For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:

Size: px
Start display at page:

Download "For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:"

Transcription

1 Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x GATC Biotin Forward oligo (100 um) 45 µl ~ Indexed Reverse oligo (100 um) 45 µl ~ For the indexed Y-adaptors, set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 Barcoded Y-adaptor HI (100 um) 20 µl ~ Barcoded Y-adaptor LO (100 um) 20 µl ~ Water 50 ul 50 ul x 96 For both adaptors, heat to 98 o C for 6 min, then ramp down (-0.1 o C / s or slower) to RT. The final concentration of the 5 -GATC internal bridge adaptors is 45 um. The final concentration of Y- adaptors is 20 um Check the annealing efficiency by running oligos on 4% DNA Agarose gel 2. Cell lysis and chromatin digestion with DpnII (10 million cells total) 2.1) Thaw a vial of 2% Formaldehyde-fixed human cells (HeLa S3 / HAP1 / GM12878 / K562) and a vial of 2.5% fixed Patski and 2% fixed MEFs at 37 o C for sec. 2.2) Resuspend in 1 ml of ice-cold cell lysis buffer containing protease inhibitor cocktail (Roche). 2.3) Transfer 2.5E6 of each type of cell to separate tubes. 2.4) Centrifuge for 30 seconds at 800xg at RT. 2.5) Discard the supernatant and resuspend the pellet in each tube in 95 µl of water and 5 µl 10% SDS. 2.6) Incubate at 60 o C for 10 min. 2.7) Add 100 µl of water and 25 µl 10% Triton X-100 to each tube and mix well. 2.8) Incubate at 37 o C for 10 min. 2.9) Add 40 µl NEBuffer 3.1, 8 µl DpnII (10 U/ul) and 120 µl water to each tube, mix well. 2.10) Incubate at 37 o C overnight. 2.11) Centrifuge for 60 seconds at 850xg at RT.

2 2.12) Discard the supernatant and resuspend the pellet in 384 µl water and 6 µl 100X BSA 1 in each tube, mix well. 3. Ligation of the biotin-labeled, barcoded Bridge adaptors (1E5 cells / well, 10 µl reaction volume in at least 1 96 well plate) 3.1) Distribute T4 DNA ligase/buffer to each well of one (or more) 96 well plates (below master mix volumes are for 2 plates, with 3 µl per well), s Per reaction Water 380 (1.4x220) µl 50% PEG (0.5x220) µl 10X T4 DNA Ligase Buffer 220 (1x220) µl T4 DNA ligase (5 U/ µl) 24 (0.15x220) µl 3.2) Distribute 2 ul of biotinylated barcoded double-stranded bridge adaptor (45 µm) to each well of each 96-well plate using a multi-channel pipette. 3.3) Distribute 5 µl nuclei to each well. 3.4) Incubate at 16 o C overnight. 3.5) Distribute 1 µl 0.25 M EDTA to each well to inactivate ligation reaction. 3.6) On ice, pool the samples from each well together (1 ml) into two 1.5ml tubes. 3.7) Centrifuge at 850xg at RT for 90 seconds. 3.8) Resuspend in 291 µl of water, 6 µl 10%SDS, and 3 µl of 100X BSA, and combine the four tubes. 3.9) Centrifuge at 850xg at RT for 40 seconds. 3.10) Resuspend in 294 µl of water, 3 µl 10%SDS, and 3 µl of 100X BSA. 3.11) Incubate at 37 o C for 3 min. 3.12) Centrifuge at 850xg at RT for 40 seconds. 3.13) Resuspend in 294 µl of water, 3 µl 10%SDS, and 3 µl of 100X BSA. 3.14) Centrifuge at 850xg at RT for 40 seconds. 3.15) Resuspend in 237 µl of water, and 3 µl of 100X BSA, mix well. 3.16) Add 5 µl 10% Triton X-100, mix well. 4. Phosphorylation 4.1) Prepare the PNK-ligation master-mix for the nuclei as follows: 1 Stock conc. = 10 mg / ml

3 4.2) Incubate both at 37 o C for 1 hr. 5. In situ ligation 5.1) Add the following to the above tube: Nuclei 250 µl 10x T4 DNA Ligase buffer 30 µl PNK (10 U/ µl) 20 µl Water 615 µl 10x T4 DNA Ligase buffer 70 µl T4 DNA ligase (5 U/ µl) 8 µl 100X BSA 7 µl 5.2) Mix well, and incubate at RT for 4 hr. Divide into two tubes. 5.3) Centrifuge at 850xg at RT for 90 seconds. 5.4) Resuspend in 294 µl of water, 3 µl 10%SDS, and 3 µl of 100x BSA. 5.5) Incubate at 37 o C for 3 min. 5.6) Centrifuge at 850xg at RT for 40 seconds. 5.7) Resuspend in 294 µl of water, 3 µl 10%SDS, and 3 µl of 100x BSA. 5.8) Centrifuge at 850xg at RT for 40 seconds. 5.9) Resuspend in 294 µl of water, 3 µl 10%SDS, and 3 µl of 100x BSA. 6. Serial dilution and reverse cross-linking 6.1) Carry out serial dilution as follows: transfer 5 µl from 5.9) to 980 µl water plus 10 µl 100X BSA and 5 µl 10% SDS, mix well; then transfer 100 µl of diluted nuclei to 885 µl water plus 10 µl 100X BSA and 5 µl 10% SDS and mix well; then transfer 100 µl of diluted nuclei to 885 µl water plus 10 µl 100X BSA and 5 µl 10% SDS, and mix well. There should be ~1 nucleus per 2 µl solution. At last distribute 20 µl per well to a Lo-bind 96- well PCR plate. 6.2) Make the following master mix for reverse crosslinking: 6.3) Distribute 20 µl to each well. Per plate (x110) Water 15.5 µl (1705) 10% SDS 0.5 µl (55) 2X B&W Buffer 2 µl (220) Proteinase K (20 mg / ml) 2 µl (220)

4 6.4) Incubate at 62 o C overnight. Plates can then be stored at -20 o C for later processing. At this point, 8-strip PCR tubes may be used for small-scale assays, and the remaining cells can be processed as a bulk control assay. 7. Binding to 10 ul of Ampure beads (160 µl) 7.1) Dilute 1200 µl Ampure beads with 7 ml AMPure buffer and mix well. 7.2) If the 96-well plate was stored at -20 o C, thaw at 65 o C for 10 min. 7.3) Add 40 µl water to each well. 7.4) Add 80 µl diluted AMPure beads to each well with 12-channel multipipette. Mix well. 7.5) Incubate at RT for 10 min. 7.6) Perform quick spin to bring volume to bottom of each well. 7.7) Place the plate in a 96-well magnet and discard the supernatant with multichannel pipette. 7.8) Wash two times with 160 µl 80% EtOH 7.9) Remove the residue solution. 7.10) Quick spin plate to get the beads to the bottom of each well. 7.11) Resuspend the beads in 5 µl water, mix well by moving the beads around on the magnet. 7.12) Incubate at 37 o C for 10 min. 7.13) Quick spin to get the beads to the bottom of each well cutter digestion (MseI + HaeIII) (10 µl) 8.1) Add 5 ul of the following reaction buffer to each well: Per plate (x110) Water 3.4 µl (374) 10X NEBuffer 2 1 µl (110) MseI (10 U / µl) 0.3 µl (33) HaeIII (10 U / µl) 0.3 µl (33) 8.2) Quickly spin plate to bring volume to bottom of each well. 8.3) Incubate at 37 o C for 20 h, 65 o C for 30 min, and 4 o C forever. 9. End-repair to remove dangling ends (15 µl) 9.1) On ice, add 5 ul of the following reaction mix to each well: Per plate (x110) Water 3.55 µl (391.5) 10X NEBuffer µl (55) 10 mm dntps 0.2 µl (22) Klenow (10 U / µl) 0.15 µl (16.5) Carrier plasmid DNA 2 (220 ng/ul) 0.6 µl (60) 2 We use puc19 as a carrier plasmid.

5 9.2) Quick spin plate. 9.3) Incubate at 18 o C for 10 min, 65 o C for 30 min., and 4 o C forever. 10. da-tailing (20 µl) 10.1) Add 5 ul of da-tailing reaction mix to each well: Per reaction (x110) 10X NEBuffer µl (55) 20 mm datp 1 µl (110) Klenow (exo - ) (5 U/ µl) 0.3 µl (33) Water 3.2 µl (352) 10.2) Quick spin. 10.3) Incubate at 37 o C for 45 min, 65 o C for 30 min., and 4 o C forever. 11. Ligation of sequencing adaptors (20 µl), 96 indexed adaptors 11.1) Add 19 ul ligation mix to each well: Per reaction (x110) Water 10.8 µl (1188) 10X T4 DNA Ligase Buffer 4 µl (440) 50% PEG µl (440) T4 DNA ligase (5 U/ µl) 0.2 µl (22) 11.2) Distribute 1 µl Indexed sequencing adaptor (20 µm) to each well. 11.3) Quick spin. 11.4) Incubate at 16 o C for 20 h, 70 o C for 10 min, and 4 o C forever 12. Purification and Biotin pull down 12.1) Combine each column of wells into ml low-binding tubes. 12.2) Use 100 µl EB to rinse each well and add to each respective tube. 12.3) Add 40 µl 3M NaOAc, 4 µl GlycoBlue, and 500 µl isopropanol to each tube, mix well. 12.4) Incubate tubes at -80 o C for 2 h. 12.5) Spin at max speed on a chilled tabletop centrifuge for 30 min. 12.6) Resuspend and combine all 12 pellets in 100 µl EB. 12.7) Use 100 µl EB to rinse each tube twice (final volume 300 ul EB). 12.8) Add 100 µl AMPure Beads and 200 µl AMPure buffer. 12.9) Incubate at RT for 5 min ) Wash two times with 80% EtOH ) Resuspend in 100 µl water in each tube ) Bind to 10 µl M-280 Beads in 200 µl 1X B&W buffer 12.13) Incubate at RT for 20 min ) Wash 4 times with 200 µl 1X B&W buffer containing 0.1% Tween ) Wash twice with 200 µl EB.

6 12.16) Resuspend in 30 µl EB in each tube. 13. Library amplification (80 µl) 13.1) Carry out 3 PCR reactions with the following reaction composition: 13.2) Carry out PCR amplification: Water 22 µl 2X KAPA Hi-Fi Master Mix 40 µl Illumina F (10 um) 4 µl Barcoded Illumina R (10 um) 4 µl Beads 10 µl 98 o C, 2 min; 4 cycles: 98 o C, 20s; 60 o C, 30s; 72 o C, 45 sec cycles: 98 o C, 20s; 65 o C, 20s; 72 o C, 40 sec 13.3) Pool together all samples from each PCR reaction. 13.4) Add 30 µl AMPure beads and a volume of AMPure buffer necessary to achieve a 1:1 volumetric ratio of AMPure buffer + beads to sample. 13.5) Incubate 5 min at RT, and wash once with 0.6 ml 80% EtOH. 13.6) Resuspend in 200 µl water, add 155 µl AMPure buffer, mix well. 13.7) Incubate 5 min at RT, wash twice with 0.8 ml 80% EtOH. 13.8) Repeat three times. 13.9) After final purification, elute DNA with 30 µl EB and measure concentration using a Qubit ) Proceed to sequencing on a HiSeq 2500 instrument (PE 2x250 bp reads). 14. Library validation by EcoRI digestion (optional) 14.1) Digest a small aliquot of the final combinatorial single cell Hi-C library with EcoRI to estimate the portion of molecules with valid ligated junctions Experimental Control 10X Cutsmart Buffer 1µl 1µl PCR Product 1-2 µl (20 ng) 1-2 µl (20 ng) EcoRI-HF 1 µl 0 µl Water to 10 µl to 10 µl 14.2) Incubate at 37 o C for 1 hr. 14.3) Run the entire volume of the reaction on a 6% TBE-PAGE gel. Digested libraries should demonstrate a marked shift, as properly ligated molecules will be cut with EcoRI.

7 Buffers and Materials Primers For barcodes used for cellular indexing see Supplementary File 1 Illumina F: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Barcoded Illumina R: CAAGCAGAAGACGGCATACGAGAT[10 bp barcode]tgactggagttcagacgtgtgct Buffers 1X Cell Lysis buffer 10 mm Tris-HCl ph mm NaCl 0.2% Igepal CA-630 (NP-40) Autoclaved water --- Store at 4 C AMPure Buffer 20% PEG M NaCl --- Store at 4 C 2X B&W buffer 10 mm Tris-HCl ph8.0 1 mm EDTA 2 M NaCl -- Store at RT

Antibodies: LB1 buffer For 50 ml For 10ml For 30 ml Final 1 M HEPES, ph 2.5 ml 0.5 ml 1.5 ml 50mM. 5 M NaCl 1.4 ml 280 µl 0.

Antibodies: LB1 buffer For 50 ml For 10ml For 30 ml Final 1 M HEPES, ph 2.5 ml 0.5 ml 1.5 ml 50mM. 5 M NaCl 1.4 ml 280 µl 0. Experiment: Date: Tissue: Purpose: ChIP-Seq Antibodies: 11x cross-link buffer: Regent Stock Solution Final Vol for 10 ml of 11xstock concentration 5 M NaCl 0.1M 0.2 ml 0.5 M EDTA 1 mm 20 ul 0.5 M EGTA,

More information

Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab)

Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab) Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab) Updated 12/3/02 Reagents: ChIP sonication Buffer (1% Triton X-100, 0.1% Deoxycholate, 50 mm Tris 8.1, 150 mm NaCl, 5 mm EDTA): 10 ml 10 % Triton

More information

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:

More information

Trident Membrane Protein Extraction Kit

Trident Membrane Protein Extraction Kit Cat. No. Size Shelf life GTX16373 5/ 20 tests 12 months at the appropriate storage temperatures (see below) Contents Component Storage Amount for 5 tests Amount for 20 tests Buffer A -20 o C 2.5 ml 10

More information

Protocol for purification of recombinant protein from 300 ml yeast culture

Protocol for purification of recombinant protein from 300 ml yeast culture Protocol for purification of recombinant protein from 300 ml yeast culture Equipment and reagents needed: Zirconia beads (0.5 mm diameter from BSP, Germany) Paint Shaker (at 4 C) Tube rotator for 15 ml

More information

End of the Note Book

End of the Note Book End of the Note Book 16 September 2016 Colonies PCR Mix (25 µl total volume reaction): + clones - 12.5 µl DreamTaq PCR Mastermix 2X (ThermoScientific) - 2.5 µl 10X DreamTaq Green Buffer (ThermoScientific)

More information

The following protocol describes the isolation of nuclei from tissue. Item. Catalog No Manufacturer

The following protocol describes the isolation of nuclei from tissue. Item. Catalog No Manufacturer SOP: Nuclei isolation from tissue and DNaseI treatment Date modified: 090923 Modified by: P. Sabo. (UW) The following protocol describes the isolation of nuclei from tissue. Ordering Information Item.

More information

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array

More information

Supplementary Figure 1. Method development.

Supplementary Figure 1. Method development. Supplementary Figure 1 Method development. Titration experiments to determine standard antibody:lysate concentration. Lysates (~2 mg of total proteins) were prepared from cells expressing FLAG- tagged

More information

PREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS

PREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS TMM,5-2011 PREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS Ice-cold means cooled in ice water. In order to prevent proteolysis, make sure to perform all steps on ice. Pre-cool glass homogenizers, buffers

More information

Transfection of Sf9 cells with recombinant Bacmid DNA

Transfection of Sf9 cells with recombinant Bacmid DNA Transposition Bacmid DNA Mini Culturing baculo cells Transfection of Sf9 cells with recombinant Bacmid DNA Amplification of the virus Titration of baculo stocks Testing the expression Transposition 1.

More information

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr)

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences

More information

Midi Plant Genomic DNA Purification Kit

Midi Plant Genomic DNA Purification Kit Midi Plant Genomic DNA Purification Kit Cat #:DP022MD/ DP022MD-50 Size:10/50 reactions Store at RT For research use only 1 Description: The Midi Plant Genomic DNA Purification Kit provides a rapid, simple

More information

Western Immunoblotting Preparation of Samples:

Western Immunoblotting Preparation of Samples: Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells

More information

Interlab Study - Cloning and measuring of GFP and RFP

Interlab Study - Cloning and measuring of GFP and RFP Interlab Study - Cloning and measuring of GFP and RFP The following constructs are build for further GFP and RFP measurement: I2020 GFP construct 0 K823005 + E0240 GFP construct I K823012 + E0240 GFP construct

More information

Concentration Estimation from Flow Cytometry Exosome Data Protocol

Concentration Estimation from Flow Cytometry Exosome Data Protocol Concentration Estimation from Flow Cytometry Exosome Data Protocol 1. STANDARD CURVE Create a standard curve for the target exosome by plotting the mean fluorescence (y axis) against the protein concentration

More information

Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5)

Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5) Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit Catalog number: SM-005 Description Minute TM plasma membrane (PM) protein isolation kit is a novel and patented native PM protein

More information

Virus Harvest AAV 15 cm 2

Virus Harvest AAV 15 cm 2 Virus Harvest AAV 15 cm 2 1) Gently scrape cells from plate in 10 ml of media, place remaining 10 ml of media in plate lid. 2) Once cells are removed from plate, wash plate by pipetting 20 ml of media

More information

EXO-DNAc Circulating and EV-associated DNA extraction kit

EXO-DNAc Circulating and EV-associated DNA extraction kit Datasheet EXO-DNAc Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.

More information

Plasma Membrane Protein Extraction Kit

Plasma Membrane Protein Extraction Kit ab65400 Plasma Membrane Protein Extraction Kit Instructions for Use For the rapid and sensitive extraction and purification of Plasma Membrane proteins from cultured cells and tissue samples. This product

More information

Mitochondrial DNA Isolation Kit

Mitochondrial DNA Isolation Kit Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

Nuclear Extraction Kit

Nuclear Extraction Kit Nuclear Extraction Kit Catalog Number KA1346 50 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay... 3 General Information... 4

More information

EXO-DNA Circulating and EV-associated DNA extraction kit

EXO-DNA Circulating and EV-associated DNA extraction kit Datasheet EXO-DNA Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.

More information

SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric*

SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* Catalog # 72146 Kit Size 500 Assays (96-well plate) Optimized Performance: This kit is optimized to detect alkaline phosphatase activity Enhanced

More information

Europium Labeling Kit

Europium Labeling Kit Europium Labeling Kit Catalog Number KA2096 100ug *1 Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...

More information

Hepatitis B Virus Genemer

Hepatitis B Virus Genemer Product Manual Hepatitis B Virus Genemer Primer Pair for amplification of HBV Viral Specific Fragment Catalog No.: 60-2007-10 Store at 20 o C For research use only. Not for use in diagnostic procedures

More information

Recipes for Media and Solution Preparation SC-ura/Glucose Agar Dishes (20mL/dish, enough for 8 clones)

Recipes for Media and Solution Preparation SC-ura/Glucose Agar Dishes (20mL/dish, enough for 8 clones) Protocol: 300 ml Yeast culture preparation Equipment and Reagents needed: Autoclaved toothpicks Shaker Incubator set at 30 C Incubator set at 30 C 60 mm 2 sterile petri dishes Autoclaved glass test tubes

More information

XTRAKT FFPE Kit / Manual

XTRAKT FFPE Kit / Manual XTRAKT FFPE Kit / Manual For manual extraction of RNA, mirna and/or DNA from Formalin Fixed Paraffin Embedded (FFPE) tissue samples Catalog No. # XTK2.0-96 For research use only. Not intended for diagnostic

More information

Mammalian Membrane Protein Extraction Kit

Mammalian Membrane Protein Extraction Kit Mammalian Membrane Protein Extraction Kit Catalog number: AR0155 Boster s Mammalian Membrane Protein Extraction Kit is a simple, rapid and reproducible method to prepare cellular protein fractions highly

More information

KAPA Stranded RNA-Seq Library Preparation Kit

KAPA Stranded RNA-Seq Library Preparation Kit KAPA Stranded RNA-Seq Illumina platforms KR0934 v1.13 This provides product information and a detailed protocol for the KAPA Stranded RNA- Seq (Illumina platforms), product codes KK8400 and KK8401. Contents

More information

Note: During 30 minute incubation; proceed thru appropriate sections below (e.g. sections II, III and V).

Note: During 30 minute incubation; proceed thru appropriate sections below (e.g. sections II, III and V). LEGEND MAX β Amyloid x 40 LEGEND MAX β Amyloid x 40 ELISA Kit Components and Protocol Kit Components Capture Antibody Coated Plate 1 stripwell plate 1 40 Standard (2) 20μg vial 5X Wash Buffer 125mL Standard

More information

ab Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric)

ab Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric) ab156064 Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric) Instructions for Use For the quantitative measurement of Histone Deacetylase activity in cell lysates This product is for research

More information

Whole Mount Drosophila Embryo In Situ Hybridization with RNA probes 2/5/2001 Leslie Vosshall

Whole Mount Drosophila Embryo In Situ Hybridization with RNA probes 2/5/2001 Leslie Vosshall Whole Mount Drosophila Embryo In Situ Hybridization with RNA probes 2/5/2001 Leslie Vosshall DAY ONE All incubations are done at room temperature unless otherwise noted. All solutions and all containers

More information

Optimization of a LanthaScreen Kinase assay for NTRK1 (TRKA)

Optimization of a LanthaScreen Kinase assay for NTRK1 (TRKA) Optimization of a LanthaScreen Kinase assay for NTRK1 (TRKA) Overview This protocol describes how to develop a LanthaScreen kinase assay designed to detect and characterize kinase inhibitors. The development

More information

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley

More information

FOCUS SubCell. For the Enrichment of Subcellular Fractions. (Cat. # ) think proteins! think G-Biosciences

FOCUS SubCell. For the Enrichment of Subcellular Fractions. (Cat. # ) think proteins! think G-Biosciences 169PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name FOCUS SubCell For the Enrichment of Subcellular Fractions (Cat. # 786 260) think

More information

Caspase-3 Assay Cat. No. 8228, 100 tests. Introduction

Caspase-3 Assay Cat. No. 8228, 100 tests. Introduction Introduction Caspase-3 Assay Cat. No. 8228, 100 tests Caspase-3 is a member of caspases that plays a key role in mediating apoptosis, or programmed cell death. Upon activation, it cleaves a variety of

More information

Large Scale Infection for Pooled Screens of shrna libraries

Large Scale Infection for Pooled Screens of shrna libraries Last modified 01/11/09 Large Scale Infection for Pooled Screens of shrna libraries Biao Luo, Glenn Cowley, Michael Okamoto, Tanaz Sharifnia This protocol can be further optimized if cells being used are

More information

E.Z.N.A. SQ Blood DNA Kit II. Table of Contents

E.Z.N.A. SQ Blood DNA Kit II. Table of Contents E.Z.N.A. SQ Blood DNA Kit II Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Blood Storage and DNA Yield...4 Preparing Reagents...5 100-500 μl Whole Blood Protocol...6

More information

Striatal Neuron Medium Kit

Striatal Neuron Medium Kit Striatal Neuron Medium Kit Product Information What are included in the Striatal Neuron Medium Kit (ax0333): 2x 250 ml Striatal Neuron Basal Medium (Store at 4 o C upon receipt) 2x 7.5 ml Striatal Neuron

More information

Primary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham

Primary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham Primary Adult Naïve CD4+ CD45RA+ Cells Prepared by: David Randolph (drdrdr@uab.edu) at University of Alabama, Birmingham Goal: To obtain large numbers of highly pure primary CD4+ CD45RO- CD25- cells from

More information

EXPERIMENT 26: Detection of DNA-binding Proteins using an Electrophoretic Mobility Shift Assay Gel shift

EXPERIMENT 26: Detection of DNA-binding Proteins using an Electrophoretic Mobility Shift Assay Gel shift EXPERIMENT 26: Detection of DNA-binding Proteins using an Electrophoretic Mobility Shift Assay Gel shift Remember to use sterile conditions (tips, tubes, etc.) throughout this experiment Day 1: Biotinylation

More information

In-Solution Digestion for proteomics

In-Solution Digestion for proteomics In-Solution Digestion for proteomics Guidelines for sample preparation (How to protect your samples from contamination with keratin) 1. Try to avoid any contact of samples and solutions with dust, skin

More information

Nuclear Extraction Kit

Nuclear Extraction Kit Nuclear Extraction Kit Item No. 10009277 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION 3 Materials

More information

Human IL-2. Pre-Coated ELISA Kit

Human IL-2. Pre-Coated ELISA Kit Human IL-2 (Interleukin 2) Pre-Coated ELISA Kit Catalog No: 90-2083 1 96 well Format (96 tests) Detection Range: 31.2 2000 pg/ml Sensitivity: < 18.75 pg/ml This immunoassay kit allows for the in vitro

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-cfDNA Serum & Plasma Kit Catalog No. D4076 Highlights High-quality DNA, including cell-free, is easily and robustly purified from up to 10 ml of serum/plasma, up to 1 ml amniotic

More information

igem2013 Microbiology BMB SDU

igem2013 Microbiology BMB SDU igem2013 Microbiology BMB SDU Project type: Creation of Biobrick with Prenyltransferase Project title: Biobrick_Prenyltransferase Sub project: Creation date: 13.08.09 Written by: SIS Performed by: PRA,

More information

AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT

AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT MoBiTec GmbH 2014 Page 2 Contents 1. Description... 3 2. Kit Contents... 3 3. Terms & Conditions... 3 4. AquaPreserve

More information

Rapid antigen-specific T cell enrichment (Rapid ARTE)

Rapid antigen-specific T cell enrichment (Rapid ARTE) Direct ex vivo characterization of human antigen-specific CD154+CD4+ T cell Rapid antigen-specific T cell enrichment (Rapid ARTE) Introduction Workflow Antigen (ag)-specific T cells play a central role

More information

Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples:

Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Dr. Sanjeeva Srivastava IIT Bombay Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Sample preparation for serum proteome analysis Sample

More information

Gladstone Institutes, University of California (UCSF), San Francisco, USA

Gladstone Institutes, University of California (UCSF), San Francisco, USA Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of

More information

Protein Dephosphorylation Methods

Protein Dephosphorylation Methods Protein Dephosphorylation Methods Phosphospecific antibodies are designed to differentiate between the phosphorylated and the non-phosphorylated states of a protein. The method to determine if or how well

More information

PRODUCT INFORMATION & MANUAL

PRODUCT INFORMATION & MANUAL PRODUCT INFORMATION & MANUAL Mitochondrial Extraction Kit NBP2-29448 Research use only. Not for diagnostic or therapeutic procedures www.novusbio.com P: 303.760.1950 P: 888.506.6887 F: 303.730.1966 technical@novusbio.com

More information

Data Sheet. PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002

Data Sheet. PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002 Data Sheet PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002 DESCRIPTION: The PCSK9[Biotinylated]-LDLR Binding Assay Kit is designed for screening and profiling purposes. PCSK9 is known to function

More information

Roche Molecular Biochemicals Application Note No. HP 1/1999

Roche Molecular Biochemicals Application Note No. HP 1/1999 Roche Molecular Biochemicals Application Note No. HP 1/1999 Nucleic Acid Purification High Pure Viral Nucleic Acid Kit High Pure 16 System Viral Nucleic Acid Kit Efficiency of Hepatitis C Virus sample

More information

PRODUCT INFORMATION & MANUAL

PRODUCT INFORMATION & MANUAL PRODUCT INFORMATION & MANUAL 0.4 micron for Overall Exosome Isolation (Cell Media) NBP2-49826 For research use only. Not for diagnostic or therapeutic procedures. www.novusbio.com - P: 303.730.1950 - P:

More information

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley

More information

1.1. Gelatinizing Plates Prepare plates by covering surface with 0.1% Gelatin solution:

1.1. Gelatinizing Plates Prepare plates by covering surface with 0.1% Gelatin solution: 1. Preparation of Feeder Layers And SNL Stocks 1.1. Gelatinizing Plates Prepare plates by covering surface with 0.1% Gelatin solution: Plate Size (cm) 3 2 6 4 10 9 15 18 Amount of Gelatin (ml) Swirl the

More information

ABIOpure TM Viral (version 2.0)

ABIOpure TM Viral (version 2.0) ABIOpure TM Viral (version 2.0) DNA/RNA Extraction Handbook Cat No: M561VT50 FOR RESEARCH USE ONLY Table of Contents Contents Page Kit Components 3 Precautions 3 Stability & Storage 4 General Description

More information

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Optimization of a LanthaScreen Kinase assay for ZAP70

Optimization of a LanthaScreen Kinase assay for ZAP70 Optimization of a LanthaScreen Kinase assay for ZAP70 Overview This protocol describes how to develop a LanthaScreen kinase assay designed to detect and characterize kinase inhibitors. The development

More information

Protocol for Gene Transfection & Western Blotting

Protocol for Gene Transfection & Western Blotting The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation

More information

INSTRUCTION MANUAL. RNA Clean & Concentrator -5 Catalog Nos. R1015 & R1016. Highlights. Contents

INSTRUCTION MANUAL. RNA Clean & Concentrator -5 Catalog Nos. R1015 & R1016. Highlights. Contents INSTRUCTION MANUAL Catalog Nos. R1015 & R1016 Highlights Quick (5 minute) method for cleaning and concentrating RNA. Ideal for purification of RNA from aqueous phase following an acid phenol extraction.

More information

PRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature

PRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature PRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature PRODUCT DESCRIPTION. RNAzol BD is a reagent for isolation of total RNA from whole blood, plasma or serum of human

More information

EPIGENTEK. EpiQuik Total Histone Extraction Kit. Base Catalog # OP-0006 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Total Histone Extraction Kit. Base Catalog # OP-0006 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Total Histone Extraction Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiQuik Total Histone Extraction Kit is suitable for a quick preparation of total histone extracts

More information

RayBio Human Phosphotyrosine BTK ELISA Kit

RayBio Human Phosphotyrosine BTK ELISA Kit RayBio Human Phosphotyrosine BTK ELISA Kit Catalog #: PEL-BTK-Y User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-RNA Miniprep Kit Catalog Nos. R1054 & R1055 Highlights High-quality total RNA (including small RNAs) from a wide range of samples. You can opt to isolate small and large RNAs in

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-RNA Miniprep Kit Catalog Nos. R1054 & R1055 Highlights High-quality total RNA (including small RNAs) from a wide range of samples. You can opt to isolate small and large RNAs in

More information

RayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit

RayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit RayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit Catalog #: PEL-NFKBP65-S536-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-DNA/RNA Pathogen Miniprep Catalog Nos. R1042 & R1043 Highlights Spin-column purification of pathogen (virus, bacteria, protozoa) DNA/RNA from a wide variety of vectors (mosquitoes,

More information

Supplementary material: Materials and suppliers

Supplementary material: Materials and suppliers Supplementary material: Materials and suppliers Electrophoresis consumables including tris-glycine, acrylamide, SDS buffer and Coomassie Brilliant Blue G-2 dye (CBB) were purchased from Ameresco (Solon,

More information

Instructions. Fuse-It-mRNA easy. Shipping and Storage. Overview. Kit Contents. Specifications. Note: Important Guidelines

Instructions. Fuse-It-mRNA easy. Shipping and Storage. Overview. Kit Contents. Specifications. Note: Important Guidelines Membrane fusion is a highly efficient method for transfecting various molecules and particles into mammalian cells, even into sensitive and primary cells. The Fuse-It reagents are cargo-specific liposomal

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

Pandemic Preparedness Team Immunology and Pathogenesis Branch Influenza Division Centers for Disease Control and Prevention USA VERSION 1

Pandemic Preparedness Team Immunology and Pathogenesis Branch Influenza Division Centers for Disease Control and Prevention USA VERSION 1 MODIFIED HEMAGGLUTINATION INHIBITION (HI) ASSAY USING HORSE RBCS FOR SEROLOGIC DETECTION OF ANTIBODIES TO H7 SUBTYPE AVIAN INFLUENZA VIRUS IN HUMAN SERA Pandemic Preparedness Team Immunology and Pathogenesis

More information

MATERIALS. Peptide stimulation and Intracellular Cytokine Staining- EFFECTOR 45RA PANEL

MATERIALS. Peptide stimulation and Intracellular Cytokine Staining- EFFECTOR 45RA PANEL v Peptide stimulation and Intracellular Cytokine Staining- EFFECTOR 45RA PANEL Authors S. Kutscher, A. Cosma, MATERIALS REAGENTS: - PBMCs - Culture medium - Costimulating antibodies - Peptide pools including

More information

PicoProbe Acetyl CoA Assay Kit

PicoProbe Acetyl CoA Assay Kit ab87546 PicoProbe Acetyl CoA Assay Kit Instructions for Use For the rapid, sensitive and accurate measurement of Acetyl CoA levels in various samples. This product is for research use only and is not intended

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-cfDNA/cfRNA Serum & Plasma Kit Catalog No. R1072 Highlights High-quality cell-free DNA and RNA are easily and robustly purified from up to 3 ml of plasma, serum, or other biological

More information

Glucose Uptake Colorimetric Assay Kit

Glucose Uptake Colorimetric Assay Kit ab136955 Glucose Uptake Colorimetric Assay Kit Instructions for Use For the sensitive and accurate measurement of Glucose uptake in various samples This product is for research use only and is not intended

More information

Peptide stimulation and Intracellular Cytokine Staining

Peptide stimulation and Intracellular Cytokine Staining v Peptide stimulation and Intracellular Cytokine Staining Authors A. Cosma, S. Allgayer MATERIALS Date 01-02-2007 REAGENTS: Version 1.0 - PBMCs - Culture medium - Costimulating antibodies - Peptide pools

More information

BILAYER CHANNEL RECONSTITUTION

BILAYER CHANNEL RECONSTITUTION (1) 1% Agar Salt Bridge 1.0 g Agar 3.75g KCl in 100ml distilled water, store at 4 o C. BILAYER CHANNEL RECONSTITUTION (2) Cs solution: (Cesium Methanesulfonate) 1) 50 mm Cs + solution 0.209 MOPS, 10mM

More information

Sputum DNA Collection, Preservation and Isolation Kit 50 Individual Devices

Sputum DNA Collection, Preservation and Isolation Kit 50 Individual Devices 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Sputum DNA Collection, Preservation and Isolation Kit 50 Individual

More information

HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates

HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates Department of Microbiology, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, USA

More information

Human Alpha 1 microglobulin ELISA Kit

Human Alpha 1 microglobulin ELISA Kit Human Alpha 1 microglobulin ELISA Kit Catalogue No.: EH4144 Size: 48T/96T Reactivity: Human Range:0.625-40ng/ml Sensitivity:

More information

2-Deoxyglucose Assay Kit (Colorimetric)

2-Deoxyglucose Assay Kit (Colorimetric) 2-Deoxyglucose Assay Kit (Colorimetric) Catalog Number KA3753 100 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

Retro-X qrt-pcr Titration Kit User Manual

Retro-X qrt-pcr Titration Kit User Manual Takara Bio USA Retro-X qrt-pcr Titration Kit User Manual Cat. No. 631453 PT3952-1 (030218) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United States/Canada

More information

ab Glucose Uptake Assay Kit (colorimetric) 1

ab Glucose Uptake Assay Kit (colorimetric) 1 Version 16 Last updated 10 January 2018 ab136955 Glucose Uptake Assay Kit (Colorimetric) For the measurement of Glucose uptake in a variety of cells. This product is for research use only and is not intended

More information

ASSAY OF SPHINGOMYELINASE ACTIVITY

ASSAY OF SPHINGOMYELINASE ACTIVITY ASSAY OF SPHINGOMYELINASE ACTIVITY Protocol for Protein Extraction Stock Solution 1. Leupeptin/hydrochloride (FW 463.0,

More information

Human Apolipoprotein A1 EIA Kit

Human Apolipoprotein A1 EIA Kit A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent

More information

Protocol. G-LISA Rac1 Activation Assay Biochem Kit : 24 Assays (Absorbance Based) Cat. # BK128-S. cytoskeleton.com. Cytoskeleton, Inc.

Protocol. G-LISA Rac1 Activation Assay Biochem Kit : 24 Assays (Absorbance Based) Cat. # BK128-S. cytoskeleton.com. Cytoskeleton, Inc. The Protein Experts Protocol Cytoskeleton, Inc. V 8.1 G-LISA Rac1 Activation Assay Biochem Kit : 24 Assays (Absorbance Based) Cat. # BK128-S cytoskeleton.com Phone: (303) 322.2254 Fax: (303) 322.2257 Customer

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-DNA/RNA Viral MagBead Catalog Nos. R2140 & R2141 Highlights High-throughput, magnetic-bead based purification of viral DNA and RNA from plasma, serum, urine, cell culture media,

More information

AMPK Assay. Require: Sigma (1L, $18.30) A4206 Aluminum foil

AMPK Assay. Require: Sigma (1L, $18.30) A4206 Aluminum foil AMPK Assay Require: Acetone Sigma (1L, $18.30) A4206 Aluminum foil Ammonium sulfate Fisher BP212R-1 AMP Sigma A1752 ATP Sigma A6144 (alt. use A7699) Beta-mercaptoethanol Sigma M6250 (alt. use M7154) Bio-Rad

More information