAGTTCGAGGAACCCTAGTG GGGATTTGTAGTGGATCGTGC CXCL1 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA CXCL12 GTAAACCAGTCAGCCTGAG GCTTTCTCCAGGTACTCTTG CXCL14 GGAAATGAAGCCAAAGTACC GATGAAGCGTTTGGTGCTCTG CXCL15 CAAGGCTGGTCCATGCTCC TGCTATCACTTCCTTTCTGTTGC CXCL16 GGACTGCTTTGAGCGCAAAG CTGAGTGCTCTGACTATGTG CXCL17 AGGTGGCTCTTGGAAGGTG GGTGACATCGTTTGAGAAATTGC IL1beta GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG S1A9 GCACAGTTGGCAACCTTTATG TGATTGTCCTGGTTTGTGTCC S1A8 AAATCACCATGCCCTCTACAAG CCCACTTTTATCACCATCGCAA Arg1 TTTTTCCAGCAGACCAGCTT AGAGATTATCGGAGCGCCTT inos TTCTGTGCTGTCCCAGTGAG TGAAGAAAACCCCTTGTGCT IL1 ATCGATTTCTCCCCTGTGAA TGTCAAATTCATTCATGGCCT CD4 GTCGGCTTCTTCTCCAATCAG CATCACGACAGGAATGACCAG Nature Medicine: doi:1.138/nm

26 Supplementary Table 5. Primer sequences targeting human genes used for qrt-pcr. Gene name Forward Reverse Actin TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGA CXCL5 CTGTTGGTGCTGCTGCTGCTG CGAACACTTGCAGATTACTG CXCL17 TGCTGCCACTAATGCTGATGT CTCAGGAACCAATCTTTGCACT p21 GACCTGTCACTGTCTTGTAC CTTCCTCTTGGAGAAGATCAG Nature Medicine: doi:1.138/nm

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF

Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5 and GM-CSF A RT I C L E S Obesity alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL and GM-CSF Daniela F. Quail,7, Oakley C. Olson,7, Priya Bhardwaj, Logan A. Walsh, Leila Akkari,,,

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.

Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs. Supplementary Figure 1 RNA-Seq analysis of CD8 + TILs and N-TILs. (a) Schematic representation of the tumor and cell types used for the study. HNSCC, head and neck squamous cell cancer; NSCLC, non-small

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

Fisher et al. Supplemental Figure 1

Fisher et al. Supplemental Figure 1 Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Supporting Information

Supporting Information Supporting Information Aldridge et al. 10.1073/pnas.0900655106 Fig. S1. Flow diagram of sublethal (a) and lethal (b) influenza virus infections. (a) Infection of lung epithelial cells by influenza virus

More information

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation IMMUNOLOGICAL MEMORY CD4 T Follicular Helper Cells Memory CD8 T Cell Differentiation CD4 T Cell Differentiation Bcl-6 T-bet GATA-3 ROR t Foxp3 CD4 T follicular helper (Tfh) cells FUNCTION Provide essential

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D.

Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D. Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D. Professor, Departments of Pathology and Medicine Program Leader,

More information

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD) Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

More information

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S.

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S. This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S., Weiss, S. Neutrophils responsive to endogenous IFN-β

More information

How plasma cells develop. Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft

How plasma cells develop. Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft How plasma cells develop Deutsches Rheuma Forschungs Zentrum, Berlin Institut der Leibniz Gemeinschaft 1 Plasma cells develop from activated B cells Toll Like Receptor B Cell Receptor B cell B cell microbia

More information

DURACLONE IF BE CERTAIN ABOUT THE RESPONSE. l res. a il n c n. For Research Use Only - Not for use in Diagnostic procedures

DURACLONE IF BE CERTAIN ABOUT THE RESPONSE. l res. a il n c n. For Research Use Only - Not for use in Diagnostic procedures DURACLONE IF earch tria l res lc a om ic il n c n nio pa Yo ur BE CERTAIN ABOUT THE RESPONSE For Research Use Only - Not for use in Diagnostic procedures BE CERTAIN ABOUT THE RESPONSE The sensitive and

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Human Immune System (HIS) mouse models for translational research. Barbara Joyce-Shaikh

Human Immune System (HIS) mouse models for translational research. Barbara Joyce-Shaikh Human Immune System (HIS) mouse models for translational research Barbara Joyce-Shaikh Humanized Immune System (HIS) Mouse Models Goals Enable clinically relevant in vivo studies of human cells, tissues,

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Asian Zika virus strains target CD14 + blood monocytes and induce M2-skewed immunosuppression during pregnancy

Asian Zika virus strains target CD14 + blood monocytes and induce M2-skewed immunosuppression during pregnancy SUPPLEMENTARY INFORMATION Articles DOI:./s-7-- In the format provided y the authors and unedited. Asian Zika virus strains target CD + lood monocytes and induce M-skewed immunosuppression during pregnancy

More information

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Foxp3-positive Macrophages Display Immunosuppressive Properties and Promote Tumor Growth

Foxp3-positive Macrophages Display Immunosuppressive Properties and Promote Tumor Growth Foxp3-positive Macrophages Display Immunosuppressive Properties and Promote Tumor Growth The Harvard community has made this article openly available. Please share how this access benefits you. Your story

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation Research article Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation C. Andrew Stewart, 1 Hannah Metheny, 1 Noriho Iida, 1 Loretta Smith, 1 Miranda Hanson, 1 Folkert Steinhagen,

More information

Emerging Concepts of Cancer Immunotherapy

Emerging Concepts of Cancer Immunotherapy Emerging Concepts of Cancer Immunotherapy Jeffrey Schlom, Ph.D. Laboratory of Tumor Immunology and Biology (LTIB) Center for Cancer Research National Cancer Institute, NIH Immune Cell Infiltrate in Primary

More information

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours) A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin

More information

Bone marrow stroma: biology and therapeutic exploitation

Bone marrow stroma: biology and therapeutic exploitation Bone marrow stroma: biology and therapeutic exploitation! Francesco Dazzi! francesco.dazzi@kcl.ac.uk Outline 1. Bone marrow stroma and the physiology of the haemopoietic niche! 2. The malignant niche:

More information

Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples

Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Patient ID Age (yrs) BIC classification * HGVS classification # 1 2 BRCA1 del exon BRCA1g.71598-?_71681+?del

More information

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Immunity, Volume 4 Supplemental Information Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Steven J. Van Dyken, Alexander Mohapatra,

More information

Targeting the glucose metabolism of myeloidderived suppressor cells (MDSCs) to stimulate cancer immunity.

Targeting the glucose metabolism of myeloidderived suppressor cells (MDSCs) to stimulate cancer immunity. University of Louisville ThinkIR: The University of Louisville's Institutional Repository Electronic Theses and Dissertations 5-2017 Targeting the glucose metabolism of myeloidderived suppressor cells

More information

Licensing delineates helper and effector NK cell subsets during viral infection

Licensing delineates helper and effector NK cell subsets during viral infection Licensing delineates helper and effector NK cell subsets during viral infection Anthony E. Zamora, 1 Ethan G. Aguilar, 1 Can M. Sungur, 1 Lam T. Khuat, 1 Cordelia Dunai, 1 G. Raymond Lochhead, 2 Juan Du,

More information

Supplementary appendix

Supplementary appendix Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kennedy GA, Varelias A, Vuckovic S, et al.

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Molecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy

Molecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy Molecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy Thomas F. Gajewski, M.D., Ph.D. Professor, Departments of Pathology and Medicine Program Leader,

More information

GM CSF Bioactivity and IBD Phenotype. NIH, CCFA, BMRP NIH DHC Trapnell Lab Kugathasan/Plevy Labs MiOk Kim, PhD

GM CSF Bioactivity and IBD Phenotype. NIH, CCFA, BMRP NIH DHC Trapnell Lab Kugathasan/Plevy Labs MiOk Kim, PhD GM CSF Bioactivity and IBD Phenotype NIH, CCFA, BMRP NIH DHC Trapnell Lab Kugathasan/Plevy Labs MiOk Kim, PhD Defective Neutrophil Function in Crohn s Disease Marks et al Lancet 26 GM CSF in Active Crohn

More information

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice SUPPLEMENTAL METHODS T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice Florian Wiede 1, Benjamin J. Shields 1, Sock Hui Chew 1, Konstantinos Kyparissoudis 2,

More information

Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of

Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of 1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars

More information

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance ORIGINAL ARTICLE Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance Yoshinaga Kawano, 1 Jun Nakae, 1 Nobuyuki Watanabe, 2 Shiho Fujisaka, 3

More information

Cancer, inflammation, and immunity crosstalk

Cancer, inflammation, and immunity crosstalk Contact Technical Support BRCsupport@QIAGEN.COM 1-800-362-7737 Cancer, inflammation, and immunity crosstalk Jesse Liang, Ph.D. Legal disclaimer QIAGEN products shown here are intended for molecular biology

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information

SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans

SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans water-soluble mannoprotein-beta-glucan complex (CAWS) Noriko Nagi-Miura 1,, Daisuke

More information

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV)

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV) A mln NK Cells(x ) 6 1 * ndln NK Cells (x ) ns C Lung NK Cells(x ) 1 1 7 * D LN NK Cells (x ) 1 7 1 7 Days post-infection (A/PR/8) * * E Liver NK Cells (x ) 1 7 Days post-infection (A/PR/8) * * * 1 7 Days

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

DECLARATION OF CONFLICT OF INTEREST. No disclosures

DECLARATION OF CONFLICT OF INTEREST. No disclosures DECLARATION OF CONFLICT OF INTEREST No disclosures micrornas: Role in progression of atherosclerosis Christian Weber Institute for Cardiovascular Prevention (IPEK) Ludwig-Maximilians-University Munich

More information

a b Pml F/F Prrx1-cre f 1.4 n.s.

a b Pml F/F Prrx1-cre f 1.4 n.s. a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane.8.6.4.2.8.6.4.2 1 2 3 4 days in ulture late passages 2 4 6 8 1

More information

CB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response

CB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response CB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response Francesco Parlati, Ph.D. Calithera Biosciences South San Francisco, CA Arginine Depletion by Arginase

More information

Flow cytometry leukocyte differential : a critical appraisal

Flow cytometry leukocyte differential : a critical appraisal Flow cytometry leukocyte differential : a critical appraisal Francis Lacombe Flow cytometry department University Hospital of Bordeaux, Pessac, France francis.lacombe@chu-bordeaux.fr 2008 HORIBA ABX, All

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Clinical question. Screening tube. Diagnostic panel MRD. Clinical question

Clinical question. Screening tube. Diagnostic panel MRD. Clinical question OW CYTOMETRY UPDATES IN LYMPHOPROLIFERATIVE DISORDERS CANCER RESEARCH CENTER IBSAL UNIVERSITY & UNIVERSITY HOSPITAL, SALAMANCA (SPAIN) DISCLOSURES The EuroFlow Scientific Consortium Iamco-chairof receives

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding

More information

General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center

General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center General Overview of Immunology Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center Objectives Describe differences between innate and adaptive immune responses

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Control Pancreatitis Supplementary Figure 2 A Panc Liver SI Spleen H 2 O B EZH2 fl/fl C EZH2 fl/fl 37bp EZH2 ERK2 D E 5 EZH2 fl/fl Fasting Glucose (mg/dl) 2 18 16 14 12 1 8 6 4 2

More information

Copyright 2013 Society for Mucosal Immunology. Deposited on: 21 May 2013

Copyright 2013 Society for Mucosal Immunology.  Deposited on: 21 May 2013 Bain, C.C., Scott, C.L., Uronen-Hansson, H., Gudjonsson, S., Jansson, O., Grip, O., Guilliams, M., Malissen, B., Agace, W.W., and Mowat, A.M. (23) Resident and pro-inflammatory macrophages in the colon

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently Immunity, Volume 47 Supplemental Information Granulocyte-Monocyte Progenitors and Monocyte-endritic ell Progenitors Independently Produce Functionally istinct Monocytes lberto Yáñez, Simon G. oetzee, ndre

More information

IFNg. IFNg IL-5 IL-13 IL-17 IL-22. LTi NCR+ ILC3. IL-17 IL-22 IFNg

IFNg. IFNg IL-5 IL-13 IL-17 IL-22. LTi NCR+ ILC3. IL-17 IL-22 IFNg Group 1 ILC T-Bet Eomes Nkp46 NK1.1 NK cells IFNg T-Bet ILC1 IFNg low RORgt Group 2 ILC RORa CD127 ILC2 IL-5 IL-13 Group 3 ILC RORc CD127 AhR T-Bet AhR LTi c-kit; CD4+/- NCR+ ILC3 c-kit; Nkp46 IL-17 IL-22

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

Supplementary Information

Supplementary Information Supplementary Information Recruitment of Mesenchymal Stem Cells Into Prostate Tumours Promotes Metastasis Younghun Jung 1, Jin Koo Kim 1, Yusuke Shiozawa 1, Jingcheng Wang 1, Anjali Mishra 1, Jeena Joseph

More information

Regulating the Regulators for Cancer Immunotherapy: LAG-3 Finally Catches Up. Drew Pardoll Sidney Kimmel Cancer Center Johns Hopkins

Regulating the Regulators for Cancer Immunotherapy: LAG-3 Finally Catches Up. Drew Pardoll Sidney Kimmel Cancer Center Johns Hopkins Regulating the Regulators for Cancer Immunotherapy: LAG-3 Finally Catches Up Drew Pardoll Sidney Kimmel Cancer Center Johns Hopkins The hostile immune microenvironment within a tumor Stat3 Stat3 NK Lytic

More information

Supporting Information

Supporting Information Supporting Information Shime et al. 1.173/pnas.11139919 SI Methods Reagents. was purchased from GE Healthcare, which was free from LPS contamination. TNF-α and IFN-β ELISA kit was purchased from eioscience

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supplemental Information. High-Throughput Microfluidic Labyrinth for the. Label-free Isolation of Circulating Tumor Cells

Supplemental Information. High-Throughput Microfluidic Labyrinth for the. Label-free Isolation of Circulating Tumor Cells Cell Systems, Volume 5 Supplemental Information High-Throughput Microfluidic Labyrinth for the Label-free Isolation of Circulating Tumor Cells Eric Lin, Lianette Rivera-Báez, Shamileh Fouladdel, Hyeun

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): This manuscript builds on the recently published observation by the same investigators that TNBC tumors with Ras/MAPK activation have decreased

More information

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment

More information

Improved efficacy and in vivo cellular properties of human embryonic stem cell derivative

Improved efficacy and in vivo cellular properties of human embryonic stem cell derivative Supplementary Information Improved efficacy and in vivo cellular properties of human embryonic stem cell derivative in a preclinical model of bladder pain syndrome Aram Kim 1,11,, Hwan Yeul Yu 1,2,, Jisun

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information