Update on HIV Cure Research

Transcription

1 Update on HIV Cure Research Robert F. Siliciano, MD, PhD Professor of Medicine The Johns Hopkins University School of Medicine Baltimore, Maryland FORMATTED: /7/5 New Orleans, Louisiana: December 5-7, 25 Learning Objectives After attending this presentation, participants will be able to: Describe how the latent reservoir for HIV arises Describe current approaches to curing HIV infection Describe how these approaches will be evaluated clinically Slide 3 of 5 Viral dynamics in patients on antiretroviral drugs Start single antiretroviral drug... v Time on HAART (days) Slide 4 of 5 New Orleans, Louisiana: December 5 7, 25 Page of 7

2 Viral dynamics in patients on antiretroviral drugs Start three antiretroviral drugs... Limit of Detection (5 copies/ml) Below limit of detection Eradication in 2-3 years 2 3 Time on HAART (days) Slide 5 of 5 Physiology of resting and activated CD4 + T cells Slide 6 of 5 Naive Memory Establishment of immunologic memory Slide 7 of 5 Naive Memory New Orleans, Louisiana: December 5 7, 25 Page 2 of 7

3 Naive Memory HIV infection of activated and resting CD4 + T cells HIV HIV HIV Slide 8 of 5 Establishment of the latent reservoir in resting CD4 + T cells Slide 9 of 5 Naive HIV Memory NFκB sites in the HIV LTR U 3 R U 5 Slide of 5 Cell DNA Modulatory region Enhancer Core AP NFAT USF Ets LEF NFκB NFAT Sp TBP LBP Nabel G, et al. Nature. 987;326:7-73. Tong-Starksen SE, et al. PNAS. 987;84:6845:6849. Bohnlein E, et al. Cell. 988;53: Duh EJ, et al. PNAS. 989;86: New Orleans, Louisiana: December 5 7, 25 Page 3 of 7

4 - Reactivation of latent HIV Slide of 5 Naive HIV Memory An assay for latently infected cells 8-2 ml blood Slide 2 of 5 Purified resting CD4 + T cells PHA + irradiated allogeneic PBMC /,, d2: add CD4 + lymphoblasts from HIVdonors d7: add CD4 + lymphoblasts from HIVdonors p24 Chun et al., Nature, 997 Finzi et al., Science, 997 Frequency (per 6 cells) Slow decay of latently infected CD4 + T cells..... Time to eradication > 73.4 years Time on ART (years) Finzi et al., Nature Med., 999 Siliciano et al., Nature Med., 23 Slide 3 of 5 New Orleans, Louisiana: December 5 7, 25 Page 4 of 7

5 Latency results from infection of memory precursor cells Deng et al., submitted Slide 4 of 5... Start Therapy Limit of Detection (5 copies/ml) Residual viremia 2 years Time on HAART (days/years) Hermankova et al, JAMA, 2 Sensitive to current regimen Persaud et al, J Virol, 23 Archival Kieffer et al, J Infect Dis, 24 Non-evolving Nettles et al, JAMA, 25 Bailey et al, J Virol, 26 Brennan et al, J Virol, 29 copy/ml HAART Slide 5 of 5... Start Therapy Limit of Detection (5 copies/ml) Residual viremia cannot be reduced by treatment intensification Residual viremia copy/ml HAART Add 4 th drug 2 years Time on HAART (days/years) Dinoso et al, PNAS, 29 Many later raltegravir intensification studies Slide 6 of 5 New Orleans, Louisiana: December 5 7, 25 Page 5 of 7

6 The first cure Host immune system, including latently infected cells, largely eliminated by condition regimen (chemo + irradiation and by graft vs host disease. Donor cells protected from HIV infection due to absence of CCR5 Slide 7 of 5,, Boston Patient B Below limit of detection Slide 8 of 5,, Matched allogeneic HSCT Stop ART, TDF FTC RAL Time after Rx interruption (months) Henrich et al, JID, 23, The Mississippi baby ART discontinued Slide 9a of 5,, AZT 3TC LPV/r Below limit of detection >2 years Months after Birth Persaud D et al., NEJM 23 New Orleans, Louisiana: December 5 7, 25 Page 6 of 7

7 , The Mississippi baby ART discontinued Slide 9b of 5,, Below limit of detection AZT 3TC These delayed rebound LPV/r cases prove that HIV can persist in a latent form for years and then begin >2 years to replicate Months after Birth Persaud D et al., NEJM 23 Approaches to HIV cure Slide 2 of 5 pathway agonists Gene Rx LRAs (HDACi) Shock and kill Prevent reactivation Induce elite control Fundamental approach to HIV cure pathway agonists LRAs (HDACi) How do we measure the reservoir in eradication trials? How do we identify latency reversing agents? Will cells be eliminated following reversal of latency? Slide 2 of 5 New Orleans, Louisiana: December 5 7, 25 Page 7 of 7

8 Viral outgrowth assay (VOA) DNA PCR Induction of HIV RNA Induction of virion production Assays for latent HIV agonist agonist agonist PCR for proviral DNA Measure intracellular HIV RNA Measure virion release Slide 22 of 5 Infected cell frequency (per 6 ) Assay Cell/tissue,,. Cohort Viral outgrowth Total HIV DNA Resting CD4 PBMC Resting CD4 Chronic Viral outgrowth vs PCR assays Acute Chronic r =.38 p =.28 3x Total HIV Integrated HIV DNA DNA PBMC Resting CD4 Rectal CD4 r =.7 p <. r =.4 p =.3 r =.5 p =.86 Acute Chronic Acute Chronic Acute Chronic Acute Chronic Acute 2 LTR circles PBMC rho =.9 p =.3 Residual viremia Plasma rho =.7 p =.7 Chronic Acute Chronic Acute,, Eriksson et al, PLOS Pathogens, 23. Plasmas HIV RNA (copies/ml) Slide 23 of 5 Resting CD4 + T cells Non-induced proviruses Slide 24 of 5 Non-induced proviruses PHA + irradiated allogeneic PBMC full length, single genome analysis Are they inducible? d2: add CD4 + lymphoblasts from HIVdonors d7: add CD4 + lymphoblasts from HIVdonors p24 Ho et al, Cell, 23 New Orleans, Louisiana: December 5 7, 25 Page 8 of 7

9 Clonal analysis of non-induced proviruses Slide 25 of 5 LTR gag pol vif env nef LTR 9. KB limiting dilution PCR Nested gag PCR to establish clonality Direct sequencing of PCR products No cloning! Ho et al, Cell, 23 Non-induced proviral clones (n=23) Hypermutated 32.4% NH2 N O N TGG Trp O HN O N TAG Stop Ho et al, Cell, 23 Slide 26 of % of non-induced proviruses have lethal G A hypermutation HXB2 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAA Pt 9 clone 3E5..A...A...A...A...A...C...A... Pt 9 clone 3E..AA...A...A.A...A...AA...A...C...AAA... Pt 2 clone 36D2..A...C...A...A...G...A... Pt 2 clone 33C3..A...C...A...A...G...A... Pt 2 clone 33C9..A...C...A...A...G...A... Pt 2 clone 33G..A...A.A...C...A...A...AA... Slide 27 of 5 HXB2 MGARASVLSGGELDRWEKIRLRPGGKK Pt 9 clone 3E5 I...I..E...*... Pt 9 clone 3E IS...I..R...*...Q...K.. Pt 2 clone 36D2 I...Q...*.R...N Pt 2 clone 33C3 I...Q...*.R...N Pt 2 clone 33C9 I...Q...*.R...N Pt 2 clone 33G I...R.Q...*...E.N ATG ATA M I start codon mutation TGG TAA, TAG, TGA Tryptophan stop codon nonsense mutation Ho et al, Cell, 23 New Orleans, Louisiana: December 5 7, 25 Page 9 of 7

10 45.5% of non-induced proviruses have large internal deletions Large internal deletion 45.5% Hypermutated 32.4% NH2 N O N TGG Trp HN O N Ho et al, Cell, 23 O TAG Stop Slide 28 of 5 Non-induced Non-induced proviral proviruses clones (n=23) Nonsense mutations/ INDELS 3.8% Deletion in ψ/ MSD site 6.5% Large internal deletion 45.5%.7% Intact genome Hypermutated 32.4% NH2 N O N TGG Trp HN O N Ho et al, Cell, 23 O TAG Stop Slide 29 of 5 p24 (ng/ml) Replication Replication capacity of of intact intact non- non-induced proviruses. Patient.. Patient NL4-3. Patient 6 Rep-Comp. Intact noninduced. Patient Time post infection (days) Slide 3 of 5 New Orleans, Louisiana: December 5 7, 25 Page of 7

11 Size of latent reservoir Slide 3 of 5 HIV DNA VOA Intact Scale=/ 6 62 fold Ho et al, Cell, 23 Can intact non-induced proviruses be induced? 8-2 ml blood Slide 32 of 5 Purified resting CD4 + T cells PHA + irradiated allogeneic PBMC Recover cells from negative wells d2: add CD4 + lymphoblasts from HIVdonors d7: add CD4 + lymphoblasts from HIVdonors Ho et al, Cell, 23 p24 Can intact non-induced proviruses be induced? Resting CD4 + T cells + PHA+ allo PBMC - 47% 53% PHA+ allo PBMC % 6% PHA+ allo PBMC % 6% Ho et al, Cell, 23 Nina Hosmane Slide 33 of 5 New Orleans, Louisiana: December 5 7, 25 Page of 7

12 Conclusions Defective proviruses accumulate rapidly in acute HIV infection DNA PCR assays widely used for reservoir analysis mainly defect grossly defective proviruses The quantitative viral outgrowth assay remains the best available assay for the latent reservoir Slide 34 of 5 Fundamental approach to HIV cure pathway agonists LRAs (HDACi) How do we measure the reservoir in eradication trials? How do we identify latency reversing agents? Will cells be eliminated following reversal of latency? Slide 35 of 5 Current status of LRA trials Slide 36 of 5 pathway agonists LRAs (HDACi) Numerous LRAs identified in studies with transformed cell lines and primary T cell model systems Few shown to work ex vivo with cells from patients In clinical trials, no reduction in the reservoir yet demonstrated In clinical trials, evidence for increases in cell-associated HIV RNA (Archin et al.) Some evidence for slight transient increases in plasma HIV RNA after LRA treatment (romidepsin, panobinostat, TLR7 agonist) New Orleans, Louisiana: December 5 7, 25 Page 2 of 7

13 Assay for reversal of latency using patient resting CD4 + T cells 5 x 6 resting CD4 + T cells Slide 37 of 5 +Test compound 5 x 6 cells/well LRA Measure intracellular HIV RNA and virion release Positive control agonist Shan et al, J Virol, 23 Laird et al, PLOS Pathogens, 23 Bullen et al., Nature Med, 24 H IV - m R N A fo ld in d u c tio n Induction of HIV RNAs by LRAs. Total RNA polya primers 8 hrs DMSO Control Vo rinostat Ro m id e p sin Panobinostat D isu lfiram JQ Bryo statin- PMA + Ionomycin Bullen et al, Nat Med 24 Slide 38 of 5 Induction of HIV RNAs by combinations of LRAs % of PMA/ionomycin S in g le L R A D is ram J Q Single LRA P a nobinostat Rom id epsin V o rin o sta t B ryostatin - Pro strati + Bryo statin- + Bryostatin- + Disulfiram D is ra m J Q P a n o b in o stat Rom id epsin V o rino stat Panobinostat Romid epsin V o rino stat Laird et al, in preparation Ro Slide 39 of 5 New Orleans, Louisiana: December 5 7, 25 Page 3 of 7

14 Fundamental approach to HIV cure pathway agonists LRAs (HDACi) How do we measure the reservoir in eradication trials? How do we identify latency reversing agents? Will infected cells be eliminated following reversal of latency? Slide 4 of 5 Fate of infected CD4 cells after latency reversal in vivo is unknown Slide 4 of 5 pathway agonists HDACi Residual GFP+ cells (%) HDACi αcd3+αcd Days after reactivation Shan et al, Immunity, 22 Surviving infected cells (%) E:T = : CTL killing of latently infected cells treated with SAHA Normal donor Time of coculture (days) Normal donor 2 Normal donor 3 Elite suppressor Elite suppressor 2 Elite suppressor 3 Shan et al, Immunity, 22 Slide 42 of 5 New Orleans, Louisiana: December 5 7, 25 Page 4 of 7

15 Surviving infected cells (%) E:T = : CTL killing of latently infected cells treated with SAHA Normal donor Time of coculture (days) Normal donor 2 Normal donor 3 Elite suppressor Elite suppressor 2 Elite suppressor 3 HAART patient HAART patient 2 HAART patient 3 HAART patient 4 HAART patient 5 HAART patient 6 Shan et al, Immunity, 22 Slide 43 of 5 CTL escape variants dominate in the latent reservoir of chronic patients Frequency of variants (%) 5 GK9 EV9 SL9 TV9 EI8GLY9 DL9 FK 5 WF9 SL9 TV9 TL9 HA9 PY9 VI9 FK 5 KK9 RK9 SV9 TL9 HA9 GL9 5 KK9 RK9 LY9 SV9 TL9 HA9 GL9 5 RY VL8 TW YL9 QW9 5 LY9 IW9 KF TW QW9 CTL epitopes in HIV- Gag Acute Pt A*2: Chronic Pt 8 A*2: Acute Pt 2 A*3: Chronic Pt 39 A*3: Acute Pt7 B*58: Chronic Pt2 B*57: Documented Escape Diminished Response MutationType Not Determined Deng et al, Nature, 25 Slide 44 of 5 Predicting time to rebound after reservoir reductions Slide 45 of 5 Hill et al, PNAS 24 New Orleans, Louisiana: December 5 7, 25 Page 5 of 7

16 Time to rebound Slide 46 of 5 Log reduction in latent reservoir Boston pt. A Chun et al. Boston pt. B Miss. baby Berlin pt. wk mo 3 mo yr yr Lifetime Time to rebound Hill et al, PNAS 24 Plasma HIV RNA (copies/ml) What will cure look like?,, Therapeutic vaccination, cart, clras (weeks) (years) Time Post Infection Slide 47 of 5 Thanks Slide 48 of 5 Janet Siliciano Ya-Chi Ho Korin Bullen Greg Laird New Orleans, Louisiana: December 5 7, 25 Page 6 of 7

17 Thanks Slide 49 of 5 Kai Deng Liang Shan Collaborators Steve Deeks Richard Flavell Dave Margolis Joel Gallant Joe Cofrancesco Doug Richman Jon Karn Martin Nowak Matt Strain Sarah Palmer Una O Doherty Joe Wong Steve Yukl John Mellors Thanks Funding NIH: Martin Delaney Collaboratories CARE and DARE Howard Hughes Medical Institute Foundation for AIDS Research (amfar): ARCHE Johns Hopkins Center for AIDS Research Bill and Melinda Gates Foundation Slide 5 of 5 New Orleans, Louisiana: December 5 7, 25 Page 7 of 7