α chain β chain C N C N β 2 α 1 β 1 α 2

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "α chain β chain C N C N β 2 α 1 β 1 α 2"

Transcription

1 a α chain c β chain C N C N β 2 m α chain b d N C N C β 1 α 2 Supplemental Figure 1 Major histocompatibility complex (MHC) class I and class II structures. (a, b)representation of the structure of the class I HLA-B*41:04 (3LN5; see Bade-Döding et al. 2011), viewed from (a) side and (b) above. The invariant β 2 -microglobulin (β 2 m) chain is in magenta, and the polymorphic B*41:04 α chain is in red. The 11-mer HEEAVSVDRVL self-peptide observed within the antigen-binding cleft of this structure is shown in stick format (yellow). The peptide s N and C termini are labeled accordingly. The molecular surface of this MHC peptide is overlaid in semitransparent mode. (c, d) Equivalent views of the structure of the class II HLA-DQ8 (2NNA; see Henderson et al. 2007). The polymorphic α (HLA-DQA1*03:01) and β (HLA-DQB1*03:02) chains are colored red and magenta, respectively. Residues of the deamidated 18-mer QQYPSGEGSFQPSQENPQ -gliadin peptide that were observed within the antigenbinding cleft of this structure are shown in stick format (yellow). The peptide s N- to C- terminal orientation is labeled.

2 β 1 β 1 α 2 Polymorphism in HLA-DQA1 and -DQB1 3 DQA1 mutation DQB1 mutation β 2 Nonsilent substitutions Frequency Mature protein position Supplemental Figure 2 Major histocompatibility complex class II polymorphism. Structural and graphical representations of nonsilent polymorphism in the HLA-DQA1 and -DQB1 genes. The frequencies of amino acid substitutions in eligible sequences of HLA-DQ (A1*01-A1*06 and B1*02-*06) were mapped onto the three-dimensional structure of HLA-DQ8. Individual positions were color-coded according to the number of distinct amino acid substitutions observed: 0, blue; 1, green; 2, yellow; 3, red. Only complete and confirmed HLA-DQ sequences are represented. References Bade-Döding C, Theodossis A, Gras S, Kjer-Nielsen L, Eiz-Vesper B, et al The impact of human leukocyte antigen (HLA) micropolymorphism on ligand specificity within the HLA-B * 41 allotypic family. Haematologica 96: Henderson KN, Tye-Din JA, Reid HH, Chen Z, Borg NA, et al A structural and immunological basis for the role of human leukocyte antigen DQ8 in celiac disease. Immunity 27:23--34

3 Supplemental Table 1 Simplified schematic of the organization of the human leukocyte antigen (HLA) complex MHC class II III I Locus/loci DP DQ DR C4, C2, BF B C A Gene product(s) Number of alleles DP-α, -β DQ-α, -β DR-α, -β C proteins TNF-α, -β HLA-B HLA-C HLA-A 28,145 35,144 3, ,069 1,016 1,519 Abbreviations: MHC, major histocompatibility complex; TNF, tumor necrosis factor. Adapted from figure 7-1 in the following Reference: Goldsby RA, Kindt TJ, Osborne BA, Kuby J Immunology. New York: W. H. Freeman

4 NON--MAJOR HISTOCOMPATIBILITY COMPLEX DETERMINANTS OF DRUG HYPERSENSITIVITY It is unknown why only 2%--5% of HLA-DQ2 and/or HLA-DQ8 carriers develop celiac disease, and although the possession of HLA-B*57:01 and HLA-B*15:02 in AHS and carbamazepine-induced SJS/TEN, respectively, appear necessary for the development of these reactions, they are by no means sufficient. The PREDICT-1 and SHAPE studies showed that approximately 50% of HLA-B*57:01-positive individuals exposed to abacavir failed to develop AHS (Mallal et al. 2008), whereas 3% of carbamazepine-tolerant individuals possessed HLA-B*15:02 (Chung et al. 2004). In vitro studies have advanced the understanding of HLA in drug hypersensitivities, but the roles of other genes and environmental influences remain unclear in these reactions. Genetic polymorphisms in genes involved in cytokine production (Kim et al. 2006, 2009; Park et al. 2008; Pirmohamed et al. 2001) and drug metabolism (Perry et al. 1970, Viznerova et al. 1973) have been implicated in the manifestation of hypersensitivity reactions, and future investigations should include genome-wide analysis of both susceptible and tolerant individuals carrying the relevant HLA allotype. The possibility that TCR gene polymorphism might impact the development of hypersensitivity should also be considered. Narcolepsy, associated with HLA-DQB1*06:02 and mooted to be the result of immune-mediated cell death in the hypothalamus, has recently been further associated with polymorphisms of the TCRα gene locus, suggesting a possible role for specific TCR alleles or TCR regulation along with the defined association with HLA-DQB1*06:02 (Hallmayer et al. 2009). Furthermore, polymorphism in the TCR genes can alter the ability of individuals to mount T cell responses against specific viral epitopes in the same HLA context (Gras et al. 2010). This suggests that some forms of DHS might be restricted not only by ligand presentation on a specific HLA allotype but also by the presence of specific TCR alleles capable of interaction with the immunogenic complex.

5 In addition to genetic factors, underlying disease status of an individual may also play a role in generating the environment necessary for T cell stimulation. For example, CD4 + and CD8 + T cell counts at the time of drug introduction are thought to contribute to nevirapine hypersensitivities and AHS, respectively (Easterbrook et al. 2003, Martin et al. 2005), whereas differences in renal function have been implicated in allopurinol hypersensitivities (Markel 2005). Further layers of complexity may also be generated by environmental factors, such as diet, that can affect drug activity (Custodio das Dores et al. 2007). The observation that HLA- B*57:01 is associated with AHS (predominantly a systemic reaction) and flucloxacillin hypersensitivity (which manifests as liver injury) suggests that the in vivo metabolism of the drug is also important in understanding the etiology and immunology of the disease. Literature Cited Chung WH, Hung SI, Hong HS, Hsih MS, Yang LC, et al Medical genetics: a marker for Stevens-Johnson syndrome. Nature 428:486 Custodio das Dores SM, Booth SL, Martini LA, Aujo Martini L, de Carvalho Gouvea VH, et al Relationship between diet and anticoagulant response to warfarin: a factor analysis. Eur. J. Nutr. 46: Easterbrook PJ, Waters A, Murad S, Ives N, Taylor C, et al Epidemiological risk factors for hypersensitivity reactions to abacavir. HIV Med. 4: Gras S, Chen Z, Miles JJ, Liu YC, Bell MJ, et al Allelic polymorphism in the T cell receptor and its impact on immune responses. J. Exp. Med. 207: Hallmayer J, Faraco J, Lin L, Hesselson S, Winkelmann J, et al Narcolepsy is strongly associated with the T-cell receptor alpha locus. Nat. Genet. 41: Kim SH, Yang EM, Lee HN, Cho BY, Ye YM, Park HS Combined effect of IL-10 and TGF-β1 promoter polymorphisms as a risk factor for aspirin-intolerant asthma and rhinosinusitis. Allergy 64: Kim SH, Ye YM, Lee SK, Choi JH, Holloway JW, et al Association of TNF-α genetic polymorphism with HLA DPB1 * Clin. Exp. Allergy 36:

6 Mallal S, Phillips E, Carosi G, Molina J-M, Workman C, et al HLA-B*5701 screening for hypersensitivity to abacavir. N. Engl. J. Med. 358: Markel A Allopurinol-induced DRESS syndrome. Isr. Med. Assoc. J. 7: Martin AM, Nolan D, James I, Cameron P, Keller J, et al Predisposition to nevirapine hypersensitivity associated with HLA-DRB1 * 0101 and abrogated by low CD4 T-cell counts. AIDS 19: Park HJ, Ye YM, Hur GY, Kim SH, Park HS Association between a TGFβ1 promoter polymorphism and the phenotype of aspirin-intolerant chronic urticaria in a Korean population. J. Clin. Pharm. Ther. 33: Perry HM, Tan EM, Carmody S, Sakamoto A Relationship of acetyl transferase activity to antinuclear antibodies and toxic symptoms in hypertensive patients treated with hydralazine. J. Lab. Clin. Med. 76: Pirmohamed M, Lin K, Chadwick D, Park BK TNFα promoter region gene polymorphisms in carbamazepine-hypersensitive patients. Neurology 56: Viznerova A, Slavikova Z, Ellard GA The determination of the acetylator phenotype of tuberculosis patients in Czechoslovakia using sulphadimidine. Tubercle 54:67--71

Significance of the MHC

Significance of the MHC CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) - MHC molecules were initially discovered during studies aimed

More information

AG MHC HLA APC Ii EPR TAP ABC CLIP TCR

AG MHC HLA APC Ii EPR TAP ABC CLIP TCR !! AG MHC HLA APC Ii EPR TAP ABC CLIP TCR Antigen Major Histocompartibility Complex Human Leukocyte Antigen Antigen Presenting Cell Invariant Chain Endoplasmatic Reticulum Transporters Associated with

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens

More information

Antigen Presentation to T lymphocytes

Antigen Presentation to T lymphocytes Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antigen processing: How are

More information

MHC class I MHC class II Structure of MHC antigens:

MHC class I MHC class II Structure of MHC antigens: MHC class I MHC class II Structure of MHC antigens: MHC class I antigens consist of a transmembrane heavy chain (α chain) that is non-covalently associated with β2- microglobulin. Membrane proximal domain

More information

Mechanisms of Drug Hypersensitivity Reactions

Mechanisms of Drug Hypersensitivity Reactions 18/5/213 Mechanisms of Drug Hypersensitivity Reactions Munir Pirmohamed NHS Chair of Pharmacogenetics Department of Molecular and Clinical Pharmacology Institute of Translational Medicine University of

More information

the HLA complex Hanna Mustaniemi,

the HLA complex Hanna Mustaniemi, the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important

More information

Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction

Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Basic Immunology Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Molecular structure of MHC, subclasses, genetics, functions. Antigen presentation and MHC restriction.

More information

BDC Keystone Genetics Type 1 Diabetes. Immunology of diabetes book with Teaching Slides

BDC Keystone Genetics Type 1 Diabetes.  Immunology of diabetes book with Teaching Slides BDC Keystone Genetics Type 1 Diabetes www.barbaradaviscenter.org Immunology of diabetes book with Teaching Slides PRACTICAL Trailnet screens relatives and new onset patients for autoantibodies and HLA

More information

Clinical Relevance of the HLA System in Blood Transfusion. Dr Colin J Brown PhD FRCPath. October 2017

Clinical Relevance of the HLA System in Blood Transfusion. Dr Colin J Brown PhD FRCPath. October 2017 Clinical Relevance of the HLA System in Blood Transfusion Dr Colin J Brown PhD FRCPath. October 2017 Outline of talk HLA genes, structure and function HLA and immune complications of transfusion TA-GVHD

More information

The Adaptive Immune Response. T-cells

The Adaptive Immune Response. T-cells The Adaptive Immune Response T-cells T Lymphocytes T lymphocytes develop from precursors in the thymus. Mature T cells are found in the blood, where they constitute 60% to 70% of lymphocytes, and in T-cell

More information

HLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute

HLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute HLA Mismatches Professor Steven GE Marsh HLA Mismatches HLA Genes, Structure, Polymorphism HLA Nomenclature HLA Mismatches in HSCT Defining a mismatch HLA Mismatches HLA Genes, Structure, Polymorphism

More information

Profiling HLA motifs by large scale peptide sequencing Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009

Profiling HLA motifs by large scale peptide sequencing Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009 Profiling HLA motifs by large scale peptide sequencing 2009 Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009 HLA Background The human leukocyte antigen system (HLA) is the

More information

The role of HLA in Allogeneic Hematopoietic Stem Cell Transplantation and Platelet Refractoriness.

The role of HLA in Allogeneic Hematopoietic Stem Cell Transplantation and Platelet Refractoriness. The role of HLA in Allogeneic Hematopoietic Stem Cell Transplantation and Platelet Refractoriness. Robert Liwski, MD, PhD, FRCPC Medical Director HLA Typing Laboratory Department of Pathology Dalhousie

More information

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response Ivana FELLNEROVÁ E-mail: fellneri@hotmail.com, mob. 732154801 Basic immunogenetic terminology innate and adaptive immunity specificity and polymorphism immunoglobuline gene superfamily immunogenetics MHC

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

The Major Histocompatibility Complex

The Major Histocompatibility Complex The Major Histocompatibility Complex Today we will discuss the MHC The study of MHC is necessary to understand how an immune response is generated. And these are the extra notes with respect to slides

More information

Historical definition of Antigen. An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen.

Historical definition of Antigen. An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen. Historical definition of Antigen An antigen is a foreign substance that elicits the production of antibodies that specifically binds to the antigen. Historical definition of Antigen An antigen is a foreign

More information

The Human Major Histocompatibility Complex

The Human Major Histocompatibility Complex The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure

More information

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity

More information

Class I Ag processing. TAP= transporters associated with antigen processing Transport peptides into ER

Class I Ag processing. TAP= transporters associated with antigen processing Transport peptides into ER Antigen processing Class I Ag processing TAP= transporters associated with antigen processing Transport peptides into ER Proteosome degrades cytosolic proteins Large, multi-subunit complex Degrades foreign

More information

Antigens and Immunogens

Antigens and Immunogens Background 1. Medical Importance of Immune System (vaccines, immunodeficiency diseases, hypersensitivity) 2. How the Immune System Works (innate & adaptive immune mech., B/T cells, Abs, Cytokines) 2. Cells

More information

MHC Class II. Alexandra López Laura Taberner Gemma Vilajosana Ilia Villate. Structural Biology Academic year Universitat Pompeu Fabra

MHC Class II. Alexandra López Laura Taberner Gemma Vilajosana Ilia Villate. Structural Biology Academic year Universitat Pompeu Fabra MHC Class II Alexandra López Laura Taberner Gemma Vilajosana Ilia Villate Structural Biology Academic year 2012-2013 Universitat Pompeu Fabra Index - Introduction - Peptide binding to MHC class II - pockets

More information

Narcolepsy with Cataplexy: An Autoimmune Phenomenon

Narcolepsy with Cataplexy: An Autoimmune Phenomenon Fall 2014 Meeting October 3-4, 2014 Narcolepsy with Cataplexy: An Autoimmune Phenomenon Soumya C. Madala MD Mercy Health Sleep Center Grand Rapids, MI Conflict of Interest Disclosures for Speakers 1. I

More information

Chemically Reactive Drug Metabolites in Drug Discovery and Development Detection, Evaluation, and Risk Assessment

Chemically Reactive Drug Metabolites in Drug Discovery and Development Detection, Evaluation, and Risk Assessment Chemically Reactive Drug Metabolites in Drug Discovery and Development Detection, Evaluation, and Risk Assessment Pacific Northwest Bio Meeting Seattle, WA, August 14, 2012 Thomas A. Baillie, PhD, DSc

More information

Targeting the Trimolecular Complex for Immune Intervention. Aaron Michels MD

Targeting the Trimolecular Complex for Immune Intervention. Aaron Michels MD Targeting the Trimolecular Complex for Immune Intervention Aaron Michels MD Disclosures Research Grant from Novartis. Research Grant from NovoNordisk. Take Home Points Type 1 diabetes is an immunologic

More information

How T cells recognize antigen. How T cells recognize antigen -concepts

How T cells recognize antigen. How T cells recognize antigen -concepts Adaptive immunity How T cells recognize antigen Starting point: 2. Diversity in antigen recognition is accomplished, in part, by rearrangements in the TCR loci. This occurs in the thymus 3. The T cell

More information

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG

More information

Alleles: the alternative forms of a gene found in different individuals. Allotypes or allomorphs: the different protein forms encoded by alleles

Alleles: the alternative forms of a gene found in different individuals. Allotypes or allomorphs: the different protein forms encoded by alleles Nomenclature Alleles: the alternative forms of a gene found in different individuals Allotypes or allomorphs: the different protein forms encoded by alleles Genotype: the collection of genes in an individual,

More information

Amino acid sequences in the β chain HLA- DRB*0401 molecules dictate susceptibility to RA Amino Acids in the Shared Epitope

Amino acid sequences in the β chain HLA- DRB*0401 molecules dictate susceptibility to RA Amino Acids in the Shared Epitope MHC/self-peptide MHC/Vβ TCR Vβx + Vβx T cell Induction of + TH1 mediated autoimmunity: A paradigm for the pathogenesis of rheumatoid arthritis, multiple sclerosis and APC type I diabetes TCR Vβx Activated

More information

DIRECT IDENTIFICATION OF NEO-EPITOPES IN TUMOR TISSUE

DIRECT IDENTIFICATION OF NEO-EPITOPES IN TUMOR TISSUE DIRECT IDENTIFICATION OF NEO-EPITOPES IN TUMOR TISSUE Eustache Paramithiotis PhD Vice President, Biomarker Discovery & Diagnostics 17 March 2016 PEPTIDE PRESENTATION BY MHC MHC I Antigen presentation by

More information

Nomenclature. HLA genetics in transplantation. HLA genetics in autoimmunity

Nomenclature. HLA genetics in transplantation. HLA genetics in autoimmunity Nomenclature Alleles: the alternative forms of a gene found in different individuals Allotypes or allomorphs: the different protein forms encoded by alleles During pregnancy the mother tolerates the expression

More information

Autoimmune diseases. Autoimmune diseases. Autoantibodies. Autoimmune diseases relatively common

Autoimmune diseases. Autoimmune diseases. Autoantibodies. Autoimmune diseases relatively common Autoimmune diseases Fundamental abnormality: the adaptive immune system is triggered by self antigens to initiate a sustained immune response against self molecules that results in tissue injury Specificity

More information

Structure and Function of Antigen Recognition Molecules

Structure and Function of Antigen Recognition Molecules MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and

More information

2017 EFI/DGI Meeting Teaching Session I

2017 EFI/DGI Meeting Teaching Session I 2017 EFI/DGI Meeting Teaching Session I Mannheim, Wednesday, 31.05.2017 10:30 12:00 Role of non-classical HLA in Stem Cell Transplantation 10:30 10:40 Non Classical HLA-Molecules J. Mytilineos, Ulm 10:40

More information

Sustained adaptive immune response to self antigens may or may not result in tissue injury according to particular host genetics

Sustained adaptive immune response to self antigens may or may not result in tissue injury according to particular host genetics Autoimmune diseases Fundamental abnormality: the adaptive immune system is triggered by self antigens to initiate a sustained immune response against self molecules that results in tissue injury Specificity

More information

T cell maturation. T-cell Maturation. What allows T cell maturation?

T cell maturation. T-cell Maturation. What allows T cell maturation? T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

More information

B F. Location of MHC class I pockets termed B and F that bind P2 and P9 amino acid side chains of the peptide

B F. Location of MHC class I pockets termed B and F that bind P2 and P9 amino acid side chains of the peptide Different MHC alleles confer different functional properties on the adaptive immune system by specifying molecules that have different peptide binding abilities Location of MHC class I pockets termed B

More information

T-cell receptor feature. Antibody/antigen interaction. Major Histocompatibility Complex. Antigen processing. Antigen presentation

T-cell receptor feature. Antibody/antigen interaction. Major Histocompatibility Complex. Antigen processing. Antigen presentation ntibody/antigen interaction Major Histocompatibility Complex ntigen processing ntigen presentation PC/T-cell interaction T-cell receptor feature CD4+ T-Cell HL/peptide/TCR complex CD8+ T-Cell Proteasome

More information

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmunity Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmune disease can be caused to primary defects in B cells, T cells and possibly

More information

IMMUNOINFORMATICS: Bioinformatics Challenges in Immunology

IMMUNOINFORMATICS: Bioinformatics Challenges in Immunology Bioinformatics 1 -- Lecture 22 IMMUNOINFORMATICS: Bioinformatics Challenges in Immunology Most slides courtesy of Julia Ponomarenko, San Diego Supercomputer Center or Oliver Kohlbacher, WSI/ZBIT, Eberhard-Karls-

More information

Genetic Susceptibility in Granulomatous Disorders: Chronic Beryllium Disease and Sarcoidosis Prof. Lee S. Newman

Genetic Susceptibility in Granulomatous Disorders: Chronic Beryllium Disease and Sarcoidosis Prof. Lee S. Newman Genetic Susceptibility Chronic Beryllium Disease and Sarcoidosis Lee S. Newman, MD, MA, FCCP, FACOEM Prof essor of Prev entiv e Medicine and Biometrics and Prof essor of Medicine Univ ersity of Colorado

More information

CS229 Final Project Report. Predicting Epitopes for MHC Molecules

CS229 Final Project Report. Predicting Epitopes for MHC Molecules CS229 Final Project Report Predicting Epitopes for MHC Molecules Xueheng Zhao, Shanshan Tuo Biomedical informatics program Stanford University Abstract Major Histocompatibility Complex (MHC) plays a key

More information

MolDX: HLA-DQB1*06:02 Testing for Narcolepsy

MolDX: HLA-DQB1*06:02 Testing for Narcolepsy MolDX: HLA-DQB1*06:02 Testing for Narcolepsy CGS Administrators, LLC Jump to Section... Please Note: This is a Proposed LCD. Proposed LCDs are works in progress and not necessarily a reflection of the

More information

Autoimmunity. By: Nadia Chanzu, PhD Student, UNITID Infectious Minds Presentation November 17, 2011

Autoimmunity. By: Nadia Chanzu, PhD Student, UNITID Infectious Minds Presentation November 17, 2011 Molecular Mechanisms of Autoimmunity By: Nadia Chanzu, PhD Student, UNITID Infectious Minds Presentation November 17, 2011 Introduction 3m Pick an organ, any organ... Autoimmunity can affect ANY organ/organ

More information

Host Genomics of HIV-1

Host Genomics of HIV-1 4 th International Workshop on HIV & Aging Host Genomics of HIV-1 Paul McLaren École Polytechnique Fédérale de Lausanne - EPFL Lausanne, Switzerland paul.mclaren@epfl.ch Complex trait genetics Phenotypic

More information

HLA-A * L

HLA-A * L What is Nomenclature? HLA Nomenclature 3.0 Signifies DNA Subtype Differences outside the coding region (introns) HLA-A * 4 0 01 0 L Steve Spellman Sr. Manager, NMDP Asst. Scientific Director, CIBMTR Locus

More information

Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT

Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT Stephen Spellman, MBS Director, Immunobiology and Observational Research Assistant Scientific Director CIBMTR,

More information

10/18/2012. A primer in HLA: The who, what, how and why. What?

10/18/2012. A primer in HLA: The who, what, how and why. What? A primer in HLA: The who, what, how and why What? 1 First recognized in mice during 1930 s and 1940 s. Mouse (murine) experiments with tumors Independent observations were made in humans with leukoagglutinating

More information

Table S1. X-ray data collection and refinement statistics

Table S1. X-ray data collection and refinement statistics Table S1. X-ray data collection and refinement statistics Data collection H7.167 Fab-Sh2/H7 complex Beamline SSRL 12-2 Wavelength (Å) 0.97950 Space group I2 1 3 Unit cell parameters (Å, º) a = b = c=207.3,

More information

ASHI Proficiency Testing Program Summary Report. Survey 2013-HT1 / HLA Typing

ASHI Proficiency Testing Program Summary Report. Survey 2013-HT1 / HLA Typing ASHI Proficiency Testing Program Summary Report Survey 2013-HT1 / HLA Typing Shipping Date: February 26,2013 / Results Due Date:April 5,2013 / Report Date: May 17,2013 The ASHI HT proficiency testing survey

More information

Phase of immune response

Phase of immune response Antigen and antigen recognition by lymphocytes Antigen presentation to T lymphocytes Sanipa Suradhat Department of Veterinary Microbiology Faculty of Veterinary Science Phase of immune response 1 Phase

More information

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the

More information

HLA TYPING AND EXPRESSION: POTENTIAL MARKER FOR IDENTIFYING EARLY DYSPLASIA AND STRATIFYING THE RISK FOR IBD-CANCER

HLA TYPING AND EXPRESSION: POTENTIAL MARKER FOR IDENTIFYING EARLY DYSPLASIA AND STRATIFYING THE RISK FOR IBD-CANCER HLA TYPING AND EXPRESSION: POTENTIAL MARKER FOR IDENTIFYING EARLY DYSPLASIA AND STRATIFYING THE RISK FOR IBD-CANCER Megan Garrity, S. Breanndan Moore, M.D., William Sandborn, M.D., Vernon Pankratz, Ph.D.,

More information

Physiology Unit 3. ADAPTIVE IMMUNITY The Specific Immune Response

Physiology Unit 3. ADAPTIVE IMMUNITY The Specific Immune Response Physiology Unit 3 ADAPTIVE IMMUNITY The Specific Immune Response In Physiology Today The Adaptive Arm of the Immune System Specific Immune Response Internal defense against a specific pathogen Acquired

More information

Immunogens and Antigens *

Immunogens and Antigens * Immunogens and Antigens * Jeffrey K. Actor, Ph.D. Pathology and Laboratory Medicine The University of Texas-Houston Medical School * Special thanks to Dr. L. Scott Rodkey, Ph.D. Immunogen vs. Antigen Immunogen-Agent

More information

General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center

General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center General Overview of Immunology Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center Objectives Describe differences between innate and adaptive immune responses

More information

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow. Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature

More information

Induction of antigenspecific. peptide epitopes. University of Bristol

Induction of antigenspecific. peptide epitopes. University of Bristol Induction of antigenspecific tolerance with peptide epitopes d.c.wraith@bris.ac.uk University of Bristol Antigen-directed therapy of hypersensitivity diseases In 1911, Drs John Freeman and Leonard Noon

More information

Immunogenetics in Vaccine Design and Pharmacogenetics

Immunogenetics in Vaccine Design and Pharmacogenetics Immunogenetics in Vaccine Design and Pharmacogenetics M. Sue Leffell, Ph.D. Johns Hopkins University School of Medicine Vaccine Achievements Vaccination is one of greatest public health achievements Almost

More information

Chapter 35 Active Reading Guide The Immune System

Chapter 35 Active Reading Guide The Immune System Name: AP Biology Mr. Croft Chapter 35 Active Reading Guide The Immune System Section 1 Phagocytosis plays an important role in the immune systems of both invertebrates and vertebrates. Review the process

More information

Antibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity

Antibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity Antibodies and T Cell Receptor Genetics 2008 Peter Burrows 4-6529 peterb@uab.edu Generation of Antigen Receptor Diversity Survival requires B and T cell receptor diversity to respond to the diversity of

More information

AUTOIMMUNITY CLINICAL CORRELATES

AUTOIMMUNITY CLINICAL CORRELATES AUTOIMMUNITY CLINICAL CORRELATES Pamela E. Prete, MD, FACP, FACR Section Chief, Rheumatology VA Healthcare System, Long Beach, CA Professor of Medicine, Emeritus University of California, Irvine Colonel

More information

T cell development October 28, Dan Stetson

T cell development October 28, Dan Stetson T cell development October 28, 2016 Dan Stetson stetson@uw.edu 441 Lecture #13 Slide 1 of 29 Three lectures on T cells (Chapters 8, 9) Part 1 (Today): T cell development in the thymus Chapter 8, pages

More information

Key words: antiphospholipid syndrome, trombosis, pathogenesis

Key words: antiphospholipid syndrome, trombosis, pathogenesis 26. XI,. 4/2011,.,..,..,., -..,,. 2GPI. -,.,,., -,, -, -,,,,, IL-1, IL-2, IL-6, IL-8, IL-12, IL-10, TNF, INF-. :,, N. Stoilov, R. Rashkov and R. Stoilov. ANTIPHOSPHOLIPID SYNDROME HISTORICAL DATA, ETI-

More information

Use of BONSAI decision trees for the identification of potential MHC Class I peptide epitope motifs.

Use of BONSAI decision trees for the identification of potential MHC Class I peptide epitope motifs. Use of BONSAI decision trees for the identification of potential MHC Class I peptide epitope motifs. C.J. SAVOIE, N. KAMIKAWAJI, T. SASAZUKI Dept. of Genetics, Medical Institute of Bioregulation, Kyushu

More information

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow. Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature

More information

6/19/2012. Who is in the room today? What is your level of understanding of Donor Antigens and Candidate Unacceptables in KPD?

6/19/2012. Who is in the room today? What is your level of understanding of Donor Antigens and Candidate Unacceptables in KPD? 6/19/212 KPD Webinar Series: Part 3 Demystifying the OPTN Kidney Paired Donation Pilot Program Unacceptable HLA antigens: The key to finding a compatible donor for your patient M. Sue Leffell, Ph.D. J.

More information

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012.

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012. www.ebmt.org HLA and more Ilias I.N. Doxiadis Geneva 03/04/2012 HLA and more HLA and more / Doxiadis 2 Topic of the day Compatibility testing is a type of testing used to ensure compatibility of the system/application/website

More information

Elevated CD4+/CD8+ Ratio in HIV Elite Controller

Elevated CD4+/CD8+ Ratio in HIV Elite Controller Elevated / Ratio in HIV Elite Controller Joseph Carnevale, BA 1,2 ; Timothy Flanigan, MD 2,3 1 Fordham University, New York, NY 2 Brown University Alpert Medical School, Providence, RI 3 Division of Infectious

More information

immunopathology Dr. Ameer Dhahir

immunopathology Dr. Ameer Dhahir immunopathology Dr. Ameer Dhahir Objectives. Explaining the causes of immune deficiency with clinical examples. Explaining important examples of inappropriate or excessive immune response. Discussing the

More information

There are 2 major lines of defense: Non-specific (Innate Immunity) and. Specific. (Adaptive Immunity) Photo of macrophage cell

There are 2 major lines of defense: Non-specific (Innate Immunity) and. Specific. (Adaptive Immunity) Photo of macrophage cell There are 2 major lines of defense: Non-specific (Innate Immunity) and Specific (Adaptive Immunity) Photo of macrophage cell Development of the Immune System ery pl neu mφ nk CD8 + CTL CD4 + thy TH1 mye

More information

White Blood Cells (WBCs)

White Blood Cells (WBCs) YOUR ACTIVE IMMUNE DEFENSES 1 ADAPTIVE IMMUNE RESPONSE 2! Innate Immunity - invariant (generalized) - early, limited specificity - the first line of defense 1. Barriers - skin, tears 2. Phagocytes - neutrophils,

More information

Antigen Receptor Structures October 14, Ram Savan

Antigen Receptor Structures October 14, Ram Savan Antigen Receptor Structures October 14, 2016 Ram Savan savanram@uw.edu 441 Lecture #8 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Today): Structural features of the BCR and TCR Janeway Chapter

More information

Basic immunology. Lecture 9. Innate immunity: inflammation, leukocyte migration. Péter Engelmann

Basic immunology. Lecture 9. Innate immunity: inflammation, leukocyte migration. Péter Engelmann Basic immunology Lecture 9. Innate immunity: inflammation, leukocyte migration Péter Engelmann Different levels of the immune response Recognition molecules of innate immunity Initiation of local and systemic

More information

Research: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype

Research: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype Research: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype J. M. M. Howson 1,2, M. S. Roy 3, L. Zeitels 1, H. Stevens 1 and J. A. Todd

More information

Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia

Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia AIDSvaccine conference, 14 th September 2011 IMGT HLA database July 2011 >5000 class

More information

Fetal-Maternal HLA Relationships and Autoimmune Disease. Giovanna Ibeth Cruz. A dissertation submitted in partial satisfaction of the

Fetal-Maternal HLA Relationships and Autoimmune Disease. Giovanna Ibeth Cruz. A dissertation submitted in partial satisfaction of the Fetal-Maternal HLA Relationships and Autoimmune Disease By Giovanna Ibeth Cruz A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Epidemiology

More information

Relationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese

Relationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese HK J Paediatr (new series) 2005;10:20-25 Relationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese YM SANG, C YAN, C ZHU, GC NI, YM HU Abstract Key words The Human Leucocyte Antigen (HLA)-DMA

More information

Antigen presenting cells

Antigen presenting cells Antigen recognition by T and B cells - T and B cells exhibit fundamental differences in antigen recognition - B cells recognize antigen free in solution (native antigen). - T cells recognize antigen after

More information

Al-Zaytoonah University of Jordan. Course Name. Course No. Credit Hours. Prerequisite Intended Learning Outcomes. Course Topics.

Al-Zaytoonah University of Jordan. Course Name. Course No. Credit Hours. Prerequisite Intended Learning Outcomes. Course Topics. Department Pharmacy Course Name Immunology Course No. 0201336 Prerequisite Pharmaceutical Microbiology Credit Hours 2 Number & date of course plan approval 2010-2011 Brief Description See form QF02/0409

More information

Antigen Presentation to T lymphocytes

Antigen Presentation to T lymphocytes Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antibodies and T cell receptors

More information

T Cell Differentiation

T Cell Differentiation T Cell Differentiation Ned Braunstein, MD MHC control of Immune Responsiveness: Concept Whether or not an individual makes an immune response to a particular antigen depends on what MHC alleles an individual

More information

Minimal Requirements for Histocompatibility & Immunogenetics Laboratory

Minimal Requirements for Histocompatibility & Immunogenetics Laboratory Minimal Requirements for Histocompatibility & Immunogenetics Laboratory The 4 th WBMT Congress and Workshop Riyadh, KSA - January 15-17, 2017 HLA Discovery, 1958 The Nobel Prize in Physiology or Medicine

More information

The Immune Epitope Database Analysis Resource: MHC class I peptide binding predictions. Edita Karosiene, Ph.D.

The Immune Epitope Database Analysis Resource: MHC class I peptide binding predictions. Edita Karosiene, Ph.D. The Immune Epitope Database Analysis Resource: MHC class I peptide binding predictions Edita Karosiene, Ph.D. edita@liai.org IEDB Workshop October 29, 2015 Outline Introduction MHC-I peptide binding prediction

More information

Antigen sampling and presentation

Antigen sampling and presentation Antigen sampling and presentation ntigen sampling ntigen recognition ntigen clearance What is an antigen How antigens are sampled when they enter the body How do B and T lymphocytes recognize antigens

More information

Use of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing of Patients with Narcolepsy

Use of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing of Patients with Narcolepsy Original Article Woo HI, et al. Diagnostic Immunology Ann Lab Med 2012;32:57-65 ISSN 2234-3806 eissn 2234-3814 Use of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing

More information

allergy Asia Pacific Stevens-Johnson syndrome and toxic epidermal necrolysis in Dr. Hasan Sadikin General Hospital Bandung, Indonesia from

allergy Asia Pacific Stevens-Johnson syndrome and toxic epidermal necrolysis in Dr. Hasan Sadikin General Hospital Bandung, Indonesia from pissn -876 eissn -868 Original Article Asia Pac Allergy 6;6:-7 Stevens-Johnson syndrome and toxic epidermal necrolysis in Dr. Hasan Sadikin General Hospital Bandung, Indonesia from 9 Oki Suwarsa *, Wulan

More information

The Role of IL-1 and Tumor Necrosis Factor-α in Pathogenesis of Rheumatoid Arthritis

The Role of IL-1 and Tumor Necrosis Factor-α in Pathogenesis of Rheumatoid Arthritis RHEUMATOID THE IRAQI POSTGRADUATE ARTHRITIS MEDICAL JOURNAL The Role of IL-1 and Tumor Necrosis Factor-α in Pathogenesis of Rheumatoid Arthritis Eman Sh.Al-Obeidy*, Shatha F. Abdullah** ABSTRACT: BACKGROUND:

More information

Innate immunity (rapid response) Dendritic cell. Macrophage. Natural killer cell. Complement protein. Neutrophil

Innate immunity (rapid response) Dendritic cell. Macrophage. Natural killer cell. Complement protein. Neutrophil 1 The immune system The immune response The immune system comprises two arms functioning cooperatively to provide a comprehensive protective response: the innate and the adaptive immune system. The innate

More information

The Immune System. These are classified as the Innate and Adaptive Immune Responses. Innate Immunity

The Immune System. These are classified as the Innate and Adaptive Immune Responses. Innate Immunity The Immune System Biological mechanisms that defend an organism must be 1. triggered by a stimulus upon injury or pathogen attack 2. able to counteract the injury or invasion 3. able to recognise foreign

More information

Immune responses in autoimmune diseases

Immune responses in autoimmune diseases Immune responses in autoimmune diseases Erika Jensen-Jarolim Dept. of Pathophysiology Medical University Vienna CCHD Lecture January 24, 2007 Primary immune organs: Bone marrow Thymus Secondary: Lymph

More information