Temporal patterns of feline immunodeficiency virus transcripts in peripheral blood cells during the latent stage of infection

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Temporal patterns of feline immunodeficiency virus transcripts in peripheral blood cells during the latent stage of infection"

Transcription

1 Journal of General Virology (1995), 76, Printed in Great Britain 2193 Temporal patterns of feline immunodeficiency virus transcripts in peripheral blood cells during the latent stage of infection Keizo Tomonaga,t Yasuo Inoshima, Yasuhiro Ikeda and Takeshi Mikami* Department of Veterinary Microbiology, Faculty of Agriculture, The University of Tokyo, Yayoi, Bunkyo-ku, Tokyo 113, Japan We have investigated the in vivo state of feline immunodefciency virus (FIV) transcription in peripheral blood mononuclear cells (PBMC) of chronically FIV-infected, asymptomatic cats. FIV was detected in a high percentage of PBMC but not in the plasma of these cats. By quantitative reverse transcription-pcr (RT-PCR) analysis, FIV transcriptional status in the PBMC was characterized by extremely low or undetectable levels of unspliced or singly spliced mrnas and predominantly multiply spliced mrnas. Upon stimulation in vitro, however, the larger mrna species and infectious virus production were rapidly induced in the PBMC. Fur- thermore, we demonstrated that viral production was induced in association with differential increases in the levels of each multiply spliced mrna coding for FIV regulatory proteins. From these results, we suggest that replication of FIV is blocked at an early stage of gene expression in vivo, as described in asymptomatic human immunodeficiency virus (HIV) -infected patients, and that FIV infection in cats may be a useful model for clinical latency of HIV infection in man. Moreover, we propose that the replication of FIV in vivo may be controlled by the differential expression of each multiply spliced mrna. Introduction The hallmarks of lentivirus infection are persistent and latent infection in the natural host. Despite significant advances in the study of lentivirus infections, our present knowledge of the pathogenic mechanisms involved remains incomplete. However, a better characterization of virus latency is likely to be the key to understanding virus pathogenesis. Primary infection with human immunodeficiency virus type 1 (HIV-1) is usually followed by a long period, lasting up to several years, of clinical latency associated with low or undetectable levels of virus replication in peripheral blood mononuclear cells (PBMC) (Coombs et al., 1989; Fauci, 1988; Ho et al., 1989). Recently, the molecular basis of cellular latency of HIV- 1 has become clearer (Bednarik & Folks, 1992; Pomerantz et al., 1992a). In the PBMC from asymptomatic HIV-1- infected individuals, it has been observed that viral replication is blocked at an early stage of gene expression, and the expression of the spliced transcripts that encode viral regulatory proteins predominates over unspliced * Author for correspondence. Fax t Present address: Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111, USA. genomic transcripts (Arens et al., 1993; Gupta et al., 1993; Schnittman et al., 1991; Seshamma et al., 1992). On progression to AIDS, however, expression of unspliced transcripts in PBMC is enhanced (Gupta et al., 1993; Michael et al., 1992; Saksela et al., 1994). These findings in vivo reflect those obtained with in vitro models of HIV-1 latency, which show a preponderance of multiply spliced over unspliced transcripts (Michael et al., 1991; Pomerantz et al., 1990, 1992b). Thus, it is considered that this 'blocked early-stage latency' in the PBMC and cell lines may be due to low levels of transcription and low levels of the virus-encoded regulatory proteins, Rev and Tat, which are required for the accumulation of unspliced viral RNA and for the elongation of transcripts, respectively (Cullen & Greene, 1989). Feline immunodeficiency virus (FIV) also belongs to the lentivirus genus of retroviruses, and the morphology, protein composition, and Mg 2+ dependency of the reverse transcriptase (RT) are similar to those of other members of the lentiviruses including HIV-1 (Pedersen et al., 1987; Yamamoto et al., 1988). FIV has a tropism for the CD4 + and CD8 + subsets of T cells, macrophages, immunoglobulin-positive cells, and other cells in vivo and in vitro (Brown et al., 1991; Brunner & Pedersen, 1989; English et al., 1993; Kawaguchi et al., 1992; Toyosaki et al., 1993). FIV also causes a slowly progressive multiorgan disease in infected cats and shows considerable patho SGM

2 2194 K. Tomonaga and others genic similarities to HIV-1 (Ishida et al., 1989; Pedersen et al., 1987; Yamamoto et al., 1988). It is, therefore, considered to be a useful small animal model of HIV-1 infection in man. As with HIV infection in man, FIV infection in cats results in a transient viraemia followed by an extended period with low or undetectable levels of cell-free virus in plasma (Matteucci et al., 1993; Meers et al., 1992). Cats also develop FIV-specific neutralizing antibodies (Baldinotti et al., 1994; Hohdatsu et al., 1993; Yamamoto et al., 1991, 1993) and cytotoxic T cells (Flynn et al., 1994; Song et ai., 1992). Despite these immunological responses, persistent viral infection occurs, and infectious virus can generally be isolated from cat PBMC at any time during infection (Matteucci et al., 1993; Meers et ai., 1992; Miyazawa et al., 1989a). In all stages of FIV infection, even in the long term, chronically infected period, numerous cells harbouring FIV provirus can be detected in the PBMC (Lawson et al., 1993; Meers et al., 1992; Rimstad & Ueland, 1992). However, the replication status of FIV in chronically infected cats has not previously been studied in detail. Furthermore, at the outset of this study it was still unknown whether the FIV provirus is transcriptionally active or quiescent in the peripheral blood cells harbouring FIV provirus. In this study, we examined the temporal expression pattern of FIV transcripts in PBMC from chronically FIV-infected, asymptomatic cats by a quantitative RT PCR method. This study revealed that the expression of multiply spliced mrnas predominated over unspliced and singly spliced mrnas in the PBMC. However, stimulation of the PBMC in vitro induced readily detectable expression of unspliced and singly spliced mrnas in association with differential increases of each multiply spliced mrna. Our results indicate that the FIV provirus found in PBMC is transcriptionally competent but partially expressed in vivo. Moreover, it appears that the differential increase in each multiply spliced mrna may play an important role in the activation of virus from latent infection in vivo. Methods FIV injection of cats. PBMC were taken from two experimentally infected specific-pathogen-free (SPF) cats (C-103 and C-104) with established infection and from one uninfected SPF cat (C-112). Cats C- 103 and C-104 were infected intraperitoneally 6.5 years ago with 0.5 ml of peripheral blood from cats infected with FIV strains TM 1 and TM2, respectively. A more detailed description of the infection and follow-up of these cats in the early stages of infection was given in Miyazawa et al. (1989a). At the time of blood sampling in the present study, these FIV-infected cats were still seropositive but clinically healthy and showed no clinical signs of feline AIDS-related complex. In addition to these experimentally infected cats, PBMC were obtained from nine naturally FIV-infected cats that were positive for FIV antibody and negative for feline leukaemia virus antigen when tested using a commercial kit (Cite Combo FIV-FeLV; Agritech Systems) and used for RT-PCR analysis. Sample collection and preparation. Peripheral blood was obtained by venipuncture. PBMC were purified immediately after blood withdrawal using Ficoll-Hypaque density gradient centrifugation as described previously (Miyazawa et al, 1989 b), washed twice with cold PBS, and either stored as a frozen pellet until analysed or resuspended in RPMI 1640 with 10% fetal calf serum plus antibiotics when used for in vitro activation studies. For in vitro activation of the PBMC, phytohaemagglutinin (PHA; Sigma) or concanavalin A (ConA; Pharmacia) were added to the RPMI 1640-cultured PBMC, and at an appropriate time afterwards, the cells were collected, washed twice with cold PBS, and stored as a frozen pellet. Virus isolation from cat plasma. Heparinized blood was obtained from FIV-infected cats, centrifuged twice at 3000 g for 10 min, and the cell-free plasma supernatants were removed. Cell-free plasma (200 ixl) was filtered (filter pore size, 0.45 gm) and added to 106 feline T- lymphoblastoid cells (MYA-1 cells) (Miyazawa et al., 1989 b). The cellfree culture supernatants were monitored every 3 to 4 days for Mg 2 dependent virion-associated RT activity as described previously (Tomonaga et al., 1993a). For quantification, spots on DE81 paper were cut out and RT activity was determined by scintillation counting. Nucleic acid extraction. Total cellular RNA was extracted from the PBMC pellets by the guanidium thiocyanate method, as previously described (Chomczynski & Sacchi, 1987). For extraction of viral RNA in plasma samples, pellets were obtained by centrifuging 1 ml of the plasma passed through 0-45 gm-pore-size filters. To extract cytoplasmic RNA, the cell pellets were resuspended in 300 gl of ice-cold lysis buffer (50 mm-tris-hc1 ph 8.0, 100 mm-nac1, 5 mm-mgc12, and 0.5 % NP- 40). After incubation on ice for 5 min, the nuclei were pelleted by centrifugation at r.p.m, for 1 min at 4 C. The supernatant was removed to a new tube and then incubated with appropriate amount of Proteinase K for 15 min at 37 C. The lysate was extracted twice in phenol-chloroform-isoamyl alcohol (25:24:1) and RNA was precipitated in 1/10 volume of 3 N-sodium acetate ph 5.2 and ethanol at -20 C for several hours. The RNA preparations were treated for 1 h with 100U of RNase-free DNase (Boehringer Mannheim Yamanouchi) in the presence of 20 U of placental RNase inhibitor (Toyobo), extracted with phenol-chloroform and precipitated with ethanol. High-molecular-weight DNA was extracted by standard methods and incubated for 1 h with 100 U of boiled RNase A (Boehringer Mannheim Yamanouchi) before addition of Proteinase K to the lysates. As a positive control, nucleic acids were isolated from MYA-1 cells infected with FIV strain TM2 and their culture supernatant. Synthetic oligonucleotide primers. Ten amplification primers were used for detection of FIV-specific transcripts in this study. The locations of these primers are indicated in Fig. 1. The nucleotide sequences and exact positions of the primers are as follows (strain TM2 nucleotide numbers are given within parentheses). Primers: KA-14, 5' GTCTCTGGTATATCACCTGG Y (800 to 781); KA-16, 5' GTAA- TGTTCCTCTTGAGGTG 3' (6673 to 6654); KA-17, 5' GTTGAC- GGTGTGCCAAACAG 3' (9061 to 9042); KS-24, 5' GAACCCTG- CACTCTTCCTGA Y (5217 to 5236); KS-25, 5' GATAGAGAACC- AGCTATTAG 3' (6043 to 6062). Primers PR-1, KA-2, KA-4, KA-5, and KS-6 were described previously as PRLTS, PRVIA, PROAA, PRENA and PRENS, respectively (Tomonaga et al., 1992, 1993b). cdna synthesis and PCR amplification. To detect FIV-specific transcripts in infected PBMC, RT-PCR analysis was performed as follows. One jag of DNase-treated RNA in water was heated for 10 min at 70 C, placed on ice, and first-strand synthesis of cdna was carried

3 FIV transcripts in the latent state 2195 rev gag pol vif A / env % i--in PR1 KS25 KS24 ~ KS6 I Ill KA14 KA2 KA5 KA17 (b) 1 KA4 KA m 2A ~ m m 4 m (c) SD1 SD2 SD3 SA1 I SA2 / x SA3 SA4 ~ (5194) (5928) (6264) (8959) Fig. 1. Transcription map of FIV with location of oligonucleotide primers for RT-PCR. A schematic representation of the FIV genome is shown at the top. Sense and antisense oligonucleotide primers used in this study. The location and direction of each primer are shown by an arrow. The exact positions of these oligonucleotides are indicated in the Methods. (b) Structures of FIV mrna transcripts detected in previous studies (Phillips et al., 1992; Tomonaga et al., 1993 b). Exons in the genome are identified by numbers. (c) Locations of major splice donor (SD) and splice acceptor (SA) sites in FIV genome. Nucleotide positions of the splice sites based on the strain TM2 sequence are indicated in parentheses. out in a total volume of 20 lal containing 75 mm-kc1, 50 mu-tris-hc1 ph 8.3, 5 mm-mgcle, 0"01 M-DTT, 10 mm of each dntp, 10 U of RNasin (Toyobo), 10 U of Moloney murine leukaemia virus RT (Gibco BRL) and 50 pmol of the antisense oligonucleotide primer. The reaction mixture was incubated at 45 C for 2 h. PCR amplification of single-stranded DNA was carried out after the addition of 50 pmol of the sense oligonucleotide primer and 2.5 U of Taq DNA polymerase (Saiki et al., 1988) (Perkin-Elmer Cetus). The reaction mixture was overlaid with 1 drop of mineral oil (Sigma) and incubated at 94 C, 57 C, and 72 C for 1, 2, and 2 min, respectively. This cycle was repeated 30 times in a Perkin-Elmer Cetus DNA Thermal Cycler P J2000. Analysis of PCR products. PCR products were analysed on 5 % polyacrylamide gels, and visualized by UV fluorescence after staining with ethidium bromide. To denature DNA before blotting, gels were soaked in 0.5 M-NaOH, 1.5 M-NaC1 for 10 min, washed twice with H~O, and neutralized with 1.0 M-Tris-HCI ph 7.4, 1.5 M-NaC1 for 10 rain. The DNA was transferred to nylon membrane by electroblotting at 36 ma for 16 h in 2 xtbe buffer (0.1 M-Tris-HCI ph 8'3, 0.1 N-boric acid, 2.0 mm-edta) at 4 C. After cross-linking of DNA, the membranes were prehybridized for 1 h at 37 C. Hybridizations were performed overnight with 32P-labelled probes. When necessary, radioactivities of the hybridization signals from RT-PCR analyses were quantified by the use of a radioanalytical imaging system. By limiting cell dilution RT-PCR and Southern blot analysis, the primers used here could be used to detect FIV-specific transcripts in one FIV-infected MYA-1 cell in a background of 106 uninfected MYA-1 cells. Results Detection of viral DNA and RNA in feline PBMC and plasma samples For detection of the FIV-specific DNA and RNA in two experimentally infected cats, we constructed ten sense and antisense primers that match precisely the sequence of FIV strain TM2 used for inoculation of cat C-104. Although cat C-103 was inoculated with another strain of [:IV (TM 1), it was confirmed that the sequences of the two strains were highly conserved (Maki et al, 1992) and that the primers could amplify the sequences of both strains. The locations of the primers are indicated in Fig. 1. To detect FIV proviral DNA, genomic DNA was prepared from the PBMC of three SPF cats and FIV TM2-infected MYA-1 cells. One gg of each RNase A-

4 2196 K. Tomonaga and others : ~[ 4 PR-1/--..,,p : KA-14 Genomic DNA (b) Plasma RNA Fig. 2. Detection offiv proviral DNA and viral RNA (b) by PCR. Primer pair used for the PCR analysis is indicated on the left. Lane 1, cat C-104 (TM2-infected); lane 2, (TMl-infected); lane 3, cat C-112 (uninfected); lane 4, positive control (TM2-infected MYA-1 cells). treated DNA was then used as the template for PCR amplification employing the primer pair, PR-1/KA-14, which is predicted to amplify a 364 bp fragment specific for FIV proviral DNA. As shown in Fig. 2, FIVspecific DNAs were clearly detected in both infected cats (Fig. 2a, lanes I and 2). In contrast, no FIV signal was observed in the PBMC fi'om an uninfected cat (Fig. 2 a, lane 3). Next, to look for viral RNA in plasma, 1 ml plasma samples were filtered and pelleted (see Methods) and RNA was extracted. RT-PCR was performed with DNase-treated RNAs under the established conditions with the primer pair PR-1/KA-14. As shown in Fig. 2 (b), no viral RNA was detected in plasma samples from either experimentally infected or uninfected cats (Fig. 2 b, lanes 1-3). Even after prolonged exposure of the autoradiogram, we could not observe any specific signals for the viral RNA (data not shown). Furthermore, infectious FIV could not be isolated from 200 pl of plasma-inoculated cultures during the observation period (see Fig. 4b). From this observation, we could find no evidence for the presence of cell-free virus in the plasma of these experimentally FIV-infected, asymptomatic cats. Quantitative RT-PCR analysis' of FIV-specific RNAs We next analysed the transcriptional pattern of FIV in the PBMC to establish the replication status of FIV in the chronically infected cats. For detailed examination, six different pairs of the amplification primers were used. The RNA species and sizes corresponding to the predicted amplified products are shown in Table 1. To determine first whether FIV-specific RNAs could be quantified using these primer pairs and our RT-PCR procedure, sequential twofold dilutions of total cellular RNA from FIV TM2-infected MYA-1 cells were subjected to RT-PCR analysis. The signals generated by the RT-PCR were quantitative across a 500-fold range of RNA concentrations with all primer pairs tested. Fig. 3 i Table 1. RNA species and sizes of PCR products that should be generated by RT-PCR analysis* Primer pair RNA species Size (bp) PR- 1/KA- 14 full-length 364 /KA-2 vzf 219 /KA-16 env 585 /KA-4 ORF-A, rev, env 310, 378 /KA-5 rev, env 334, 402 KS-6/KA-17 ORF-A, rev 216 * RNA species and sizes indicated here are predicted from the RNA splicing pattern of FIV strain TM2 (Tomonaga et al., 1993b). shows the results of RT-PCR analysis obtained using primer pairs PR-1/KA-14, PR-1/KA-2, and KS-6/KA- 17. Primer pair PR-1/KA-14 generates a fragment specific for genomic RNA or intracellular full-length FIV mrna. The primer pair PR-1/KA-2 will generate a fragment specific for singly spliced v~f mrna (Tomonaga et al., 1992) because the KA-2 primer is located immediately downstream of a non-coding exon (termed 2A) (Fig. l b), which is employed for many multiply spliced transcripts (Phillips et al., 1992; Tomonaga et al., 1993 b). The primer pair KS-6/KA-17, separated by the intron between the two coding exons of rev was used to amplify a fragment from all multiply spliced transcripts (Table l). In all cases, signal intensities increased with input RNA. Although the magnitude of the increase in signal intensities was not linear and reached a plateau in some cases, this is probably because concentrations of the RNA or oligonucleotides were limiting. Furthermore, we have obtained similar results using limiting dilutions of FIV-infected cells as template in this RT-PCR procedure; the increasing specific signal intensities were observed according to the ratio of FIV-infected cells (K. Tomonaga & T. Mikami, unpublished results). From these observations, we estimated that these primer pairs and RT-PCR procedure could be used for quantitative analysis of FIV-specific RNA in infected cells. Analysis of transcriptional patterns of FIV in the PBMC To determine the transcription pattern of FIV in two experimentally infected cats, both total cellular and cytoplasmic RNAs were extracted from the PBMC, because presence of RNA in total cellular RNA does not necessarily equate with translational usage. As a positive control, RNA was extracted from MYA-1 cells infected with FIV strain TM2. One lag of each DNase-treated RNA sample was subjected to RT-PCR in parallel, and 10 lal of each amplification product was analysed on 5 % polyacrylamide gel.

5 - - FIV transcripts in the latent state 2197 Primer pairs PR-1/KA-14 (unspliced) PR-1/KA-2 (singly spliced) KS-6/K (multiply (b) (c) PR- l/ka-2 - PR-1/KA-4 PR- 1/KA-5 - KS-6/KA J i6,6 qp~ Total : ::::, ::L :: Cytoplasmic ':I:I ; ilo II I Total Cytoplasmic Fig. 3. Quantitative RT-PCR analysis and detection of FIV-specific RNAs in PBMC of experimentally FIV-infected cats. RT-PCR on twofold dilutions of RNA from FIV-infected cells (lanes 1 to 11). One ixg of RNA (lane 1) was diluted, and converted to cdna. Primer pairs used to each RT-PCR analysis are indicated on the left. (b and c) Detection of viral transcripts in PBMC by using various pairs of oligonucleotide primers. One gg of each DNase-treated RNA sample was subjected to RT PCR analysis. Ten 14 of each PCR product was analysed on 5 % polyacrylamide gel, and hybridization was performed. Primer pairs used for the RT-PCR analysis are indicated on the left. All fi'agments migrate to the expected size on the gel. Lanes: 1~4, total RNA: 5 8, cytoplasmic RNA; 1 and 5, cat C-104 (TM2-infected); 2 and 6, cat C-103 (TM 1-infected); 3 and 7, cat C-112 (uninfected); 4 and 8, positive control (TM2-infected MYA-1 cells). Fig. 3 (b) shows the result of the RT-PCR using three sets of primer pairs. When the primer pair PR-1/KA-14 was used, the unspliced full-length RNA was detected in total RNAs from both infected cats but only at low levels in cat C-103 (Fig. 3b, lanes 1 and 2), whereas a weak signal was detected in cytoplasmic RNA only from cat C-104 (Fig. 3 b, lane 5). To detect the expression of singly spliced RNAs in the PBMC, we generated two different primer pairs. One pair of primers, PR-1/KA-2, detected a fragment specific for v/f mrna, as described above. Another pair, PR-1/KA-16, was used to amplify the fragments specific for env mrna, since the primer KA- 16 is located just downstream of the splice donor 3 (SD3) at the 5' end of the env ORF (Fig. 1 a; Table 1). As shown in Fig. 3 (b), singly spliced FIV vif mrna was detected only in the total RNA sample from cat C-103 at low intensity but not in the cytoplasmic RNA samples (Fig. 3 b). On the other hand, no fragment specific for the env mrnas was observed in either infected cat, although in RNAs from strain TM2-infected cells the specific signals were clearly detected (Fig. 3 b). Even on longer exposure of the autoradiogram, we could not find the specific signals (data not shown). From these observations, it was concluded that undetectable or extremely low levels, if any, of unspliced and singly spliced transcripts were present in PBMC from the experimentally infected cats. Next, to investigate the pattern of FIV specific transcripts in more detail, we used another three sets of primer pairs (Fig. 3c). The primer pair, PR-1/KA-4, should generate two fragments (Table 1). The shorter fragment is specific for mrna that joins splice donor 1 (SD1) with splice acceptor 2 (SA2). The longer fragment is 68 bp longer than the shorter fragment, since the longer fragment represents mrnas employing SA 1 and SD2, which span the non-coding exon 2A, as well as SD1 and SA2. The primer pair, PR-1/KA-5, will also detect two fragments. The shorter fragment is specific for mrna that spans SD1 to SA3. The longer fragment represents mrna that contains the non-coding exon 2A. Because expression of env mrna was not observed in the PBMC from either infected cat (Fig. 3b), it is considered that the fragments detected by these two primer pairs reflect expression of multiply spliced mrnas that join SD3 with SA4. Thus, it is considered that fragments detected by the primer pairs PR-1/KA-4 and PR-1/KA-5 are specific for bicistronic mrnas that encode ORF-A and rev genes (Tomonaga et al., 1994) and monocistronic rev mrnas, respectively. The primer pair PR-1/KA-4 detected the two specific fragments in both total and cytoplasmic RNA samples from cat C-104, although the levels of the upper fragment in cytoplasmic RNA were relatively low (Fig. 3 c, lanes 1 and 5). In the case of cat C-103, the intensity of upper fragment in the total RNA sample was much less than that in cat C-104, and we could not detect the specific signal in the cytoplasmic RNA sample (Fig. 3 c, lanes 2 and 6), indicating that an extremely low level of multiply spliced bicistronic mrna containing non-coding exon 2A was expressed in the PBMC from cat C-103. By using

6 2198 K. Tomonaga and others Table 2. Summary of the RT-PCR analysis of FIV mrna expression in naturally infected asymptomatic cats Unspliced Singly spliced Multiply spliced Cat no. (PR-1/KA-14)* (PR-1/KA-2) (PR-1/KA-16) (KS-6/KA-17) t * Primer pairs used for detection of FIV-specific mrnas. t Grading: -, undetected; +, < 25 % intensity of control signal detected in the RNA from MYA-1 cells infected with strain TM2; + +, 25-50%; + + +, 50-75%; , > 75%. PR-1/KA-14 (unspliced) Time post culture (h) (b) ~ & PR-1/KA-2 (single spliced) b 6 6i ~-* i_l Time post-infection (days) Fig. 4. In vitro stimulation of latent FIV in PBMC. Induction of unspliced and singly spliced FIV RNA. PBMC were isolated and cultured with 2 lag of PHA/ml for the indicated times. One lag of cytoplasmic RNA from each culture sample was analysed by RT- PCR as in Fig. 3. (b) Detection of RT activity in the culture supernatants of MYA-1 cells. MYA-1 cells (10 s) were infected with either 200 ~tl of supernatants of 48 hr stimulated PBMC cultures or 200 ml of plasma samples from infected cats, and RT production in the culture supernatant was monitored at indicated times (days) post-infection (p.i.). Symbols: A, C-104 plasma; A, C-103 supernatant; O, C-104 supernatant; O, C-103 plasma. i the primer pair PR-1/KA-5, although the two specific signals were clearly demonstrated in the cells infected with the strain TM2, only the lower fragment was detected in RNA samples from cat C-104 (Fig. 3 c, lanes 1 and 5). On longer exposure, a low level of the longer fragment could be seen in the both total and cytoplasmic RNA samples from cat C-104 (data not shown). On the other hand, no specific signal was demonstrated in RNA samples from cat C-103 even on longer exposure (Fig. 3 c, lanes 2 and 6). The reason for this phenotype in cat C-103 is considered to be that the inoculum strain TM1 lacks the analogous SA3 site. The first nucleotide upstream of the analogous SA3 site in strain TM1 sequence differs from that in strain TM2 sequence (GCAG/ATA T [TM2]; GCAA_/ATAT [TM1]). From this observation, it appeared that strain TM 1 would not produce monocistronic rev mrnas, as was shown for two isolates from the USA (Phillips et al., 1992; Tomonaga et al., 1993 b). The primer pair, KS-6/KA- 17, clearly detected specific fragments in RNA samples from both infected cats but at relatively lower intensity in RNA from cat C-103 compared to cat C-104 (Fig. 3c). These observations demonstrate that multiply spliced mrnas encoding FIV regulatory proteins predominate in the PBMC from these experimentally FIV-infected, asymptomatic cats compared to unspliced and singly spliced mrnas, but also indicate that differential expression was observed among multiply spliced mrnas. Transcriptional patterns of FIV in naturally infected cats Next, to investigate whether the FIV transcription pattern observed in the experimentally infected cats also

7 FIV transcripts in the latent state 2199 PR 1 probe 1 2A 4 SD1 :: i i :; [!i i SA1 SD2 SA3 SD3 (b) Time post-stimulation (h) t (c) r,.) ~ 113 ' I ' I ' I ' I ~ I ' I ' I ' I ~,, Time post-stimulation (h) KA17 5 -m 11.5 SA4 ~ ~ A.4.5 m ~ ~ Fig. 5. Transition of expression levels of FIV monocistronic rev mrnas in PBMC by in vitro stimulation. PBMC of cat C-104 were isolated and cultured with 2 ~tg of PHA/ml for the indicated times (h). One ~tg of cytoplasmic RNA from each culture sample was subjected to RT PCR analysis by using primer pair PR-1/KA-17, and analysed as in Fig. 3. Structures of small multiply spliced mrnas detected by the primer pair PR-I/KA-17. Exons are indicated by black boxes and identified by numbers. The locations of oligonucleotide primers (arrows) and splice sites are shown. The restriction enzyme fragment (Pst I-Bgl II) for a 32P-labelled probe is indicated by the striped box. (b) Results of the RT-PCR analysis shown by ethidium bromide staining ofpolyacrylamide gel and Southern blot hybridization. Structures of the RNAs corresponding to each PCR product are indicated by exon numbers on the right. All fragments migrate to the expected size on the gel. (c) Relative increase of intensity of each amplification signal shown by hybridization. The radioactivity in the signals from RT-PCR occurs in naturally FIV-infected cats, we examined PBMC from nine naturally infected cats by RT-PCR. At the time of sampling, these cats were asymptomatic and showed no evidence of feline AIDS-related complex. With the primer pairs used here, FIV-specific fragments were efficiently amplified from genomic DNAs from PBMC of the naturally infected cats (data not shown). To detect FIV-specific transcripts, RNAs were extracted and subjected to RT-PCR analysis as described above. The results are summarized in Table 2. The multiply spliced mrnas were clearly detected in all RNAs from the naturally infected cats, while the unspliced and singly spliced mrnas could be detected only in a few samples. However, the signal intensities of the unspliced and singly spliced mrnas detected were much less than those of multiply spliced mrnas (Table 2). In one cat (8549) all species of mrnas were detected in the RNA sample, but the intensities of the singly spliced mrnas were extremely low compared with the multiply spliced species (< 15%). This observation demonstrated that the predominant expression of multiply spliced mrnas in peripheral blood cells is also a feature of naturally infected, asymptomatic cats. Expression of the unspliced and singly spliced transcripts in the PBMC by in vitro stimulation Although the intensities of FIV-specific DNA signals in the PBMC from chronically FIV-infected cats indicated that a high percentage of the cat PBMC carried proviruses, we found no evidence of viral replication in the peripheral blood. To test whether viral replication could be induced in these cells by cellular activation, we collected a large volume of blood from the experimentally infected cats and analysed RNA expression in the cytoplasm of PBMC before and after in vitro stimulation with 2 ~tg/ml PHA or 10 ~tg/ml ConA. Before stimulation, the expression patterns of unspliced and singly spliced transcripts were consistent with those in the samples displayed in Fig. 3 (b), indicating the stability of the phenotype. However, after only 3 h of in vitro stimulation with PHA, expression of both unspliced and singly spliced FIV RNAs was evident and readily detected at the expected size in the PBMC from cat C- 104 by RT-PCR (Fig. 4a). In PBMC from cat C-103, the unspliced and singly spliced FIV RNAs also appeared 3 to 6 h after stimulation (data not shown). Since this time analysis was determined by the use of a radioanalytical imaging system. Relative increases of each fragment were calculated by dividing the amount of radioactivity of each signal from PBMC after stimulation by the amount of radioactivity of the signal from unstimulated PBMC. Symbols: 0, 1.2A.4.5; O,

8 2200 K. Tomonaga and others KS-25 l 2A 3 NNN... (b) (i) 0 3 (ii) (c) 6 7s3 2 SA2 Time post-stimulation (h) KA-17 ~ ~,:+~o' A.3.5 : W ~ A.3.5. : , I, I ~ I, I, I ~ I, I ili Time post-stimulation (h) Fig. 6. Transition of expression levels of FIV bicistronic mrnas in PBMC by in vitro-stimulation. PBMC from both infected cats were isolated and cultured with PHA for the indicated times (h). RT-PCR analysis was performed as in Fig. 5. Structures of bicistronic mrnas detected by the primer pair KS-25/KA-17. Exons are identified by numbers. The locations of oligonucleotide primers (arrows) and splice sites are shown. (b) Results of the RT-PCR analysis shown by ethidium bromide staining of polyacrylamide gels and Southern blot hybridizations. Panels: (i), cat C-104 (TM2-infected); (ii), cat C-103 (TMl-infected). All fragments migrate to the expected size on the gel. Lanes are numbered by the time (h) after stimulation. (c) Relative increase of intensity of each amplification signal shown in hybridization. The radioactivity in the signals from RT-PCR analysis was determined as in Fig. 5. Symbols: O, C-104; A, C-103. is too short to allow virus spread, FIV expression must have been induced in cells present in the original sample. By stimulation with ConA, similar results were obtained in the PBMC of both cats (data not shown). Fur- 5 thermore, to confirm that stimulated PBMC produced virus, we collected culture supernatants 48 h after stimulation, and 200 gl aliquots were used to infect l0 s MYA-1 cells. As shown Fig. 4 (b), virion-associated RT production was detected in the supernatants of MYA-1 cells infected with the supernatants from stimulated PBMC. From these results, it was shown that the FIV provirus in the PBMC of experimentally infected cats is transcriptionally competent but in a latent state in vivo. Differential expression of multiply spliced mrnas in stimulated PBMC For HIV-1, recent studies have revealed that the expression levels of multiply spliced mrnas encoding viral regulatory proteins are critical for productive virus replication and expression in chronically infected cell lines (Adams et al., 1994; Cannon et al., 1994; Duan et al., 1994; Pomerantz et al., 1992b). We next investigated the temporal expression pattern for each multiply spliced mrna during activation of virus expression from latently infected PBMC. Large numbers of PBMC from both experimentally infected cats were stimulated with PHA in vitro as described above. First, to analyse expression levels of the monocistronic rev mrnas, which were generated only in cat C-104, the primer pair PR-1/KA-17 was used (Fig. 5). This primer pair should detect fragments specific for all multiply spliced mrnas. However, since the amplification efficiency of larger PCR products is low under these conditions, another set of primer pairs was used to amplify bicistronic multiply spliced mrna species that encode the ORF-A gene (see below). The results for each primer pair were shown by ethidium bromide staining and hybridization. The structures of transcripts amplified by PCR are indicated by exon numbers present in the products. To detect rev mrnas specifically, a probe located in central region was used for hybridization (Fig. 5a). As shown in Fig. 5 (b), a fragment specific for monocistronic rev mrna, 1.4.5, was the only product identified before stimulation apart from a small singly spliced transcript (1.5). This phenotype was consistent with the pattern seen in the first sample (Fig. 3 c), indicating that monocistronic rev mrna consisting of three exons is produced more abundantly than that containing non-coding exon 2A in unstimulated PBMC. However, monocistronic rev mrna 1.2A.4.5 was detected by hybridization as early as 3 h after stimulation, although the signal intensity was faint. Furthermore, the signal intensity of this transcript increased gradually until 48 h post-stimulation in the PBMC (Fig. 5b). On the other hand, no increase in intensity was seen in transcript after stimulation (Fig. 5b). Fig. 5(c) shows the relative increases in intensities of each amplification signal after hybridization

9 FIV transcripts in the latent state 2201 KS-24 KA A 3 5 ~i~i~ ~;~" ~ (b) (i) (ii) (c) Time post-stimulation (h) 35 r I' I ' I' I ' I' I' I ' l ~ ~ ~ ~ A.3.5,~ 1.2.A4.5. :i+;,,~ J W ~ A3.5 0 ~1, I, I, I, I i I, I, I--i--~l Time post-stimulation (h) Fig. 7. Transition of expression levels of FIV multiply spliced mrnas employing a non-coding exon in PBMC by in vitro stimulation. PBMC from both infected cats were isolated and cultured with PHA for the indicated times (h) and RTPCR analysis was performed as in Fig. 5. Structures of multiply spliced mrnas containing non-coding exon 2A detected by the primer pair KS-24/KA-17. Exons are identified by numbers. The locations of oligonucleotide primers (arrows) are shown. (b) Results of the RTPCR analysis shown by ethidium bromide staining of polyacrylamide gels and Southern blot hybridizations. Panels : (i), cat C-104 (TM2-infected); (ii), cat C- 103 (TMl-infected). All fragments migrate to the expected size on the gel. Lanes are numbered by the time (h) after stimulation. (c) Relative increase of intensity of each amplification signal shown in hybridization. The radioactivity in the signals from RT PCR analysis was determined as in Fig. 5. Symbols: Q), C-104 (1.2A.3.5); 0, C-104 (1.2A.4.5); /~, C-103 (1.2A.3.5). i and radioanalytical imaging. The intensity of the transcript 1.2A.4.5 displayed a 25-fold increased level after 48 h stimulation, whereas levels of transcript did not change during the observation period. This experiment was repeated at least three times with PBMC from another sampling time, and each time we found similar results with significant increases in transcript 1.2A.4.5 after stimulation. Next, changes in the expression levels of the bicistronic mrnas encoding ORF-A gene as well as rev gene were observed using primer pair KS-25/KA-17. Because primer KS-25 is located just downstream of SA2, this primer pair could amplify a fragment specific for transcript 1.2A.3.5 as well as (Fig. 6a), In both PBMC preparations, the transcripts showed abrupt increases immediately after stimulation, and peak intensities were found as 5-fold increases at around 3 to 6 h and 6 to 12 h after stimulation in the PBMC from cats C-104 and C-103, respectively (Fig. 6b, c). In both samples, however, the amounts of transcript were shown to decrease rapidly thereafter. To investigate changes in expression of the multiply spliced mrnas containing non-coding exon 2A that were seen at low levels before stimulation, we next used primer pair KS-24/KA-17. This primer pair should detect two fragments corresponding to the transcripts 1.2A.3.5 and 1.2A.4.5 (Fig. 7a). In the case of PBMC from cat C-104, the fragment specific for the transcript 1.2A.4.5 showed a gradual increase following stimulation [Fig. 7b (i) and c]. This pattern was consistent with the results obtained in Fig. 5. On the other hand, the fragment specific for transcript 1.2A.3.5 showed a transient increase after stimulation, and the peak intensity was 8-fold above resting levels [Fig. 7b (i) and c]. Because strain TM1 lacks a splice acceptor site analogous to SA3, only a fragment specific for the transcript 1.2A.3.5 was found in the PBMC from cat C Although a faint signal of the transcript was detected in the unstimulated state, the signal showed 20- fold increase in 12 h after stimulation (Fig. 7 b (ii) and c). From these observations, it was clear that each multiply spliced mrna that encodes FIV regulatory proteins showed a differential increase upon stimulation, and also suggested that viral activation in the PBMC might be a consequence of this pattern of sequential expression. Discussion In this study, we have examined the in vivo state of FIV expression in the peripheral blood cells of chronically FIV-infected, asymptomatic cats. We have shown that FIV was harboured at high levels in PBMC but not in the plasma of these cats (Fig. 2). Furthermore, we demon-

10 2202 K. Tomonaga and others strated by a quantitative RT PCR assay that the expression of unspliced and singly spliced transcripts was extremely low, if present at all, and that the most abundant viral transcripts were multiply spliced mrnas in the PBMC of these experimentally infected cats. In naturally infected, asymptomatic cats, a similar tendency towards expression of multiply spliced rather than unspliced and singly spliced mrnas was demonstrated by the RT-PCR analysis. From these observations, we conclude that transcription of FIV in the PBMC of these asymptomatic cats was incomplete, and that the transcriptional pattern of the FIV observed here is similar to that of latent HIV-1 in certain cultured cells and in PBMC from asymptomatic HIV-l-infected patients (Pomerantz et al., 1990; Seshamma et al., 1992). The sensitivity of our RT-PCR assay allowed us to determine the cellular basis of the lack of FIV expression in peripheral blood cells. By directly monitoring FIV mrna expression in the PBMC, we demonstrated rapid and efficient expression of unspliced and singly spliced transcripts upon mitogen stimulation in vitro (Fig. 4). Previously, Dandekar et al. (1992) also observed transient appearance of viral transcripts in mitogen-activated PBMC from FIV genome-positive, seronegative cats but were unable to demonstrate production of RT or FIV core proteins in these cultures. They indicated that the FIV genome in the cats was replication defective. However, cats used in this study are seropositive and infectious virus was recovered readily from stimulated PBMC. It was clear, therefore, that FIV in these PBMC is not replication defective, and we conclude that cellular latency of FIV does indeed exist in vivo. The mitogen-stimulated activation of latent FIV in PBMC was similar to the proviral activation observed in certain cell line models of HIV latency (Folks et al., 1987; Michael et al., 1991 ; Pomerantz et al., 1990). These latently infected cell lines support only very low levels of viral replication when cultured in an unstimulated state but can be induced to produce high amounts of virus when exposed to agents such as phorbol 12-myristate 13- acetate and PHA or cytokines. The increased virus production after such stimulation of these cells is accomplished by strong induction of HIV mrna. Recently, it was also demonstrated that HIV-1 mrna expression was activated by mitogen stimulation in chimpanzee PBMC that were latently infected with HIV- 1 (Saksela et al., 1993). Much of this induction is believed to be mediated by interaction of the cellular transcriptional factor NF-IcB with its binding sites in the proviral long terminal repeat. Thus, it is likely that the increased activity of some transcriptional factor is involved in the activation of latent FIV in in vitro stimulated cat PBMC, as was the case for HIV-1 activation. In fact, several functional transcriptional factor binding sites have been identified in the FIV long terminal repeat (Miyazawa et al., 1991 ; Thompson et al., 1994). Our detailed investigations of FIV transcripts in the PBMC have also demonstrated interesting findings concerning the expression of multiply spliced mrnas that encode FIV regulatory proteins. One of these was observed in unstimulated PBMC. In the unstimulated state, differential expression of the multiply spliced mrnas was found; the expression level of some mrnas containing non-coding exon was very low, although other mrnas were expressed efficiently (Figs 3, 5 and 7). Recent studies using in vitro models of HIV-1 latency demonstrated that a threshold level of Rev is required for accumulation of unspliced HIV mrna and is necessary for the production of infectious virus from the latently infected cells (Pomerantz et al., 1992b). It was also reported that HIV-1 Tat affects the restricted transcription and replication of HIV-1 in latently infected cells (Adams et al., 1994; Cannon et al., 1994). For FIV, we previously demonstrated that the RNA expression pattern of a rev-negative mutant mimics the pattern observed in the PBMC and efficient FIV replication is rescued only when sufficient Rev is supplied (Kiyomasu et ai., 1991 ; Tomonaga et al., 1993b), and that the ORF- A gene is needed for efficient viral replication in peripheral blood cells (Tomonaga et al., 1993a). Considering the aberrant expression patterns of multiply spliced mrnas observed here, it is likely that the accumulation of multiply spliced mrnas in the PBMC is not enough to produce the virus efficiently. In addition, we obtained another interesting finding by investigating the changes in expression level of each multiply spliced mrna species during virus activation in latently infected PBMC. The amount of monocistronic rev mrna with non-coding exon 1.2A.4.5, was very low in unstimulated PBMC, but rose gradually and reached a 25-fold higher level 48 h after stimulation, in contrast to the monocistronic rev mrna which was stable during the observation period (Fig. 5). In addition, mrnas with bicistronic coding capacity also showed abrupt increases immediately after stimulation in both PBMC populations. In particular, the bicistronic mrna 1.2A.3.5 in PBMC from cat C-103 showed marked increases. Although strain TM1 can not produce monocistronic rev mrna, it has been shown that the bicistronic mrnas can produce Rev as efficiently as the monocistronic rev mrna (Tomonaga et al., 1994). It is considered, therefore, that these increases in multiply spliced mrnas directly reflect the accumulation of Rev, although we could not examine the protein levels directly. The detection of unspliced and singly spliced mrnas in the PBMC was associated with this differential increase of each multiply spliced mrna, suggesting that this shift

11 FIV transcripts in the latent state 2203 in expression levels may play an important role in activation of virus from latency in PBMC, although our findings do not exclude the possibility that cellular factors acting in trans might influence the relative virus transcript expression. Furthermore, expression of each multiply spliced mrna exhibited a differential response to stimulation, indicating the possibility that additional factor(s) involved in the regulation of alternative splicing or accumulation of transcripts exist in the cells and regulate viral activation at the transcriptional level. This study provides substantial new support for the notion that the FIV-infected cat is a relevant model for the study of the cellular and molecular mechanisms regulating the clinical latency of HIV-1-induced disease. Specifically, these animals could be valuable in understanding the role of the PBMC in the establishment of a latent lentivirus infection. For a complete understanding of the latent state in viva, however, we should analyse transcriptional levels of FIV in lymphatic tissues in the latent stage of infection, because it has been demonstrated that HIV is transcriptionally active in lymphatic tissues throughout the clinically latent period of HIV infection when very little or no HIV mrna can be detected in the peripheral blood (Pantaleo et al., 1993). Furthermore, we suggest that FIV may control the state of repressed viral expression and the pathway responsible for viral activation by differential expression of each multiply spliced mrna. This finding will be of interest and important for the understanding of the molecular mechanisms involved in controlling the maintenance of latent states of lentivirus infection in viva. Further analysis of viral transcription in viva should provide a better understanding of lentivirus pathogenesis, and may serve as a development of antiviral therapies. We thank Drs T. Miyazawa (University of Glasgow, Glasgow, UK) and A. Adachi (Kyoto University, Kyoto, Japan) for helpful advice and Drs H. Tamura (Teikyo University, Tokyo, Japan) and T. Umemura (Tottori University, Tottori, Japan) for providing blood of cats naturally infected with FIV. This work was partly supported by grants from the Ministry of Education, Science, and Ctflture of Japan and from the Ministry of Health and Welfare of Japan. K.T. is supported by the Japan Society for the Promotion of Science (JSPS). References ADAMS, M., SHARMEEN, L., KIMPTON, J., ROMEO, J. M., GARCIA, J. V., PETERLIN, B. M., GROUDINE, M. & EMERMAN, M. (1994). Cellular latency in human immunodeficiency virus-infected individuals with high CD4 levels can be detected by the presence of promoterproximal transcripts. Proceedings of the National Academy of Sciences, USA 91, ARENS, M., JOSEPH, T., NAG, S., MILLER, J. P., POWDERLY, W. G. & RATNER, L. (1993). Alterations in spliced and unspliced HIV-1- specific RNA detection in peripheral blood mononuclear cells of individuals with varying CD4-positive lymphocyte counts. AIDS Research and Human Retroviruses 9, BALDINOTTI, F., MATTEUCCI, D., MAZZETTI, P., GIANNELLI, C., BANDECCHI, P., TOZZINI, F. & BENDINELLI, M. (1994). Serum neutralization of feline immunodeficiency virus is markedly dependent on passage history of the virus and host system. Journal of Virology 68, BEDNARIK, D.P. & FOLKS, T.M. (1992). Mechanisms of H1V-I latency. AIDS 6, BROWN, W. C., BISSEY, L., LOGAN, K. S., PEDERSEN, N. C., ELDER, J. H. & COLLISSON, E. W. (1991). Feline immunodeficiency virus infects both CD4 + and CD8 + T lymphocytes. Journal of Virology 65, BRUNNER, D. & PEDERSEN, N.C. (1989). Infection of peritoneal macrophages in vitro and in viva with feline immunodeficiency virus. Journal of Virology 63, CANNON, P., KIM, S.-H., ULICH, C. & KIM, S. (1994). Analysis of Tat function in human immunodeficiency virus type 1-infected low-levelexpression cell lines U1 and ACH-2. Journal of Virology 68, CHOMCZYNSKI, P. & SACCHI, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry 162, COOMBS, R. M., COLLIER, A. C., ALLmN, J. P., NIRORA, B., LEUTr~R, M., GJERSET, G. & COREY, L. (1989). Plasma viremia in human immunodeficiency virus infection. New England Journal of Medicine 321, CULLEN, B.R. & GREENE, W.C. (1989). Regulatory pathways governing HIV-1 replication. Cell 58, 423~426. DANDEKAR, S., BEEBE, A. M., BARLOUGH, J., PHILLIPS, T., ELDER, J., TORTEN, M. PEDERSEN, N. (1992). Detection of feline immunodeficiency virus (FIV) nucleic acids in FIV-seronegative cat. Journal of Virology 66, DUAN, L., OAKES, J. W., FERRARO, A., BAGASRA, O. & POMERANTZ, R. J. (1994). Tat and Rev differentially affect restricted replication of human immunodeficiency virus type 1 in various cells. Virology 199, 47~478. ENGLISH, R. V., JOHNSON, C. M., GEBHARD, D. H. & TOMPKINS, M. B. (1993). In viva lymphocyte tropism of feline immunodeficiency virus. Journal of Virology 67, FAUCl, A. S. (1988). The human immunodeficiency virus: infectivity and mechanisms of pathogenesis. Science 239, FLYNN, J. N., CANNON, C. A., BEATTY, J. A., MACKETT, M., RIGBY, M. A., NELL, J. C. & JARRETT, O. (1994). Induction of feline immunodeficiency virus-specific cytotoxic T cells in viva with carrier-free synthetic peptide. Journal of Virology 68, FOLKS, T. M., CLOUSE, K. A., JUSTEMENT, J., RABSON, A., DUH, E., KEHRL, J. H. & FAUCI, A. S. (1987). Cytokine-induced expression of HIV-1 in a chronically infected promonocyte cell line. Science 238, 8OO-802. GUPTA, P., KINGSLEY, L., ARMSTRONG, J., DING, M., COTTRILL, M. & RINALDO, C. (1993). Enhanced expression of human immunodeficiency virus type 1 correlates with development of AIDS. Virology 196, Ha, D. D., MO~JDGI, T. & ALAM, M. (1989). Quantitation of human immunodeficiency virus type 1 in the blood of infected persons. New England Journal o3" Medicine 321, HOHDATSU, T., PU, R., TORRES, B. A., TRUJILLO, S., GARDNER, M. B. & YAMAMOTO, J.K. (1993). Passive antibody protection of cats against feline immunodeficiency virus infection. Journal of Virology 67, ISHIDA, T., WASHIZU, T., TORIYABE, K., MOTOYOSHI, S., TOMODA, I. & PEDERSEN, N. C. (1989). Feline immunodeficiency virus infection in cats of Japan. Journal of the American Veterinary Medical Association 194, KAWAGUCHI, Y., MAEDA, K., TOHYA, Y., FURUYA, T., MIYAZAWA, T., HORIMOTO, T., NORIMINE, J., KM, C. & MIKAMI, T. (1992). Replicative differences in early-passage feline brain cells among feline immunodeficiency virus isolates. Archives of Virology 125, KIYOMASU, T., MIYAZAWA, T., FURUYA, T., SHIBATA, R., SAKAI, H., SAKURAGI, J.-I., FUKASAWA, M., MAKI, N., HASEGAWA, A., MIKAMI, T. & ADACrn, A. (1991). Identification of feline immunodeficiency virus rev gene activity. Journal of Virology 65, LAWSON, M., MEERS, J., BLECHYNDEN, L., ROBINSON, W., GREENE, W. & CARNEGIE, P. (1993). The detection and quantification of feline

12 2204 K. Tomonaga and others immunodeficiency provirus in peripheral blood mononuclear cells using the polymerase chain reaction. Veterinary Microbiology 38, MAKI, N., MIYAZAWA, T., FUKASAWA, M., HASEGAWA, A., HAYAMI, M., MIKI, K. & MIKAMI, T. (1992). Molecular characterization and heterogeneity of feline immunodeficiency virus isolates. Archives of Virology 123, MATTEUCCI, D., BALDINOTTI, F., MAZZETTI, P., PISTELLO, M., BANDECCHI, P., GHILARDUCCI, R., POLl, A., TOZZINI, F. & BENDINELLI, M. (1993). Detection of feline immunodeficiency virus in saliva and plasma by cultivation and polymerase chain reaction. Journal of Clinical Microbiology 31, MEERS, J., ROBINSON, W. F., DEL FIERRO, G. M., SCOONES, M. A. & LAWSON, M.A. (1992). Feline immunodeficiency virus: quantification in peripheral blood mononuctear cells and isolation from plasma of infected cats. Archives of Virology 127, MICHAEL, N. L., MORROW, P., MOSCA, J., VAHEY, M., BURKE, D. S. & REDFIELD, R. R. (1991). Induction of human immunodeficiency virus type 1 expression in chronically infected cells is associated primarily with a shift in RNA splicing patterns. Journal of Virology 65, MICHAEL, N. L., VAHEY, M., BURKE, D. S. & REDFIELD, R. R. (1992). Viral DNA and mrna expression correlate with the stage of human immunodeficiency virus (HIV) type 1 infection in humans: evidence for viral replication in all stages of HIV disease. Journal of Virology 66, MIYAZAWA, T., FURUYA, T., ITAGAKI, S., TOHYA, Y., NAKANO, K., TAKAHASHI, E. ~ MIKAMI, T. (1989a). Preliminary comparisons of the biological properties of two strains of feline immunodeficiency virus (FIV) isolated in Japan with FIV Petaluma strain isolated in the United States. Archives of Virology 108, MIYAZAWA, T., FURUYA, T., ITAGAKI, S., TOHYA, Y., TAKAHASHI, E. & MIKAMI, T. (1989 b). Establishment of a feline T-lymphoblastoid cell line highly sensitive for replication of feline immunodeficiency virus. Archives of Virology 108, MIYAZAWA, T., FUKASAWA, M., HASEGAWA, A., MAKI, N., IKUTA, K., TAKAHASHI, E., HAYAMI, M. & MIKAMI, T. (1991). Molecular cloning of a novel isolate of feline immunodeficiency virus biologically and genetically different from the original U.S. isolate. Journal of Virology 65, PANTALEO, G., GRAZIOSI, C., DEMAREST, J. F., BUTINI, L., MONTRONI, M., Fox, C. H., ORENSTEIN, J. M., KOTLER, D.P. & FAUCI, A. S. (1993). HIV infection is active and progressive in lymphoid tissue during the clinically latent stage of disease. Nature 362, PEDERSEN, N. C., HO, E. W., BROWN, M. L. & YAMAMOTO, J. K. (1987). Isolation of a T-lymphotropic virus from domestic cats with an immunodeficiency-like syndrome. Science 235, 79(~793. PHILLIPS, T. R., LAMONT, C., KONINGS, D. A. M., SHACKLETT, B. L., HAMSON, C. A., LucIw, P. A. & ELDER, J. H. (1992). Identification of the Rev transactivation and Rev-responsive elements of feline immunodeficiency virus. Journal of Virology 66, POMERANTZ, R.J., TRONO, D., FEINBERG, M.B. 8z BALTIMORE, D. (1990). Cells nonproductively infected with HIV-1 exhibit an aberrant pattern of viral RNA expression: a molecular model for latency. Cell 61, POMERANTZ, R.J., BAGASRA, O. & BALTIMORE, D. (1992a). Celluar latency of human immunodeficiency virus type 1. Current Opinion in Immunology 4, 475~480. POMERANTZ, R.J., SESHAMMA, T. & TRONO, D. (1992b). Efficient replication of human immunodeficiency virus type 1 requires a threshold level of Rev: potential implication for latency. Journal of Virology 66, RIMSTAD, E. & UELAND, K. (1992). Detection of feline immunodeficiency virus by a nested polymerase chain reaction. Journal of Virological Methods 36, SAIKI, R. K., GELFAND, D. H., STOFFEL, S., SCHARF, S. J., HIGUCHI, R., HORN, G.T., MULLIS, K.B. & EHRLICH, H.A. (1988). Primer- directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487M91. SAKSELA, K., MUCHMORE, E., GIRARD, M., FULTZ, P. & BALTIMORE, D. (1993). High viral load in lymph nodes and latent human immunodeficiency virus (HIV) in peripheral blood cells of HIV-1- infected chimpanzees. Journal of Virology 67, SAKSELA, K., STEVENS, C., RUBINSTEIN, P. & BALTIMORE, D. (1994). Human immunodeficiency virus type 1 mrna expression in peripheral blood cells predicts disease progression independently of the numbers of CD4+ lymphocytes. Proceedings of the National Academy of Sciences, USA 91, SCHNITTMAN, S. M., GREENHOUSE, J. J., LANE, H. C., PIERCE, P.F. & FAUCI, A. S. (1991). Frequent detection of HIV-1-specific mrnas in infected individuals suggested ongoing active viral expression in all stages of disease. AIDS Research and Human Retroviruses 7, SESHAMMA, T., BAGASRA, O., TRONO, D., BALTIMORE, D. & POMERANTZ, R. J. (1992). Blocked early-stage latency in the peripheral blood cells of certain individuals infected with human immunodeficiency virus type 1. Proceedings of the National Academy of Sciences, USA 89, SONG, W., COLLISSON, W., BILLINGSLEY, P. M. BROWN, W. C. (1992). Induction of feline immunodeficiency virus-specific cytolytic T-cell responses from experimentally infected cats. Journal of Virology 66, THOMPSON, F.J., ELDER, J. & NELL, J.C. (1994). Cis- and transregulation of feline immunodeficiency virus: identification of functional binding sites in the long terminal repeat. Journal of General Virology 75, TOMONAGA, K., NORIMINE, J., SHIN, Y-S., FUKASAWA, M., MIYAZAWA, T., ADACHI, A., TOYOSAKI, T., KAWAGUCHI, Y., KAI, C. & MIKAMI, T. (1992). Identifcation of a feline immunodeficiency virus gene which is essential for cell-free virus infectivity. Journal of Virology 66, TOMONAGA, K., MIYAZAWA, T., SAKURAGI, J-I., MORI, T., ADACHI, A. & MIKAMI, T. (1993 a). The feline immunodeficiency virus ORF-A gene facilitates efficient viral replication in established T-cell lines and peripheral blood lymphocytes. Journal of Virology 67, TOMONAGA, K., SHIN, Y.-S., FUKASAWA, M., MIYAZAWA, T., ADACHI, A. & MIKAMI, T. (1993 b). Feline immunodeficiency virus gene expression: analysis of the RNA splicing pattern and the monocistronic rev mrna. Journal of General Virology 74, TOMONAGA, K., MIYAZAWA, T., KAWAGUCHI, Y., KOHMOTO, M., INOSHIMA, Y. & MIKAMI, T. (1994). Comparison of the Rev transactivation of feline immunodeficiency virus in feline and nonfeline cell lines. Journal of Veterinary Medical Science 56, 19%201. TOYOSAKI, T., MIYAZAWA, T., FURUYA, T., TOMONAGA, K., SHIN, Y.-S., OKITA, M., KAWAGUCHI, Y., KAI, C., MORI, S. & MIKAMI., T. (1993). Localization of the viral antigen of the feline immunodeficiency virus in the lymph nodes of cats at the early stage of infection. Archives of Virology 131, YAMAMOTO, J.K., SPARGER, E., HO, E.W., ANDERSEN, P.R., O'CONNOR, T. P., MANDELL, C. P., LOWENSTINE, L., MUNN, R. & PEDERSEN, N.C. (1988). Pathogenesis of experimentally induced feline immunodeficiency virus infection in cats. American Journal of Veterinary Research 49, YAMAMOTO, J. K., OKUDA, Y., ACKLEY, C. D., LOUIE, H., ZOCHLINSKI, H., PEMBROKE, E. & GARDNER, M. B. (1991). Experimental vaccine protection against feline immunodeficiency virus. AIDS Research and Human Retroviruses 7, YAMAMOTO, J. K., HOHDATSU, T., OLMSTED, R. A., Pu, R., LOUIE, H., ZOCHLINSKI, H. m., ACEVEDO, V., JOHNSON, H. M., SOULDS, G. m. & GARDNER, M. B. (1993). Experimental vaccine protections against homologous and heterologous strains of feline immunodeficiency virus. Journal of Virology 67, (Received 13 February 1995; Accepted 19 May 1995)

Micropathology Ltd. University of Warwick Science Park, Venture Centre, Sir William Lyons Road, Coventry CV4 7EZ

Micropathology Ltd. University of Warwick Science Park, Venture Centre, Sir William Lyons Road, Coventry CV4 7EZ www.micropathology.com info@micropathology.com Micropathology Ltd Tel 24hrs: +44 (0) 24-76 323222 Fax / Ans: +44 (0) 24-76 - 323333 University of Warwick Science Park, Venture Centre, Sir William Lyons

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Construction and In Vitro Characterization of Attenuated Feline Immunodeficiency Virus Long Terminal Repeat Mutant Viruses

Construction and In Vitro Characterization of Attenuated Feline Immunodeficiency Virus Long Terminal Repeat Mutant Viruses JOURNAL OF VIROLOGY, Jan. 2001, p. 1054 1060 Vol. 75, No. 2 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.2.1054 1060.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Construction

More information

X/01/$ DOI: /JVI Copyright 2001, American Society for Microbiology. All Rights Reserved.

X/01/$ DOI: /JVI Copyright 2001, American Society for Microbiology. All Rights Reserved. JOURNAL OF VIROLOGY, Apr. 2001, p. 3753 3765 Vol. 75, No. 8 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.8.3753 3765.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Route of Simian

More information

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against

More information

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information

More information

HIV INFECTION: An Overview

HIV INFECTION: An Overview HIV INFECTION: An Overview UNIVERSITY OF PAPUA NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL MBBS II SEMINAR VJ

More information

DATA SHEET. Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter calf thymus DNA.

DATA SHEET. Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter calf thymus DNA. Viral Load DNA >> Standard PCR standard 0 Copies Catalog Number: 1122 Lot Number: 150298 Release Category: A Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter

More information

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Melissa Mihelidakis May 6, 2004 7.340 Research Proposal Introduction Apoptosis, or programmed cell

More information

Structural vs. nonstructural proteins

Structural vs. nonstructural proteins Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?

More information

Identification and Characterization of CD4 T cells actively transcribing HIV RNA in Peripheral Blood

Identification and Characterization of CD4 T cells actively transcribing HIV RNA in Peripheral Blood Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Identification and Characterization of CD4 T cells actively transcribing

More information

Downloaded from UvA-DARE, the institutional repository of the University of Amsterdam (UvA)

Downloaded from UvA-DARE, the institutional repository of the University of Amsterdam (UvA) Downloaded from UvA-DARE, the institutional repository of the University of Amsterdam (UvA) http://hdl.handle.net/11245/2.2816 File ID Filename Version uvapub:2816 26745y.pdf unknown SOURCE (OR PART OF

More information

Helper virus-free transfer of human immunodeficiency virus type 1 vectors

Helper virus-free transfer of human immunodeficiency virus type 1 vectors Journal of General Virology (1995), 76, 691 696. Printed in Great Britabz 691 Helper virus-free transfer of human immunodeficiency virus type 1 vectors Jennifer H. Riehardson,~ Jane F. Kaye, Lisa A. Child

More information

JANELLE MARISA NOVAK UNIVERSITY OF FLORIDA

JANELLE MARISA NOVAK UNIVERSITY OF FLORIDA ORF-A/2 DEFICIENT MOLECULAR CLONE OF FELINE IMMUNODEFICIENCY VIRUS (FIV) DEMONSTRATES DIMINISHED VIRAL GENE EXPRESSION IN LYMPHOID TISSUES OF NEONATAL CATS DURING ACUTE AND LATENT INFECTION By JANELLE

More information

HIV & AIDS: Overview

HIV & AIDS: Overview HIV & AIDS: Overview UNIVERSITY OF PAPUA NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL SEMINAR VJ TEMPLE 1 What

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness

Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)

More information

Mitochondrial DNA Isolation Kit

Mitochondrial DNA Isolation Kit Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

Diagnostic Methods of HBV infection. Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO)

Diagnostic Methods of HBV infection. Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO) Diagnostic Methods of HBV infection Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO) Hepatitis B-laboratory diagnosis Detection of HBV infection involves

More information

Last time we talked about the few steps in viral replication cycle and the un-coating stage:

Last time we talked about the few steps in viral replication cycle and the un-coating stage: Zeina Al-Momani Last time we talked about the few steps in viral replication cycle and the un-coating stage: Un-coating: is a general term for the events which occur after penetration, we talked about

More information

EBV infection B cells and lymphomagenesis. Sridhar Chaganti

EBV infection B cells and lymphomagenesis. Sridhar Chaganti EBV infection B cells and lymphomagenesis Sridhar Chaganti How EBV infects B-cells How viral genes influence the infected B cell Differences and similarities between in vitro and in vivo infection How

More information

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel

More information

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1999, p Vol. 43, No. 8. Copyright 1999, American Society for Microbiology. All Rights Reserved.

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1999, p Vol. 43, No. 8. Copyright 1999, American Society for Microbiology. All Rights Reserved. ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1999, p. 2017 2026 Vol. 43, No. 8 0066-4804/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Use of the Hepatitis B Virus

More information

HIV-DNA: nuovo marcatore virologico. Metodiche a confronto per la quantificazione di HIV-DNA

HIV-DNA: nuovo marcatore virologico. Metodiche a confronto per la quantificazione di HIV-DNA HIV-DNA: nuovo marcatore virologico Metodiche a confronto per la quantificazione di HIV-DNA Maria Carla Re Laboratorio Retrovirus e Agenti infettivi HIV correlati UO di Microbiologia, Università di Bologna

More information

Chapter 19: Viruses. 1. Viral Structure & Reproduction. 2. Bacteriophages. 3. Animal Viruses. 4. Viroids & Prions

Chapter 19: Viruses. 1. Viral Structure & Reproduction. 2. Bacteriophages. 3. Animal Viruses. 4. Viroids & Prions Chapter 19: Viruses 1. Viral Structure & Reproduction 2. Bacteriophages 3. Animal Viruses 4. Viroids & Prions 1. Viral Structure & Reproduction Chapter Reading pp. 393-396 What exactly is a Virus? Viruses

More information

Biol115 The Thread of Life"

Biol115 The Thread of Life Biol115 The Thread of Life" Lecture 9" Gene expression and the Central Dogma"... once (sequential) information has passed into protein it cannot get out again. " ~Francis Crick, 1958! Principles of Biology

More information

Received 29 December 1998/Accepted 9 March 1999

Received 29 December 1998/Accepted 9 March 1999 JOURNAL OF VIROLOGY, June 1999, p. 4794 4805 Vol. 73, No. 6 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Molecular Requirements for Human Immunodeficiency

More information

Diagnostic Methods of HBV and HDV infections

Diagnostic Methods of HBV and HDV infections Diagnostic Methods of HBV and HDV infections Zohreh Sharifi,ph.D Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine Hepatitis B-laboratory diagnosis Detection

More information

INSTRUCTION MANUAL. RNA Clean & Concentrator -5 Catalog Nos. R1015 & R1016. Highlights. Contents

INSTRUCTION MANUAL. RNA Clean & Concentrator -5 Catalog Nos. R1015 & R1016. Highlights. Contents INSTRUCTION MANUAL Catalog Nos. R1015 & R1016 Highlights Quick (5 minute) method for cleaning and concentrating RNA. Ideal for purification of RNA from aqueous phase following an acid phenol extraction.

More information

RNA/DNA Stabilization Reagent for Blood/Bone Marrow

RNA/DNA Stabilization Reagent for Blood/Bone Marrow For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. RNA/DNA Stabilization Reagent for Blood/Bone Marrow For simultaneous cell lysis and stabilization of nucleic acids

More information

LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication

LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication DEFINITIONS OF TERMS Eukaryotic: Non-bacterial cell type (bacteria are prokaryotes).. LESSON 4.4 WORKBOOK How viruses make us sick: Viral Replication This lesson extends the principles we learned in Unit

More information

Purification of viral nucleic acid from serum, plasma, cell-free biological fluids MACHEREY- NAGEL

Purification of viral nucleic acid from serum, plasma, cell-free biological fluids MACHEREY- NAGEL Purification of viral nucleic acid from serum, plasma, cell-free biological fluids Purification of viral nucleic acid from serum, plasma, cell-free biological fluids viral RNA: viral DNA: NucleoSpin RNA

More information

The Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7

The Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7 The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how they are expressed NA Structure

More information

AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT

AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT MoBiTec GmbH 2014 Page 2 Contents 1. Description... 3 2. Kit Contents... 3 3. Terms & Conditions... 3 4. AquaPreserve

More information

Lentiviruses: HIV-1 Pathogenesis

Lentiviruses: HIV-1 Pathogenesis Lentiviruses: HIV-1 Pathogenesis Human Immunodeficiency Virus, HIV, computer graphic by Russell Kightley Tsafi Pe ery, Ph.D. Departments of Medicine and Biochemistry & Molecular Biology NJMS, UMDNJ. e-mail:

More information

EXO-DNA Circulating and EV-associated DNA extraction kit

EXO-DNA Circulating and EV-associated DNA extraction kit Datasheet EXO-DNA Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.

More information

Development of 5 LTR DNA methylation of latent HIV-1 provirus in cell line models and in long-term-infected individuals

Development of 5 LTR DNA methylation of latent HIV-1 provirus in cell line models and in long-term-infected individuals Trejbalová et al. Clinical Epigenetics (2016) 8:19 DOI 10.1186/s13148-016-0185-6 RESEARCH Development of 5 LTR DNA methylation of latent HIV-1 provirus in cell line models and in long-term-infected individuals

More information

Patricia Fitzgerald-Bocarsly

Patricia Fitzgerald-Bocarsly FLU Patricia Fitzgerald-Bocarsly October 23, 2008 Orthomyxoviruses Orthomyxo virus (ortho = true or correct ) Negative-sense RNA virus (complementary to mrna) Five different genera Influenza A, B, C Thogotovirus

More information

Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana

Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana Biochemistry: Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana 38 CAMERON E. NIENABER ʻ04 Abstract Long recognized as essential plant nutrients and metabolites, inorganic and organic

More information

Chapter 13 Viruses, Viroids, and Prions. Biology 1009 Microbiology Johnson-Summer 2003

Chapter 13 Viruses, Viroids, and Prions. Biology 1009 Microbiology Johnson-Summer 2003 Chapter 13 Viruses, Viroids, and Prions Biology 1009 Microbiology Johnson-Summer 2003 Viruses Virology-study of viruses Characteristics: acellular obligate intracellular parasites no ribosomes or means

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Sensitization of the HIV-1-LTR upon Long Term Low Dose Oxidative Stress*

Sensitization of the HIV-1-LTR upon Long Term Low Dose Oxidative Stress* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 271, No. 36, Issue of September 6, pp. 21798 21802, 1996 1996 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Sensitization

More information

TRANSCRIPTION. DNA à mrna

TRANSCRIPTION. DNA à mrna TRANSCRIPTION DNA à mrna Central Dogma Animation DNA: The Secret of Life (from PBS) http://www.youtube.com/watch? v=41_ne5ms2ls&list=pl2b2bd56e908da696&index=3 Transcription http://highered.mcgraw-hill.com/sites/0072507470/student_view0/

More information

Transcription of the herpes simplex virus, type 1 genome during productive and quiescent. infection of neuronal and non-neuronal cells.

Transcription of the herpes simplex virus, type 1 genome during productive and quiescent. infection of neuronal and non-neuronal cells. JVI Accepts, published online ahead of print on 9 April 2014 J. Virol. doi:10.1128/jvi.00516-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 Transcription of the

More information

VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer

VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer VIRAL TITER COUNTS The best methods of measuring infectious lentiviral titer FLUORESCENCE CYCLES qpcr of Viral RNA SUMMARY Viral vectors are now routinely used for gene transduction in a wide variety of

More information

Packaging and Abnormal Particle Morphology

Packaging and Abnormal Particle Morphology JOURNAL OF VIROLOGY, OCt. 1990, p. 5230-5234 0022-538X/90/105230-05$02.00/0 Copyright 1990, American Society for Microbiology Vol. 64, No. 10 A Mutant of Human Immunodeficiency Virus with Reduced RNA Packaging

More information

Electron Microscope Studies of HeLa Cells Infected with Herpes Virus

Electron Microscope Studies of HeLa Cells Infected with Herpes Virus 244 STOKER, M. G. P., SMITH, K. M. & Ross, R. W. (1958). J. gen. Microbiol. 19,244-249 Electron Microscope Studies of HeLa Cells Infected with Herpes Virus BY M: G. P. STOKER, K. M. SMITH AND R. W. ROSS

More information

CDC site UNAIDS Aids Knowledge Base http://www.cdc.gov/hiv/dhap.htm http://hivinsite.ucsf.edu/insite.jsp?page=kb National Institute of Allergy and Infectious Diseases http://www.niaid.nih.gov/default.htm

More information

Midi Plant Genomic DNA Purification Kit

Midi Plant Genomic DNA Purification Kit Midi Plant Genomic DNA Purification Kit Cat #:DP022MD/ DP022MD-50 Size:10/50 reactions Store at RT For research use only 1 Description: The Midi Plant Genomic DNA Purification Kit provides a rapid, simple

More information

Towards a block and lock strategy: LEDGINs hamper the establishment of a reactivation competent HIV reservoir.

Towards a block and lock strategy: LEDGINs hamper the establishment of a reactivation competent HIV reservoir. Abstract no. MOLBPEA13 Towards a block and lock strategy: LEDGINs hamper the establishment of a reactivation competent HIV reservoir. G. Vansant,,A. Bruggemans, L. Vranckx, S. Saleh, I. Zurnic, F. Christ,

More information

For purification of viral DNA and RNA from a wide range of sample materials

For purification of viral DNA and RNA from a wide range of sample materials QIAamp virus kits For purification of viral DNA and RNA from a wide range of sample materials Automatable on QIAGEN s proven QIAamp Kits set the standard for purification of viral DNA and RNA. QIAamp virus

More information

HIV Diagnostic Testing

HIV Diagnostic Testing In The name of God HIV Diagnostic Testing By : Dr. Shahzamani PhD of Medical virology Purpose of HIV Testing To identify asymptomatic individuals To diagnose HIV infection in those who practice high risk

More information

10/18/2012. A primer in HLA: The who, what, how and why. What?

10/18/2012. A primer in HLA: The who, what, how and why. What? A primer in HLA: The who, what, how and why What? 1 First recognized in mice during 1930 s and 1940 s. Mouse (murine) experiments with tumors Independent observations were made in humans with leukoagglutinating

More information

VIRUSES. 1. Describe the structure of a virus by completing the following chart.

VIRUSES. 1. Describe the structure of a virus by completing the following chart. AP BIOLOGY MOLECULAR GENETICS ACTIVITY #3 NAME DATE HOUR VIRUSES 1. Describe the structure of a virus by completing the following chart. Viral Part Description of Part 2. Some viruses have an envelope

More information

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx 0115-041-00 Abstract The VERSANT HIV-1 RNA 1.0 Assay (kpcr) with product codes 10375763,

More information

In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described

In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described Supplemental Methods In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described previously 1 2 using 32P-labeled 211 bp fragment from 3 HS1. Footprinting reaction mixes contained

More information

Beyond the replication competent HIV reservoir: transcription and translation competent reservoirs

Beyond the replication competent HIV reservoir: transcription and translation competent reservoirs https://doi.org/10.1186/s12977-018-0392-7 Retrovirology REVIEW Open Access Beyond the replication competent HIV reservoir: transcription and translation competent reservoirs Amy E. Baxter 1,2, Una O Doherty

More information

Received 3 September 2002/Accepted 15 January 2003

Received 3 September 2002/Accepted 15 January 2003 JOURNAL OF VIROLOGY, Apr. 2003, p. 4646 4657 Vol. 77, No. 8 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.8.4646 4657.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Ability of

More information

Chapter 13B: Animal Viruses

Chapter 13B: Animal Viruses Chapter 13B: Animal Viruses 1. Overview of Animal Viruses 2. DNA Viruses 3. RNA Viruses 4. Prions 1. Overview of Animal Viruses Life Cycle of Animal Viruses The basic life cycle stages of animal viruses

More information

A Schematic Of The Life Cycle Of The

A Schematic Of The Life Cycle Of The A Schematic Of The Life Cycle Of The Lymphocytes Involved A wonderful and informative website to visit is from Johns Hopkins Medical Center Called "The Body". The ability of these viruses to infect lymphocytes

More information

7.013 Spring 2005 Problem Set 7

7.013 Spring 2005 Problem Set 7 MI Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor yler Jacks, Dr. Claudette Gardel 7.013 Spring 2005 Problem Set 7 FRIDAY May 6th, 2005 Question

More information

Product # Kit Components

Product # Kit Components 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information

More information

Activation of Human Immunodeficiency Virus Transcription in T Cells Revisited: NF- B p65 Stimulates Transcriptional Elongation

Activation of Human Immunodeficiency Virus Transcription in T Cells Revisited: NF- B p65 Stimulates Transcriptional Elongation JOURNAL OF VIROLOGY, Sept. 2001, p. 8524 8537 Vol. 75, No. 18 0022-538X/01/$04.00 0 DOI: 10.1128/JVI.75.18.8524 8537.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Activation

More information

CDC website:

CDC website: Hepatitis B virus CDC website: http://www.cdc.gov/ncidod/diseases/hepatitis/slideset/hep_b/slide_1.htm Relevance Key Features es of Hepatitis t B Virus 250 million people infected worldwide. In areas of

More information

Modeling and Simulation of HIV-1 Intracellular Replication

Modeling and Simulation of HIV-1 Intracellular Replication Modeling and Simulation of HIV-1 Intracellular Replication MSc Thesis Author Narges Zarrabi Supervisor: Prof. Dr. Peter M.A. Sloot Submitted to Faculty of Science in partial fullfilment of the requirments

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Alexander O. Pasternak, Mirte Scherpenisse, Ben Berkhout

Alexander O. Pasternak, Mirte Scherpenisse, Ben Berkhout Cell-associated HIV-1 unspliced to multiply spliced RNA ratio at 12 weeks ART correlates with markers of immune activation and apoptosis and predicts the CD4 + T-cell count at 96 weeks ART Alexander O.

More information

Effect of Azithromycin plus Rifampin versus That of Azithromycin Alone on the Eradication of Chlamydia pneumoniae

Effect of Azithromycin plus Rifampin versus That of Azithromycin Alone on the Eradication of Chlamydia pneumoniae Antimicrobial Agents and Chemotherapy, June 1999, p. 1491-1493, Vol. 43, No. 6 0066-4804/99/$04.00+0 Copyright 1999, American Society for Microbiology. All rights reserved. Effect of Azithromycin plus

More information

Chapter13 Characterizing and Classifying Viruses, Viroids, and Prions

Chapter13 Characterizing and Classifying Viruses, Viroids, and Prions Chapter13 Characterizing and Classifying Viruses, Viroids, and Prions 11/20/2017 MDufilho 1 Characteristics of Viruses Viruses Minuscule, acellular, infectious agent having either DNA or RNA Cause infections

More information

SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS:

SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS: SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS: POSSIBILITIES OF SEROLOGICAL DIAGNOSIS TYPES OF SEROLOGICAL REACTIONS SEROLOGICAL REACTIONS Ag-Ab reactions used for the detection of unknown Ag or Ab, in vitro

More information

Frequent Segregation of More-Defective Variants from a Rous Sarcoma Virus Packaging Mutant, TK15

Frequent Segregation of More-Defective Variants from a Rous Sarcoma Virus Packaging Mutant, TK15 JOURNAL OF VIROLOGY, Oct. 1987, p. 3208-3213 0022-538X/87/103208-06$02.00/0 Copyright 1987, American Society for Microbiology Vol. 61, No. 10 Frequent Segregation of More-Defective Variants from a Rous

More information

HTRF MEASUREMENT OF CYTOKINE RELEASE FROM FRESH BLOOD SAMPLES

HTRF MEASUREMENT OF CYTOKINE RELEASE FROM FRESH BLOOD SAMPLES HTRF MEASUREMENT OF CYTOKINE RELEASE FROM FRESH BLOOD SAMPLES APPLICATION NOTE ABSTRACT Cisbio offers a comprehensive line of HTRF cytokine assays to investigate the functional response of immune cells.

More information

Hepadnaviruses: Variations on the Retrovirus Theme

Hepadnaviruses: Variations on the Retrovirus Theme WBV21 6/27/03 11:34 PM Page 377 Hepadnaviruses: Variations on the Retrovirus Theme 21 CHAPTER The virion and the viral genome The viral replication cycle The pathogenesis of hepatitis B virus A plant hepadnavirus

More information

Induction of Interferon in Chick Cells by Temperaturesensitive Mutants of Sindbis Virus

Induction of Interferon in Chick Cells by Temperaturesensitive Mutants of Sindbis Virus J. gen. ViroL 0974), 25, 381-39o Printed in Great Britain 38I Induction of Interferon in Chick Cells by Temperaturesensitive Mutants of Sindbis Virus By G. J. ATKINS, M. D. JOHNSTON, LINDA M. WESTMACOTT

More information

Viruses Tomasz Kordula, Ph.D.

Viruses Tomasz Kordula, Ph.D. Viruses Tomasz Kordula, Ph.D. Resources: Alberts et al., Molecular Biology of the Cell, pp. 295, 1330, 1431 1433; Lehninger CD Movie A0002201. Learning Objectives: 1. Understand parasitic life cycle of

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-cfDNA Serum & Plasma Kit Catalog No. D4076 Highlights High-quality DNA, including cell-free, is easily and robustly purified from up to 10 ml of serum/plasma, up to 1 ml amniotic

More information

Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set

Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set Catalog Number : SEK11695 To achieve the best assay results, this manual must be read carefully before using this product

More information

CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES

CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES [Frontiers in Bioscience 5, d527-555, May 1, 2000] CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES Betty Lamothe, Sadhna Joshi Department of Medical

More information

Julianne Edwards. Retroviruses. Spring 2010

Julianne Edwards. Retroviruses. Spring 2010 Retroviruses Spring 2010 A retrovirus can simply be referred to as an infectious particle which replicates backwards even though there are many different types of retroviruses. More specifically, a retrovirus

More information

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC

More information

E.Z.N.A. SQ Blood DNA Kit II. Table of Contents

E.Z.N.A. SQ Blood DNA Kit II. Table of Contents E.Z.N.A. SQ Blood DNA Kit II Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Blood Storage and DNA Yield...4 Preparing Reagents...5 100-500 μl Whole Blood Protocol...6

More information

Reverse Transcription PCR (RT-PCR): The Molecular Biology of HIV Replication

Reverse Transcription PCR (RT-PCR): The Molecular Biology of HIV Replication Revised and Updated 335 Edvo-Kit #335 Reverse Transcription PCR (RT-PCR): The Molecular Biology of HIV Replication Experiment Objective: The objective of this experiment is for students to gain an understanding

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Blocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro

Blocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro Blocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro Y.-B. Deng, H.-J. Qin, Y.-H. Luo, Z.-R. Liang and J.-J. Zou

More information

Host-Specific Modulation of the Selective Constraints Driving Human Immunodeficiency Virus Type 1 env Gene Evolution

Host-Specific Modulation of the Selective Constraints Driving Human Immunodeficiency Virus Type 1 env Gene Evolution JOURNAL OF VIROLOGY, May 1999, p. 3764 3777 Vol. 73, No. 5 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Host-Specific Modulation of the Selective Constraints

More information

number Done by Corrected by Doctor Ashraf

number Done by Corrected by Doctor Ashraf number 4 Done by Nedaa Bani Ata Corrected by Rama Nada Doctor Ashraf Genome replication and gene expression Remember the steps of viral replication from the last lecture: Attachment, Adsorption, Penetration,

More information

The DNA -> RNA -> Protein Pathway

The DNA -> RNA -> Protein Pathway The DNA -> RNA -> Protein Pathway RNA Polymerase = enzyme that makes mrna from the DNA gene template http://www.bioteach.ubc.ca/molecularbiology/amonksflourishinggarden/ Plus-strand RNA Viruses Plus-strand

More information

ABSTRACT. HIV-induced immunodeficiency may be mediated by the activation of

ABSTRACT. HIV-induced immunodeficiency may be mediated by the activation of ABSTRACT MEXAS, ANGELA MARIE. CD4 + CD25 + Regulatory T Cells Are Infected and Activated Phenotypically and Functionally During Acute Infection with Feline Immunodeficiency Virus. (Under the direction

More information

Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University

Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University Greenwald 1 Mouse intercellular adhesion molecule 1 (ICAM-1) isoforms demonstrate different binding affinities to mouse macrophage-1 antigen (Mac-1) and preliminary evidence for alternatively-spliced variants

More information

Construction of a Full Transcription Map of Human Papillomavirus Type 18 during Productive Viral Infection

Construction of a Full Transcription Map of Human Papillomavirus Type 18 during Productive Viral Infection JOURNAL OF VIROLOGY, Aug. 2011, p. 8080 8092 Vol. 85, No. 16 0022-538X/11/$12.00 doi:10.1128/jvi.00670-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Construction of a Full

More information

An Internally Controlled Virion PCR for the Measurement of HIV-1 RNA in Plasma

An Internally Controlled Virion PCR for the Measurement of HIV-1 RNA in Plasma An Internally Controlled Virion PCR for the Measurement of HIV-1 RNA in Plasma V. Natarajan, R.J. Plishka, E.W. Scott, H.C. Lane, 1 and N.P. Salzman Laboratory of Molecular Retrovirology, Deptartment of

More information

Transcription and RNA processing

Transcription and RNA processing Transcription and RNA processing Lecture 7 Biology 3310/4310 Virology Spring 2018 It is possible that Nature invented DNA for the purpose of achieving regulation at the transcriptional rather than at the

More information

Panther has new prey

Panther has new prey Raising the Bar for Performance Testing Panther has new prey The Aptima HIV-1 Quant Dx assay leads the hunt for HIV-1 diagnosis and viral load monitoring. Freedom to work the way you choose Run what assays

More information

Comparison of Anti-Hepatitis B Virus Activities of Lamivudine and Clevudine by a Quantitative Assay

Comparison of Anti-Hepatitis B Virus Activities of Lamivudine and Clevudine by a Quantitative Assay ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Jan. 2003, p. 324 336 Vol. 47, No. 1 0066-4804/03/$08.00 0 DOI: 10.1128/AAC.47.1.324 336.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved.

More information

HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES. Elizabeth Susan Russell

HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES. Elizabeth Susan Russell HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES Elizabeth Susan Russell A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial

More information

Hepatitis B Virus infection: virology

Hepatitis B Virus infection: virology Hepatitis B Virus infection: virology 167 Falk Symposium: Liver under constant attack from fat to viruses III Falk Gastro-Konferenz 17.-21. September 2008 Congress Centrum Mainz Maura Dandri Department

More information

Molecularly Cloned Feline Immunodeficiency Virus NCSU 1 JSY3 Induces Immunodeficiency in Specific-Pathogen-Free Cats

Molecularly Cloned Feline Immunodeficiency Virus NCSU 1 JSY3 Induces Immunodeficiency in Specific-Pathogen-Free Cats JOURNAL OF VIROLOGY, May 1996, p. 3011 3017 Vol. 70, No. 5 0022-538X/96/$04.00 0 Copyright 1996, American Society for Microbiology Molecularly Cloned Feline Immunodeficiency Virus NCSU 1 JSY3 Induces Immunodeficiency

More information

Simple Solutions for Patient Monitoring. Maximum Flexibility 2 Configuration: 8 to 1000 viral load tests/day 2 Sample: Plasma/DBS

Simple Solutions for Patient Monitoring. Maximum Flexibility 2 Configuration: 8 to 1000 viral load tests/day 2 Sample: Plasma/DBS Simple Solutions for Patient Monitoring What is the interest of having a high level of sensitivity? Higher sensitivity means you are able to offer better patient monitoring, particularly in the low viral

More information

LABORATORY DIAGNOSIS OF VIRAL INFECTIONS. Methods of viral identification

LABORATORY DIAGNOSIS OF VIRAL INFECTIONS. Methods of viral identification LABORATORY DIAGNOSIS OF VIRAL INFECTIONS Methods of viral identification Viral (direct) diagnosis Cell culture Embryonated eggs Laboratory animals ISOLATION OF VIRUSES CPE Interference Hemadsorption Pocks

More information