T H E J O U R N A L O F C E L L B I O L O G Y
|
|
|
- Kathleen Kelley
- 6 years ago
- Views:
Transcription
1 T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Stelter et al., S1
2 Figure S1. Dyn2 recruitment to edid-labeled FG domain Nups. (A) Schematic drawing of a Nsp1-eDID construct. Insertion of engineered dynein light chain interacting domain (edid) followed by the Flag epitope (tag) and a LoxP site (for recombination) into the Nsp1 FG repeat nucleoporin. edid is composed of six dynein light chain QT binding motifs in a row derived from the dynein intermediate chain Pac11(previously called DID1; Flemming et al., 2010). The amino acid position within the 823-residue-long Nsp1 is indicated, at which edid, Flag, and loxp were inserted. The different domains of Nsp1 are further indicated. (B) Expression of the Nup-eDID constructs and Dyn2 (pgal-dyn2) after 3-h galactose induction. Whole-cell lysates were separated by SDS-PAGE, blotted onto nitrocellulose, and incubated with anti-flag, anti-dyn2, and anti-arc1 (loading control) antibodies. Wild-type cells revealing endogenous Dyn2 expression (lane 1), dyn2 cells + pgal-dyn2 (lane 2), NSP1-eDID + pgal-dyn2 (lane 3), NSP1-eDID(2) + pgal-dyn2 (lane 4), NUP159 DID-eDID + pgal-dyn2 (lane 5), NUP49-eDID + pgal-dyn2 (lane 6), NUP57-eDID + pgal-dyn2 (lane 7), NUP2-eDID+ pgal-dyn2 (lane 8), NUP1-eDID + pgal-dyn2 (lane 9), and NUP116-eDID + pgal-dyn2 (lane 10). (C) Coenrichment of Dyn2 with the indicated Nup-eDID constructs. NUP-eDID dyn2 strains expressing pgal-dyn2 were lysed after 3-h galactose induction before the indicated TAP constructs were affinity purified. NUP49- TAP expressing NSP1-eDID (lane 1) and NUP1-eDID-TAP (lane 2), NUP60-TAP expressing NUP2-eDID (lane 3), NUP82-TAP expressing NUP159 DID-eDID- FG Nsp1 (lane 4), NUP82-TAP expressing NUP159 DID-eDID (lane 5), NUP116-eDID-TAP NUP159 DID (lane 6), and NUP116-eDID-TAP (lane 7). (D) Dyn2-dependent dimerization of modified edid Nups. Affinity purification from strain lysates NIC96-TAP NUP49-eDID (lanes 1 and 2) and NUP82-TAP NUP159-eDID (lanes 3 and 4) in the presence (lanes 2 and 4) or absence of Dyn2 (lanes 1 and 3), which coexpress GFP-Nup82 and GFP-Nic96, respectively. Eluates and homogenates (HOM) were analyzed by SDS-PAGE and Coomassie blue staining or Western blotting (E) Expression levels of NUP159 DIDeDID-FG Nsp1 and NUP159 DID-eDID-FG Nup1 + pgal::dyn2 after 3-h galactose induction. Wild-type cells showing endogenous Dyn2 expression (lane 1), dyn2 cells + pgal::dyn2 (lane 2), dyn2 NUP159 DID cells + pgal::dyn2 (lane 3), dyn2 NUP159 DID-eDID-FG Nsp1 + pgal::dyn2 (lane 4), and dyn2 NUP159 DID-eDID-FG Nup1 + pgal::dyn2 (lane 5). Whole-cell lysates were boiled in SDS sample buffer and analyzed by SDS-PAGE and Western blotting using anti-dyn2, anti-flag, and anti-arc1 (equal loading) antibodies. CBP, calmodulin-binding peptide S2
3 Figure S2. Analysis of 60S and 40S ribosome export in edid-labeled FG Nups. (A) Nuclear export of the 60S ribosomal subunit. Indicated strains were transferred to YPR medium for 4 h, and Dyn2 expression was induced by the addition of galactose (t 0 ; uninduced) and further incubated for 4 h (induced). Localization of Rpl25-GFP and mrfp-nop1 (nucleolar marker) was analyzed under the fluorescence microscope. (B) Localization of 20S prerna and larger precursors. Indicated strains were transferred to YPR medium for 4 h (uninduced), and Dyn2 expression was induced for additional 2 h by addition of galactose (induced). In situ hybridization using a Cy3 fluorescently labeled oligonucleotide probe complementary to the ITS1 region was performed. DNA was stained with DAPI. Bars, 2 µm. S3
4 Figure S3. Analysis of growth and nucleocytoplasmic transport of NUP-eDID + pgal-dyn2 strains transformed with the respective wild-type Nups. (A) NUP49-eDID, NUP57-eDID, NSP1-eDID, and NUP1-eDID were either transformed with pgal-dyn2 or pgal-dyn2 + NUP wild type or NUP wild type alone and spotted on SGC-Leu/-Ura and SDC-Leu/-Ura plates. (B) Poly(A) + RNA was analyzed by in situ hybridization with a Cy3-labeled oligo d(t) probe, and DNA was stained with DAPI. Bar, 5 µm. S4
5 Table S1. Yeast strains used in this study Strains Genotype References RS453 a MATa or ade2 his leu trp1 ura3-52 Grandi et al., 1995 Ds1-2b c MAT leu2-1 trp1-63 his3-200 ura3-52 Baßler et al., 2001 dyn2 b MAT leu2-1 trp1-63 his3-200 ura3-52 dyn2::loxp Nsp1-eDID dyn2 b edid-loxp at position 275 aa dyn2::loxp Nsp1-eDID(2) dyn2 b edid-loxp at position 2 aa dyn2::loxp Nup1-eDID dyn2 b edid-loxp at position 717 aa dyn2::loxp Nup2-eDID dyn2 b edid-loxp at position 407 aa dyn2::loxp Nup57-eDID dyn2 b edid-loxp at position 71 aa dyn2::loxp Nup49-eDID dyn2 b edid-loxp at position 81 aa dyn2::loxp Nup159 DID-eDID dyn2 a edid-loxp at position 624 aa nup159::kanmx4 dyn2::kanmx4 -edid Nup159 DID-eDID(2) dyn2 a edid-loxp at position 904 aa nup159::kanmx4 dyn2::kanmx4 2 -edid Nup116-eDID dyn2 b edid-loxp at position 197 aa dyn2::loxp Nup159 DID Nsp1-eDID dyn2 a nup159::kanmx4 dyn2::kanmx4, DID-LoxP in NSP1 at position 275 Nsp1-eDID dyn2 Nup159 DID b edid-loxp at position 275 aa dyn2::loxp nup159::hismx6 Nup1-eDID dyn2 Nup159 DID b edid-loxp at position 717 aa dyn2::loxp nup159::hismx6 Nup2-eDID dyn2 Nup159 DID b edid-loxp at position 407 aa dyn2::loxp nup159::hismx6 Nup49-eDID dyn2 Nup159 DID b edid-loxp at position 81 aa dyn2::loxp nup159::hismx6 Nup116-eDID dyn2 Nup159 DID b edid-loxp at position 197 aa dyn2::loxp nup159::hismx6 Nup116-eDID-TAP dyn2 b edid-loxp at position 197 aa dyn2::loxp NUP116-TAP::URA3 Nup116-eDID-TAP dyn2 Nup159 DID b edid-loxp at position 197 aa dyn2::loxp NUP116-TAP:: URA3 nup159::hismx6 Nup1-eDID-TAP dyn2 b edid-loxp at position 717 aa dyn2::loxp NUP1-TAP::URA3 Nup2-eDID Nup60-TAP dyn2 b edid-loxp at position 407 aa dyn2::loxp NUP60-TAP::URA3 Nsp1-eDID dyn2 Nup49-TAP b edid-loxp at position 275 aa dyn2::loxp NUP49-TAP::URA3 Nup159 DID-eDID Nup82-TAP dyn2 a edid-loxp at position 624 aa nup159::kanmx4 dyn2::kanmx4 -edid NUP82-TAP::URA3 Nup49-eDID Nic96-TAP dyn2 b edid-loxp at position 81 aa dyn2::loxp NIC96-TAP::URA3 Nup159 DID dyn2 a nup159::kanmx4 dyn2::kanmx4 Stelter et al., 2007 Nup159 dyn2 a nup159::kanmx4 dyn2::kanmx4 prs414-nup159 Stelter et al., 2007 dyn2 GAL::Dyn2 b GAL-DYN2::HISMX6 dyn2::loxp Nsp1-eDID dyn2 GAL::DYN2 b GAL-DYN2:: HISMX6 dyn2::loxp dyn2 Pho4-GFP GAL::DYN2 b PHO4-GFP::natNT2 GAL-DYN2::HISMX6 dyn2::loxp Nsp1-eDID dyn2 Pho4-GFP b PHO4-GFP::natNT2 dyn2::loxp Nsp1-eDID dyn2 Pho4-GFP GAL:: PHO4-GFP::natNT2 GAL-DYN2::HISMX6 dyn2::loxp DYN2 b Nup57-TAP GAL::DYN2 c NUP57-TAP::TRP1 GAL-DYN2::HISMX6 Nup57-TAP Nsp1-eDID dyn2 b NUP57-TAP::TRP1 dyn2::loxp Nup57-TAP Nsp1-eDID dyn2 GAL:: NUP57-TAP::TRP1 GAL-DYN2::HISMX6 dyn2::loxp DYN2 b nup159 /dyn2 shuffle a nup159::kanmx4 dyn2::kanmx4 plg4 Stelter et al., 2007 nup159 /dyn2 GAL::DYN2 shuffle a nup159::kanmx4 dyn2::kanmx4 GAL-DYN2::HISMX6 plg4 nsp1 /nup57 dyn2 shuffle a nsp1::his3 nup57::his3 dyn2::kanmx4 pch1122-nsp1 prs314-gfp-nup57 Nup159 DID-FG Nsp1 dyn2 a nup159::kanmx4 dyn2::kanmx4 -edid-fg NSP1 Nup159 DID-FG Nup1 dyn2 a nup159::kanmx4 dyn2::kanmx4 -edid-fg NUP1 Nup159 dyn2 a nup159::kanmx4 dyn2::kanmx4 prs414-nup159 Nup159 DID dyn2 a nup159::kanmx4 dyn2::kanmx4 Nup159 DID-FG Nsp1 dyn2 a nup159::kanmx4 dyn2::kanmx4 -FG NSP1 Nup159 DID-eDID-FG Nsp1 dyn2 a nup159::kanmx4 dyn2::kanmx4 -edid-fg Nsp1 Nup82-TAP Nup159 DID dyn2 a S5
6 Table S1. Yeast strains used in this study (Continued) Strains Genotype References Nup82-TAP Nup159 DID-eDID-FG Nsp1 dyn2 a Nup82-TAP Nup159 DID-FG Nsp1 dyn2 a Nup82-TAP Nup159 DID Nsp1-eDID dyn2 a Nup82-TAP Nup159 DID-eDID-FG Nsp1 dyn2 a -edid-fg Nsp1 -FG Nsp1 NUP82-TAP::URA3 nup159::kanmx4 dyn2: kanmx4 prs414-nup159 DID -edid-fg Nsp1 GAL::DYN2 dyn2 a GAL-DYN2::HISMX6 dyn2::loxp Nup57-FG Nsp1 Nsp1 FG dyn2 a nsp1::his3 nup57::his3 dyn2::kanmx4 psb32-p ADH1 -NSP1 FG prs314-p NOP1 -NUP57-FG NSP1 Nup57-eDID-FG Nsp1 Nsp1 FG dyn2 a nsp1::his3 nup57::his3 dyn2::kanmx4 psb32-p ADH1 -NSP1 FG prs314-p NOP1 -NUP57-eDID-FG NSP1 a RS453 genetic background. b Ds1-2b genetic background. c dyn2 genetic background. Table S2. Plasmids used in this study Plasmids Comments References prs414-nup159 Stelter et al., 2007 Stelter et al., 2007 prs414-nup159-edid prs414-nup159 DID-eDID 623 edid-flag PCR amplified from pfa6aloxp-edid-flag-loxp-hismx4 and cloned as Bgl2 in the BamH1 cut prs414-nup159 DID - FG NSP1 edid-fg NSP1 edid-fg NUP1 prs314-p NOP1 prs314-p NOP1 -NUP57 FG prs314-p NOP1 -NUP57- FG NSP1 prs314-p NOP1 -NUP57- edid-fg NSP1 pura3 mrfp-nop1 RPL25-EGFP FG NSP1 (1 591 aa) was PCR amplified from genomic DNA from a wild-type strain and cloned as Pst1 Apa1 in prs414-nup159 DID edid-fg NSP1 (1 591 aa + edid-flag-loxp) was PCR amplified from genomic DNA from a NSP1-eDID dyn2 and cloned as Pst1 Apa1 in prs414-nup159 DID edid-fg NUP1 (382 1,076 aa + edid-flag-loxp) was PCR amplified from genomic DNA from a NUP1-eDID dyn2 and cloned as Pst1 Apa1 in prs414-nup159 DID NOP1 Promoter was cloned as BamH1 EcoR1 in prs314 and a Nde1 restriction site was created before the EcoR1 Nup57 FG( aa) was PCR amplified from genomic DNA and cloned as EcoR1 Xho1 in prs314-p NOP1 FG NSP1 (1 591 aa) was PCR amplified from genomic DNA from a wild-type strain and cloned as Nde1 in prs314-p NOP1 -Nup57 FG edid-fg NSP1 (1 591 aa + edid-flag-loxp) was PCR amplified from genomic DNA from a NSP1-eDID dyn2 and cloned as Nde1 in prs314-p NOP1 -Nup57 FG Ulbrich et al., 2009 YEp351-GAL-DYN2 DYN2 PCR amplified and cloned as BamH1 Hind3 Yep352-GAL-DYN2 DYN2 PCR amplified and cloned as BamH1 Hind3 Yep352-GAL-DYN2-GFP DYN2-GFP was a PCR amplified from DYN2-GFP (Stelter et al., 2007) strain and cloned as BamH1 Hind3 in Yep352-GAL-DYN2 plasmid prs303-gal::dyn2 prs303-gal::dyn2::his3 pfa6a-edid-flag-loxp- HindIII-eDID-BamH1-Flag-Sal1-loxP-HISMX4-loxP HISMX4-loxP pun100-nup49 Subcloned from genomic library plasmid (3.5 kb) prs315-nup57 Subcloned from genomic library plasmid psb32-nsp1 Subcloned from genomic library plasmid pun100-nup1 Subcloned from genomic library plasmid S6
7 References Baßler, J., P. Grandi, O. Gadal, T. Lessmann, E. Petfalski, D. Tollervey, J. Lechner, and E. Hurt Identification of a 60S preribosomal particle that is closely linked to nuclear export. Mol. Cell. 8: Flemming, D., K. Thierbach, P. Stelter, B. Böttcher, and E. Hurt Precise mapping of subunits in multiprotein complexes by a versatile electron microscopy label. Nat. Struct. Mol. Biol. 17: Grandi, P., N. Schlaich, H. Tekotte, and E.C. Hurt Functional interaction of Nic96p with a core nucleoporin complex consisting of Nsp1p, Nup49p and a novel protein Nup57p. EMBO J. 14: Stelter, P., R. Kunze, D. Flemming, D. Höpfner, M. Diepholz, P. Philippsen, B. Böttcher, and E. Hurt Molecular basis for the functional interaction of dynein light chain with the nuclear-pore complex. Nat. Cell Biol. 9: Ulbrich, C., M. Diepholz, J. Bassler, D. Kressler, B. Pertschy, K. Galani, B. Böttcher, and E. Hurt Mechanochemical removal of ribosome biogenesis factors from nascent 60S ribosomal subunits. Cell. 138: S7
Supplemental material
THE JOURNAL OF CELL BIOLOGY Supplemental material Gaik et al., http://www.jcb.org/cgi/content/full/jcb.201411003/dc1 Figure S1. -Helically predicted domain of Nup159 are conserved among fungi. Multi-sequence
Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene
Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene YUELIN ZHANG, WEIHUA FAN, MARK KINKEMA, XIN LI, AND
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Lu et al., http://www.jcb.org/cgi/content/full/jcb.201012063/dc1 Figure S1. Kinetics of nuclear envelope assembly, recruitment of Nup133
Overview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System
Overview of the Expressway Cell-Free Expression Systems The Expressway Cell-Free Expression Systems use an efficient coupled transcription and translation reaction to produce up to milligram quantities
Growth of the tps1 strain and tps1 suppressor strains in rich liquid medium with
OD 6 YP Galactose.8.6.4..8.6 5 5 5 3 35 4 45 5 Time (h) tps tps ras tps + ppde OD 6 YP Glucose.8.6.4..8.6 5 5 5 3 35 4 45 5 Time (h) Supplementary Fig. Growth of the tps strain and tps suppressor strains
Supplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Variation in the HindlII Restriction Fragments of DNA from the Chinese Tian Tan Strain of Vaccinia Virus
J. gen. irol. (1985), 66, 1819-1823. Printed in Great Britain 1819 Key words: vaccinia virus~vaccine~restriction Jragrnent variation ariation in the Hindl Restriction Fragments of DNA from the Chinese
Supplementary Information
Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
Materials and Methods , The two-hybrid principle.
The enzymatic activity of an unknown protein which cleaves the phosphodiester bond between the tyrosine residue of a viral protein and the 5 terminus of the picornavirus RNA Introduction Every day there
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded
The RasGAP Proteins Ira2 and Neurofibromin Are Negatively Regulated by Gpb1 in Yeast and ETEA in Humans
MOLECULAR AND CELLULAR BIOLOGY, May 2010, p. 2264 2279 Vol. 30, No. 9 0270-7306/10/$12.00 doi:10.1128/mcb.01450-08 Copyright 2010, American Society for Microbiology. All Rights Reserved. The RasGAP Proteins
The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1
The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Tel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
Expression constructs
Gene expressed in bebe3 ZmBEa Expression constructs 35S ZmBEa Pnos:Hygromycin r 35S Pnos:Hygromycin r 35S ctp YFP Pnos:Hygromycin r B -1 Chl YFP- Merge Supplemental Figure S1: Constructs Used for the Expression
Study of different types of ubiquitination
Study of different types of ubiquitination Rudi Beyaert (rudi.beyaert@irc.vib-ugent.be) VIB UGent Center for Inflammation Research Ghent, Belgium VIB Training Novel Proteomics Tools: Identifying PTMs October
SUPPLEMENTARY INFORMATION
with metaphase spindles DOI: 1.1/ncb315 a 23 C 25 C 28 C 3 C Wild type cdc14-3 cdc5-1 cdc5-2 cdc14-3 cdc5-1 cdc14-3 cdc5-2 23 C 25 C 28 C 3 C Wild type cdc14-3 cdc14-3 23 C 25 C 28 C 3 C Wild type cdc5-1
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2480 a ~250 kda ~130 ~95 ~72 ~250 kda anti ypk1δ ypk2δ D239A S641A T659A tor2δ YPK2 ypk2δ CherryYPK1 unspecific crossreaction Cherry c b D239A S641A T659A YPK2 D239A S641A T659A tor2δ YPK2
s u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
Transient Ribosomal Attenuation Coordinates Protein Synthesis and Co-translational Folding
SUPPLEMENTARY INFORMATION: Transient Ribosomal Attenuation Coordinates Protein Synthesis and Co-translational Folding Gong Zhang 1,2, Magdalena Hubalewska 1 & Zoya Ignatova 1,2 1 Department of Cellular
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
Supplementary table 1
Supplementary table 1 S. pombe strain list Fig. 1A JX38 h + ade6-m216 nda3-km311 PX476 PW775 PX545 PX546 h- ade6-m216 sgo2::ura4 + nda3-km311 h 9 mad2::ura4 + nda3-km311 h + ade6-m21 nda3-km311 rad21 +
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton
N α -Acetylation of yeast ribosomal proteins and its effect on protein synthesis
JOURNAL OF PROTEOMICS 74 (2011) 431 441 available at www.sciencedirect.com www.elsevier.com/locate/jprot N α -Acetylation of yeast ribosomal proteins and its effect on protein synthesis Masahiro Kamita
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
Dramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its
Supplementary Information Dramatic increase in SHP2 binding activity of Helicobacter pylori Western CagA by EPIYA-C duplication: its implications in gastric carcinogenesis Lisa Nagase, Takeru Hayashi,
Nature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
Novel FMD vaccine research in China
Novel FMD vaccine research in China International Conference on Scientific Developments and Technical Challenges in the Progressive Control of FMD in South Asia New Delhi, India 13-15 February, 2011 Dr.
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Introduction 1/3. The protagonist of our story: the prokaryotic ribosome
Introduction 1/3 The protagonist of our story: the prokaryotic ribosome Introduction 2/3 The core functional domains of the ribosome (the peptidyl trasferase center and the decoding center) are composed
effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
WDR62 is associated with the spindle pole and mutated in human microcephaly
WDR62 is associated with the spindle pole and mutated in human microcephaly Adeline K. Nicholas, Maryam Khurshid, Julie Désir, Ofélia P. Carvalho, James J. Cox, Gemma Thornton, Rizwana Kausar, Muhammad
Supplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
RECAP FROM MONDAY AND TUESDAY LECTURES
RECAP FROM MONDAY AND TUESDAY LECTURES Nucleo-cytoplasmic transport factors: interact with the target macromolecule (signal recognition) interact with the NPC (nucleoporin Phe - Gly repeats) NPC cytoplasmic
Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome
Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic
MOLECULAR CELL BIOLOGY
1 Lodish Berk Kaiser Krieger scott Bretscher Ploegh Matsudaira MOLECULAR CELL BIOLOGY SEVENTH EDITION CHAPTER 13 Moving Proteins into Membranes and Organelles Copyright 2013 by W. H. Freeman and Company
Prolonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Supplemental Information. Figures. Figure S1
Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the
Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast
Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
Supporting Information
Supporting Information Fig. S1. Overexpression of Rpr causes progenitor cell death. (A) TUNEL assay of control intestines. No progenitor cell death could be observed, except that some ECs are undergoing
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
Following Temperature Stress, Export of Heat Shock mrna Occurs Efficiently in Cells with Mutations in Genes Normally Important for mrna Export
EUKARYOTIC CELL, Mar. 2007, p. 505 513 Vol. 6, No. 3 1535-9778/07/$08.00 0 doi:10.1128/ec.00317-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Following Temperature Stress,
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
Supplementary Information
Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
SUPPLEMENTAL DATA RESULTS
SUPPLEMENTAL DATA RESULTS Ded1-mediated ribosomal scanning is less leaky than scanning promoted by eifs 4A/4B/4F. The efficiency of leaky scanning in the presence of Ded1 or of eifs 4A/4B/4F was investigated
2-D DIGE * 1,2. * src Src ras 2002 LC-MS/ MS. prefractionation. Proteome Letters
Proteome Letters 2016 1 11-18 2015 2-D DIGE * 1,2 *E-mail: hattoris@pharm.kitasato-u.ac.jp 1 108-8639 4-6-1 2 108-8641 5-9-1 2016 4 22 2016 5 31 2016 6 1 two-dimensional fluorescence difference gel electrophoresis:
(B D) Three views of the final refined 2Fo-Fc electron density map of the Vpr (red)-ung2 (green) interacting region, contoured at 1.4σ.
Supplementary Figure 1 Overall structure of the DDB1 DCAF1 Vpr UNG2 complex. (A) The final refined 2Fo-Fc electron density map, contoured at 1.4σ of Vpr, illustrating well-defined side chains. (B D) Three
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR
Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)
Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor
Synthesis and elongation of fatty acids
Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
Supplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
Telomerase RNA TLC1 Shuttling to the Cytoplasm Requires mrna Export Factors and Is Important for Telomere Maintenance
Report Telomerase RNA TLC1 Shuttling to the Cytoplasm Requires mrna Export Factors and Is Important for Telomere Maintenance Graphical Abstract Authors Haijia Wu, Daniel Becker, Heike Krebber Correspondence
Supplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation
Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha
Edinburgh Research Explorer
Edinburgh Research Explorer Genetic and physical interactions involving the yeast nuclear cap-binding complex Citation for published version: Fortes, P, Kufel, J, Fornerod, M, Polycarpou-Schwarz, M, Lafontaine,
Biology Open (2014) 000, 1 10 doi: /bio
(2014) 000, 1 10 doi:10.1242/bio.201410041 Supplementary Material Michael Brauchle et al. doi: 10.1242/bio.201410041 Fig. S1. Alignment of GFP, sfgfp, egfp, eyfp, mcherry and mruby2. Sequence-based alignment
CHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)
CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar
Supplemental Figures Legends and Supplemental Figures. for. pirna-guided slicing of transposon transcripts enforces their transcriptional
Supplemental Figures Legends and Supplemental Figures for pirn-guided slicing of transposon transcripts enforces their transcriptional silencing via specifying the nuclear pirn repertoire Kirsten-ndré
Conditional and reversible disruption of essential herpesvirus protein functions
nature methods Conditional and reversible disruption of essential herpesvirus protein functions Mandy Glaß, Andreas Busche, Karen Wagner, Martin Messerle & Eva Maria Borst Supplementary figures and text:
Structural vs. nonstructural proteins
Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?
Recombinant Protein Expression Retroviral system
Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential
EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
Bio 401 Sp2014. Multiple Choice (Circle the letter corresponding to the correct answer)
MIDTERM EXAM KEY (60 pts) You should have 5 pages. Please put your name on every page. You will have 70 minutes to complete the exam. You may begin working as soon as you receive the exam. NOTE: the RED
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Molecular Biology (BIOL 4320) Exam #2 May 3, 2004
Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number. Good
Expanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
TITLE: The Role of hcdc4 as a Tumor Suppressor Gene in Genomic Instability Underlying Prostate Cancer
AD Award Number: TITLE: The Role of hcdc4 as a Tumor Suppressor Gene in Genomic Instability Underlying Prostate Cancer PRINCIPAL INVESTIGATOR: Audrey van Drogen, Ph.D. CONTRACTING ORGANIZATION: Sidney
SUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong