basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman
|
|
- Alexis Malone
- 5 years ago
- Views:
Transcription
1 D15001 C Angiopoietin 1 (HeLa cell-derived), (Ang-1), rhuman 20 µg 32,000 D15002 C Apolipoprotein A1, (APO-A1), rhuman 100 µg 32,000 D15003 C Apolipoprotein E2, (APO-E2), rhuman 500 µg 32,000 D15004 C Apolipoprotein E3, (APO-E3), rhuman 500 µg 32,000 D15005 C Apolipoprotein E4, (APO-E4), rhuman 500 µg 32,000 D15006 C Erythropoietin alpha, (EPO-alpha), rhuman 50 µg 32,000 D15007 C Artemin, rhuman 10 µg 32,000 D15008 C Prolactin (E. coli-derived), rhuman 50 µg 32,000 D15009 C Prolactin Receptor (Prlr, GST-tagged), rhuman 5 µg 50,000 D15010 C Prolactin Receptor (Prlr), rhuman 50 µg 32,000 D15011 C Follistatin, (FST), rhuman 20 µg 32,000 D15012 C Periostin, rhuman 10 µg 32,000 D15013 C Leukemia Inhibitory Factor (E. coli-derived), (LIF), rhuman 10 µg 32,000 D15014 C-60050A Leukemia Inhibitory Factor (plant-derived), (LIF), rhuman 10 µg 28,000 D15015 C soluble CD4, rhuman 10 µg 32,000 D15016 C soluble CD105 (Endoglin; Sf9 insect cell-derived), rhuman 25 µg 54,000 近日発売 D15017 C soluble CD105 (Endoglin, E. coli-derived), rhuman 5 µg 50,000 D15018 C Activin A, rhuman 5 µg 32,000 D15019 C-60060A Activin A (plant-derived), rhuman 10 µg 32,000 D15020 C Activin B, rhuman 5 µg 32,000 D15021 C Vascular Cell Adhesion Molecule 1 (CD106), (VCAM-1), rhuman 10 µg 32,000 D15022 C B-type Natriuretic Protein, (BNP), rhuman 10 µg 32,000 D15023 C Angiopoietin-like Protein 3, (ANGPTL-3), rhuman 10 µg 32,000 D15024 C Angiopoietin-like Protein 4, (ANGPTL-4), rhuman 10 µg 32,000 D15025 C Progranulin, (PGRN), rhuman 10 µg 32,000 D15026 C CD4 ( aa variant), rhuman 20 µg 32,000 D15027 C CD4 ( aa variant), rhuman 20 µg 32,000 D15028 C Angiostatin Kringles 1-3, rhuman 100 µg 32,000 D15029 C Angiostatin K1-4, human 10 µg 32,000 D15030 C Epidermal Growth Factor (E. coli-derived), (EGF), rhuman 500 µg 32,000 D15031 C Epidermal Growth Factor (Pichia-derived), (EGF), rhuman 500 µg 32,000 D15032 C soluble Epidermal Growth Factor Receptor, (segf-r), rhuman 25 µg 66,000 D15033 C Neuroglobin, rhuman 10 µg 32,000 D15034 C Insulin (E. coli-derived), rhuman 25 mg 32,000 D15035 C Insulin (yeast-derived), rhuman 10 mg 32,000 D15036 C basic Fibroblast Growth Factor 2 (FGF-b; E. coli-derived)), rhuman 50 µg 32,000 D15037 C basic Fibroblast Growth Factor 2 (FGF-b, 147 aa variant), rhuman 50 µg 32,000 D15038 C basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman 10 µg 32,000 近日発売 D15039 C acidic Fibroblast Growth Factor 1 (FGF-a; E. coli-derived), rhuman 50 µg 32,000 D15040 C acidic Fibroblast Growth Factor 1 (FGF-a; Sf9 insect cell-derived), rhuman 10 µg 32,000 近日発売 D15041 C Fibroblast Growth Factor 4, (FGF-4), rhuman 25 µg 32,000 D15042 C Fibroblast Growth Factor 5, (FGF-5), rhuman 50 µg 32,000 D15043 C Fibroblast Growth Factor 6, (FGF-6), rhuman 25 µg 32,000 D15044 C Fibroblast Growth Factor 8, (FGF-8), rhuman 25 µg 32,000 D15045 C Fibroblast Growth Factor 9 (E. coli-derived), (FGF-9), rhuman 20 µg 32,000 D15046 C Fibroblast Growth Factor 9 (Sf9 insect cell-derived), (FGF-9), rhuman 20 µg 32,000 近日発売 1
2 D15047 C Fibroblast Growth Factor 10, (FGF-10), rhuman 25 µg 32,000 D15048 C Fibroblast Growth Factor 12, (FGF-12), rhuman 10 µg 32,000 D15049 C D15050 C D15051 C Granulocyte/Macrophage Colony Stimulating Factor (E. coli-derived), (GM-CSF), rhuman Granulocyte/Macrophage Colony Stimulating Factor (Sf9 insect cellderived), (GM-CSF), rhuman Granulocyte/Macrophage Colony Stimulating Factor/IL-3 Fusion Protein (E. coli-derived), (GM-CSF/IL-3 FP), rhuman 10 µg 32, µg 50,000 近日発売 10 µg 32,000 D15052 C Glia Maturation Factor beta, (GMF-beta), rhuman 10 µg 32,000 D15053 C Glia Maturation Factor gamma, (GMF-gamma), rhuman 20 µg 32,000 D15054 C D15055 C D15056 C D15057 C-60442A D15058 C D15059 C D15060 C D15061 C Granulocyte Colony Stimulating Factor (E. coli-derived), (G-CSF), rhuman Granulocyte Colony Stimulating Factor (CHO cell-derived), (G-CSF), rhuman Macrophage Colony Stimulating Factor (E. coli-derived), (M-CSF), rhuman Macrophage Colony Stimulating Factor (plant-derived), (M-CSF), rhuman Fibroblast soluble Growth Factor Receptor 1a (IIIc) / Fc-Chimera (Sf9 insect cell-derived), (sfgfr-1/fc), rhuman Fibroblast soluble Growth Factor Receptor 2a (IIIc) / Fc-Chimera (Sf9 insect cell-derived), (sfgfr-2/fc), rhuman Fibroblast soluble Growth Factor Receptor 3a (IIIc) / Fc-Chimera (Sf9 insect cell-derived), (sfgfr-3/fc), rhuman Fibroblast soluble Growth Factor Receptor 4 (IIIc) / Fc-Chimera (Sf9 insect cell-derived), (sfgfr-4/fc), rhuman 10 µg 32, µg 32, µg 32, µg 28, µg 32,000 近日発売 10 µg 32,000 近日発売 10 µg 32,000 近日発売 10 µg 32,000 近日発売 D15062 C Fibroblast Growth Factor 16, (FGF-16), rhuman 25 µg 32,000 D15063 C Fibroblast Growth Factor 17, (FGF-17), rhuman 25 µg 32,000 D15064 C Fibroblast Growth Factor 18, (FGF-18), rhuman 25 µg 32,000 D15065 C Fibroblast Growth Factor 19, (FGF-19), rhuman 25 µg 32,000 D15066 C Fibroblast Growth Factor 20, (FGF-20), rhuman 15 µg 32,000 D15067 C Fibroblast Growth Factor 21, (FGF-21), rhuman 20 µg 32,000 D15068 C Fibroblast Growth Factor 22, (FGF-22), rhuman 10 µg 32,000 D15069 C Fibroblast Growth Factor 23, (FGF-23), rhuman 10 µg 32,000 D15070 C Betacellulin (BTC), rhuman 20 µg 32,000 D15071 C Interferon alpha-1 (E. coli-derived), (IFN-alpha 1), rhuman 20 µg 32,000 D15072 C Interferon alpha-1b (E. coli-derived), (IFN-alpha 1b), rhuman 100 µg 32,000 D15073 C Interferon alpha-2a (E. coli-derived), (IFN-alpha 2a), rhuman 100 µg 32,000 D15074 C Interferon alpha-2b (E. coli-derived), (IFN-alpha 2b), rhuman 100 µg 32,000 D15075 C Interferon alpha-2b (yeast-derived), (IFN-alpha 2b), rhuman 50 µg 32,000 D15076 C Interferon beta-1b (E. coli-derived), (IFN-beta 1b), rhuman 10 µg 32,000 D15077 C Interferon beta-1a (CHO cell-derived), (IFN-beta 1a), rhuman 10 µg 32,000 D15078 C Interferon Regulatory Factor 1, (IRF-1), rhuman 50 µg 32,000 D15079 C Interferon Regulatory Factor 2, (IRF-2), rhuman 50 µg 32,000 D15080 C Interferon Regulatory Factor 3, (IRF-3), rhuman 50 µg 32,000 D15081 C Interferon Regulatory Factor 4 (MUM-1), (IRF-4), rhuman 2 µg 32,000 D15082 C Interferon gamma (E. coli-derived), (IFN-gamma), rhuman 100 µg 32,000 D15083 C-60724A Interferon gamma (plant-derived), (IFN-gamma), rhuman 100 µg 32,000 D15084 C Interferon lambda-1 (IL-29), (IFN-lambda-1), rhuman 20 µg 32,000 D15085 C Interferon lambda-2 (IL-28A), (IFN-lambda-2), rhuman 20 µg 32,000 D15086 C Interferon omega, (IFN-omega), rhuman 100 µg 32,000 2
3 D15087 C Insulin Like Growth Factor I (E. coli-derived), (IGF-I), rhuman 100 µg 32,000 D15088 C-60840A Insulin Like Growth Factor I (plant-derived), (IGF-I), rhuman 100 µg 32,000 D15089 C Insulin-Like Growth Factor I Receptor, (IGF-IR), rhuman 5 µg 58,000 D15090 C Insulin Like Growth Factor Binding Protein 1, (IGF-BP1), rhuman 20 µg 32,000 D15091 C Insulin Like Growth Factor Binding Protein 2, (IGF-BP2), rhuman 20 µg 32,000 D15092 C Insulin Like Growth Factor Binding Protein 3, (IGF-BP3), rhuman 25 µg 32,000 D15093 C Insulin Like Growth Factor Binding Protein 4, (IGF-BP4), rhuman 20 µg 32,000 D15094 C Insulin Like Growth Factor Binding Protein 5, (IGF-BP5), rhuman 25 µg 32,000 D15095 C Insulin Like Growth Factor Binding Protein 6 (E. coli-derived), (IGF- BP6), rhuman 20 µg 32,000 D15096 C IGF-BP6 (Hi-5 insect cell-derived), (IGF-BP6), rhuman 25 µg 32,000 近日発売 D15097 C Insulin Like Growth Factor Binding Protein 7, (IGF-BP7), rhuman 25 µg 32,000 D15098 C Insulin Like Growth Factor II, (IGF-II), rhuman 50 µg 32,000 D15099 C Interleukin 1-alpha (E. coli-derived), (IL-1 alpha), rhuman 10 µg 32,000 D15100 C-61112A Interleukin 1-alpha (plant-derived), (IL-1 alpha), rhuman 10 µg 32,000 D15101 C Interleukin 1-beta, (IL-1 beta), rhuman 10 µg 32,000 D15102 C Interleukin 1 Receptor Antagonist, (IL-1 RA), rhuman 100 µg 32,000 D15103 C Interleukin-1 Receptor Like-1, (IL-1RL1), rhuman 10 µg 32,000 D15104 C Interleukin 2 (E. coli-derived), (IL-2), rhuman 50 µg 32,000 D15105 C Interleukin 3 (yeast-derived), (IL-3), rhuman 10 µg 32,000 D15106 C Interleukin 3 (for Cell Culture), (IL-3 CC), rhuman 30 µg 28,000 D15107 C Interleukin 3 (E. coli-derived), (IL-3), rhuman 10 µg 32,000 D15108 C Interleukin 3 (Sf9 insect cell-derived), (IL-3), rhuman 10 µg 32,000 近日発売 D15109 C Interleukin 4 for (for Cell Culture), (IL-4 CC), rhuman 5 µg 28,000 D15110 C Interleukin 4 (E. coli-derived), (IL-4), rhuman 10 µg 32,000 D15111 C Soluble Interleukin 4 Receptor alpha (CD124), (sil-4r alpha), rhuman 15 µg 32,000 D15112 C Interleukin 4 (CHO cell-derived), (IL-4), rhuman 10 µg 32,000 D15113 C Interleukin 5 (E. coli-derived), (IL-5), rhuman 10 µg 32,000 D15114 C Interleukin 6 (for Cell Culture), (IL-6 CC), rhuman 10 µg 28,000 D15115 C Interleukin 6 (E. coli-derived), (IL-6), rhuman 20 µg 32,000 D15116 C soluble Interleukin 6 Receptor (CD126), (sil-6 Receptor), rhuman 20 µg 32,000 D15117 C Interleukin 6 (CHO cell-derived), (IL-6), rhuman 10 µg 32,000 D15118 C Interleukin 7 (E. coli-derived), (IL-7), rhuman 10 µg 32,000 D15119 C Interleukin 7 (yeast-derived), (IL-7), rhuman 10 µg 32,000 D15120 C Interleukin 8 (CXCL8, Pichia-derived), (IL-8 (CXCL8)), rhuman 25 µg 32,000 D15121 C Interleukin 8 (CXCL8, 77 aa variant), (IL-8), rhuman 25 µg 32,000 D15122 C Interleukin 8 (CXCL8, 72 aa variant), (IL-8), rhuman 25 µg 32,000 D15123 C Interleukin 9 (E. coli-derived), (IL-9), rhuman 10 µg 32,000 D15124 C Interleukin 10 (E. coli-derived), (IL-10), rhuman 10 µg 32,000 D15125 C Interleukin 11, (IL-11), rhuman 10 µg 32,000 D15126 C Interleukin 12, (IL-12), rhuman 10 µg 32,000 D15127 C Interleukin 12-p40 (CHO cell-derived), (IL-12-p40), rhuman 10 µg 32,000 D15128 C Interleukin 12-p80 (insect cell-derived), (IL-12-p80), rhuman 10 µg 32,000 近日発売 D15129 C Interleukin 13, (IL-13), rhuman 10 µg 32,000 D15130 C Interleukin 13 (Variant), (IL-13), rhuman 10 µg 32,000 D15131 C Interleukin 15, (IL-15), rhuman 10 µg 32,000 D15132 C TNF-Related Apoptosis Inducing Ligand (Apo2L, aa variant), (TRAIL), rhuman 10 µg 32,000 3
4 D15133 C Interleukin 16 (121 aa variant), (IL-16), rhuman 10 µg 32,000 D15134 C Interleukin 16 (130 aa variant), (IL-16), rhuman 10 µg 32,000 D15135 C Interleukin 17A, (IL-17), rhuman 25 µg 32,000 D15136 C Interleukin 17B, (IL-17B), rhuman 25 µg 32,000 D15137 C Interleukin 17D, (IL-17D), rhuman 25 µg 32,000 D15138 C Interleukin 17E (IL-25, SF20; E. coli-derived), (IL-17E), rhuman 25 µg 32,000 D15139 C Interleukin 17F, (IL-17F), rhuman 25 µg 32,000 D15140 C Interleukin 17A/F Heterodimer, (IL-17A/F), rhuman 10 µg 32,000 D15141 C Interleukin 19, (IL-19), rhuman 10 µg 32,000 D15142 C Interleukin 20 (E. coli-derived), (IL-20), rhuman 10 µg 32,000 D15143 C Interleukin 21, (IL-21), rhuman 10 µg 32,000 D15144 C Interleukin 22 (E. coli-derived), (IL-22), rhuman 10 µg 32,000 D15145 C Interleukin 24, (IL-24), rhuman 10 µg 32,000 D15146 C Interleukin 31, (IL-31), rhuman 10 µg 32,000 D15147 C Interleukin 32 alpha, (IL-32 alpha), rhuman 10 µg 32,000 D15148 C Interleukin 33, (IL-33), rhuman 10 µg 32,000 D15149 C Platelet Derived Growth Factor AB, (PDGF-AB), rhuman 10 µg 32,000 D15150 C D15151 C D15152 C D15153 C-63024A Platelet Derived Growth Factor AA (E. coli-derived), (PDGF-AA), rhuman Platelet Derived Growth Factor BB (E. coli-derived), (PDGF-BB), rhuman Platelet Derived Growth Factor BB (yeast-derived), (PDGF-BB), rhuman Platelet Derived Growth Factor BB (plant-derived), (PDGF-BB), rhuman 10 µg 32, µg 32, µg 32, µg 32,000 D15154 C Platelet Derived Growth Factor CC, (PDGF-CC), rhuman 20 µg 32,000 D15155 C Platelet Derived Growth Factor AA (Pichia-derived), (PDGF-AA), rhuman 10 µg 32,000 D15156 C Pigment Epithelium Derived Factor (E. coli-derived), (PEDF), rhuman 20 µg 32,000 D15157 C Pigment Epithelium Derived Factor (HEK cell-derived), (PEDF), rhuman 10 µg 32,000 D15158 C Prokinectin 2, rhuman 20 µg 32,000 D15159 C CD22 (CHO cell-derived), rhuman 20 µg 32,000 D15160 C soluble CD40 Ligand (TRAP, CD154), rhuman 50 µg 32,000 D15161 C Stem Cell Factor (E. coli-derived), (SCF), rhuman 10 µg 32,000 D15162 C-63120A Stem Cell Factor (plant-derived), (SCF), rhuman 10 µg 32,000 D15163 C Stem Cell Factor (Sf9 insect cell-derived), (SCF), rhuman 10 µg 32,000 近日発売 D15164 C Stem Cell Growth Factor alpha, (SCGF-alpha), rhuman 10 µg 32,000 D15165 C Stem Cell Growth Factor beta, (SCGF-beta), rhuman 10 µg 32,000 D15166 C D15167 C-63200A D15168 C soluble Receptor Activator of NF-Kappa-B Ligand (E. coli-derived), (srankl), rhuman soluble Receptor Activator of NF-Kappa-B Ligand (plant-derived), (srankl), rhuman soluble Receptor Activator of NF-Kappa-B Receptor (TNFRSF11A), (srank Receptor), rhuman 10 µg 32, µg 32, µg 32,000 D15169 C CD1A, rhuman 2 µg 32,000 D15170 C CD2, rhuman 2 µg 32,000 D15171 C CD9, rhuman 2 µg 32,000 D15172 C CD11b, rhuman 2 µg 32,000 D15173 C CD14 (CHO cell-derived), rhuman 2 µg 32,000 D15174 C CD23, rhuman 2 µg 32,000 4
5 D15175 C soluble Interleukin 2 Receptor alpha (CD25), (sil-2r alpha), rhuman 25 µg 32,000 D15176 C CD29, rhuman 2 µg 32,000 D15177 C CD31 (PECAM-1), rhuman 2 µg 32,000 D15178 C CD34, rhuman 2 µg 32,000 D15179 C CD43, rhuman 2 µg 32,000 D15180 C CD45, rhuman 2 µg 32,000 D15181 C CD54 (Intercellular Adhesion Molecule-1), (CD54 (ICAM-1)), rhuman 50 µg 32,000 D15182 C CD56, rhuman 2 µg 32,000 D15183 C CD68, rhuman 2 µg 32,000 D15184 C CD72, rhuman 2 µg 32,000 D15185 C CD99, rhuman 2 µg 32,000 D15186 C CD100, rhuman 20 µg 32,000 D15187 C CD146, rhuman 2 µg 32,000 D15188 C CD147, rhuman 2 µg 32,000 D15189 C CD152 (Cytotoxic T-lymphocyte-Associated Antigen 4), (CD152 (CTLA-4)), rhuman 50 µg 32,000 D15190 C Cysteine-rich Angiogenic Inducer 61, (CYR61), rhuman 20 µg 32,000 D15191 C D15192 C D15193 C D15194 C D15195 C D15196 C-63506A D15197 C D15198 C-63507A D15199 C Transforming Growth Factor beta-1 (113 aa, E. coli-derived), (TGF-beta 1), rhuman Transforming Growth Factor beta-1 (HEK cell-derived), (TGF-beta 1), rhuman Transforming Growth Factor beta-2 (HEK cell-derived), (TGF-beta 2), rhuman Transforming Growth Factor beta-1 (CHO cell-derived), (TGF-beta 1), rhuman Transforming Growth Factor beta-2 (Hi-5 insect cell-derived), (TGFbeta 2), rhuman Transforming Growth Factor beta-2 (plant-derived), (TGF-beta 2), rhuman Transforming Growth Factor beta-3 (E. coli-derived), (TGF-beta 3), rhuman Transforming Growth Factor beta-3 (plant-derived), (TGF-beta 3), rhuman Transforming Growth Factor beta-3 (CHO cell-derived), (TGF-beta 3), rhuman 10 µg 32,000 5 µg 32,000 5 µg 32,000 5 µg 32,000 5 µg 32,000 5 µg 32, µg 32,000 5 µg 32, µg 32,000 D15200 C Transforming Growth Factor alpha, (TGF-alpha), rhuman 100 µg 32,000 D15201 C Transforming Growth Factor Beta Receptor 2, (TGF-betaR2), rhuman 10 µg 32,000 D15202 C D15203 C D15204 C Tumor Necrosis Factor-Related Apoptosis Inducing Ligand, (TRAIL (Apo2L)), rhuman soluble TNF Related Apoptosis Inducing Ligand Receptor 1 (DR4), (strail Receptor-1), rhuman soluble TNF Related Apoptosis Inducing Ligand Receptor 2 (DR5), (strail Receptor-2), rhuman 50 µg 32, µg 32, µg 32,000 D15205 C TNF-Related Weak Inducer of Apoptosis, (TWEAK), rhuman 25 µg 32,000 D15206 C TNF-Related Weak Inducer of Apoptosis Receptor, (TWEAK Receptor), rhuman 25 µg 32,000 D15207 C TAFA 2, rhuman 20 µg 32,000 D15208 C Tumor Necrosis Factor alpha (E. coli-derived), (TNF-alpha), rhuman 50 µg 32,000 D15209 C Tumor Necrosis Factor alpha (yeast-derived), (TNF-alpha), rhuman 10 µg 10,000 D15210 C-63720A Tumor Necrosis Factor alpha (plant-derived), (TNF-alpha), rhuman 50 µg 32,000 D15211 C Tumor Necrosis Factor alpha (yeast-derived), (TNF-alpha), rhuman 50 µg 32,000 D15212 C Tumor Necrosis Factor alpha (E. coli-derived), (TNF-alpha), rhuman 10 µg 10,000 5
6 D15213 C D15214 C D15215 C Tumor Necrosis Factor alpha, Mutant/Variant (151 aa variant), (TNFalpha M), rhuman soluble Tumor Necrosis Factor Receptor Type I (CD120a), (stnf-r1), rhuman Tumor Necrosis Factor Receptor Fusion Protein, (TNF-Receptor Fusion Protein), rhuman 50 µg 32, µg 32, µg 32,000 D15216 C Tumor Necrosis Factor beta (E. coli-derived), (TNF-beta), rhuman 20 µg 32,000 D15217 C-63731A Tumor Necrosis Factor beta (plant-derived), (TNF-beta), rhuman 10 µg 28,000 D15218 C Tumor Necrosis Factor beta (insect cell-derived), (TNF-beta), rhuman 20 µg 32,000 近日発売 D15219 C Activation Induced TNFR Member Ligand, (AITRL), rhuman 20 µg 32,000 D15220 C D15221 C D15222 C D15223 C D15224 C-63755A D15225 C D15226 C TNFRSF17 (Tumor Necrosis Factor Receptor Superfamily 17, CD269), rhuman APRIL (A Proliferation Inducing Ligand, TALL-2, TRDL-1a, TNFSF13), rhuman Osteoprotegerin (Osteoclastogenesis Inhibitory Factor), (OPG (OCIF)), rhuman B-cell Activating Factor (BLyS) belonging to the TNF Family, (BAFF), rhuman B-cell Activating Factor (BLyS) belonging to the TNF Family (plantderived), (BAFF), rhuman B-cell Activating Factor (BLyS) Receptor belonging to the TNF Family, (BAFF-R), rhuman soluble Tumor Necrosis Factor Receptor Type II (CD120b), (stnf-r2), rhuman 20 µg 32, µg 32, µg 32, µg 32, µg 32, µg 32, µg 32,000 D15227 C Twisted Gastrulation Protein, (TSG ), rhuman 50 µg 32,000 D15228 C Thymic Stromal Lymphopoietin, (TSLP), rhuman 10 µg 32,000 D15229 C Plasminogen Activator Inhibitor 2, (PAI-2), rhuman 10 µg 32,000 D15230 C Keratinocyte Growth Factor (FGF-7; E. coli-derived), (KGF), rhuman 10 µg 32,000 D15231 C Keratinocyte Growth Factor 2, (KGF-2), rhuman 25 µg 32,000 D15232 C Monocyte Chemotactic Protein 1 (MCAF, CCL2), (MCP-1), rhuman 20 µg 32,000 D15233 C Matrix Metalloproteinase 1, (MMP-1), rhuman 10 µg 32,000 D15234 C Matrix Metalloproteinase 2, (MMP-2), rhuman 10 µg 32,000 D15235 C Matrix Metalloproteinase 3, (MMP-3), rhuman 20 µg 32,000 D15236 C Matrix Metalloproteinase 7, (MMP-7), rhuman 20 µg 32,000 D15237 C Matrix Metalloproteinase 8, (MMP-8), rhuman 1 unit 32,000 D15238 C Matrix Metalloproteinase 9, (MMP-9), rhuman 10 µg 32,000 D15239 C Matrix Metalloproteinase 13, (MMP-13), rhuman 2.5 µg 44,000 D15240 C RANTES (CCL5), rhuman 20 µg 32,000 D15241 C Neutrophil Activating Protein 2 (CXCL7), (NAP-2), rhuman 10 µg 32,000 D15242 C Nanog, rhuman 20 µg 32,000 D15243 C Neutrophil Peptide 1 (alpha-defensin), (NP-1), rhuman 20 µg 32,000 D15244 C Nephroblastoma Overexpressed Gene, (NOV), rhuman 20 µg 32,000 D15245 C Otoraplin, (OTOR), rhuman 20 µg 32,000 D15246 C OX40 Ligand, (OX40L), rhuman 10 µg 32,000 D15247 C D15248 C D15249 C-64410A Vascular Endothelial Cell Growth Factor 121 (Sf9-insect cell-derived), (VEGF-121), rhuman Vascular Endothelial Cell Growth Factor 121 (E. coli-derived), (VEGF- 121), rhuman Vascular Endothelial Cell Growth Factor 121 (plant-derived), (VEGF- 121), rhuman 10 µg 32, µg 32, µg 32,000 D15250 C Vascular Endothelial Cell Growth Factor B, (VEGF-B), rhuman 20 µg 32,000 D15251 C Vascular Endothelial Cell Growth Factor C, (VEGF-C), rhuman 20 µg 50,000 6
7 D15252 C Vascular Endothelial Cell Growth Factor-EG, (EG-VEGF), rhuman 20 µg 32,000 D15253 C Vascular Endothelial Cell Growth Factor D, (VEGF-D), rhuman 10 µg 32,000 D15254 C Vascular Endothelial Cell Growth Factor 189, (VEGF-189), rhuman 20 µg 58,000 D15255 C Vascular Endothelial Cell Growth Factor E, recombinant orf virus 10 µg 32,000 D15256 C D15257 C D15258 C-64420A D15259 C D15260 C D15261 C D15262 C D15263 C D15264 C D15265 C D15266 C D15267 C D15268 C D15269 C D15270 C D15271 C Vascular Endothelial Cell Growth Factor 145 (Sf9-insect cell-derived), (VEGF-145), rhuman Vascular Endothelial Cell Growth Factor 165 (E. coli-derived), (VEGF- 165), rhuman Vascular Endothelial Cell Growth Factor 165 (plant-derived), (VEGF- 165), rhuman Vascular Endothelial Cell Growth Factor 165 (yeast-derived), (VEGF- 165), rhuman Vascular Endothelial Cell Growth Factor 165 (HEK cell-derived), (VEGF-165), rhuman Vascular Endothelial Cell Growth Factor 165 (CHO cell-derived), (VEGF-165), rhuman soluble Vascular Endothelial Growth Factor Receptor 1 (flt-1, native, Sf9 insect cell-derived), (svegfr-1), rhuman soluble Vascular Endothelial Growth Factor Receptor-3 (flt-4, native, Sf9 insect cell-derived), (svegfr-3), rhuman soluble Vascular Endothelial Growth Factor Receptor 1, Domain 1-3 (flt-1; Sf9 insect cell-derived), (svegfr-1), rhuman soluble Vascular Endothelial Growth Factor Receptor 1, Domain 1-4 (flt-1; Sf9 insect cell-derived), (svegfr-1), rhuman soluble Vascular Endothelial Growth Factor Receptor 1, Domain 1-5 (flt-1; Sf9 insect cell-derived), (svegfr-1), rhuman soluble Vascular Endothelial Growth Factor Receptor 1 (flt-1, native, Sf9 insect cell-derived), (svegfr-1), rhuman soluble Vascular Endothelial Growth Factor Receptor 1, Domain 1-7 (flt-1, Fc chimera; Sf9 insect cell-derived), (svegfr-1), rhuman soluble Vascular Endothelial Growth Factor Receptor 2, Domain 1-7 (skdr; Sf9 insect cell-derived), (svegfr-2), rhuman soluble Vascular Endothelial Growth Factor Receptor 2, Domain 1-7 (skdr, Fc chimera; Sf9 insect cell-derived), (svegfr-2), rhuman Vascular Endothelial Cell Growth Factor Inhibitor (TNFSF15), (VEGF-I), rhuman 5 µg 32, µg 32, µg 32, µg 32, µg 32, µg 32, µg 32,000 近日発売 10 µg 32,000 近日発売 5 µg 32,000 近日発売 5 µg 32,000 近日発売 5 µg 16,000 近日発売 5 µg 16,000 近日発売 10 µg 12,000 近日発売 5 µg 12,000 近日発売 10 µg 16,000 近日発売 10 µg 32,000 D15272 C Hepatocyte Growth Factor (Sf9 insect cell-derived), (HGF), rhuman 10 µg 32,000 近日発売 D15273 C Hepatocyte Growth Factor (CHO cell-derived), (HGF), rhuman 10 µg 32,000 D15274 C Hepatocyte Growth Factor, A Chain, (HGF-A), rhuman 10 µg 32,000 D15275 C Hepatocyte Growth Factor, B Chain, (HGF-B), rhuman 10 µg 32,000 D15276 C Oncostatin M (OSM; 209 aa variant), rhuman 10 µg 32,000 D15277 C Oncostatin M (227 aa variant), rhuman 10 µg 32,000 D15278 C Omentin, rhuman 10 µg 32,000 D15279 C Trefoil Factor 1, (TFF-1), rhuman 20 µg 32,000 D15280 C Trefoil Factor 2, (TFF-2), rhuman 20 µg 32,000 D15281 C Trefoil Factor 3, (TFF-3), rhuman 20 µg 32,000 D15282 C Thrombomodulin (CD141), rhuman 10 µg 32,000 D15283 C TNF-like 1A (TNFSF15), (TL-1A), rhuman 20 µg 32,000 D15284 C Thrombopoietin (Mp1-ligand, MGDF; E. coli-derived), (TPO), rhuman 10 µg 32,000 D15285 C Thrombopoietin (Mp1-ligand, MGDF, CHO cell-derived), (TPO), rhuman 10 µg 32,000 D15286 C Epithelial Neutrophil Activating Peptide-78 (74 aa variant), (ENA-78), rhuman 20 µg 32,000 D15287 C B-cell Attracting Chemokine 1 (BLC, CXCL13), (BCA-1), rhuman 20 µg 32,000 7
8 D15288 C beta-defensin 2, (BD-2), rhuman 20 µg 32,000 D15289 C beta-defensin 1 (36 aa variant), (BD-1), rhuman 20 µg 32,000 D15290 C beta-defensin 1 (47 aa variant), (BD-1), rhuman 20 µg 32,000 D15291 C beta-defensin 3, (BD-3), rhuman 20 µg 32,000 D15292 C beta-defensin 4, (BD-4), rhuman 20 µg 32,000 D15293 C Neuroserpin, rhuman 25 µg 32,000 D15294 C s+c51ecreted Frizzled Related Protein 1, (sfrp-1), rhuman 20 µg 32,000 D15295 C Eotaxin (CCL11), rhuman 20 µg 32,000 D15296 C Eotaxin 2 (CCL24), rhuman 20 µg 32,000 D15297 C Eotaxin 3 (CCL26), rhuman 20 µg 32,000 D15298 C D15299 C D15300 C D15301 C Endothelial/Monocyte Activating Polypeptide 2 (E. coli-derived), (EMAP-2), rhuman Lymphocyte Function Associated Antigen 3 (CD58), Fusion Protein, (LFA-3), rhuman Growth Regulated Oncogene alpha (Melanoma Growth Stimulating Activity, CXCL1), (GRO-alpha (MGSA)), rhuman Growth Regulated Oncogene beta (CXCL2), (GRO-beta (MIP-2), rhuman 20 µg 32, µg 32, µg 32, µg 32,000 D15302 C Growth Regulated Oncogene gamma (CXCL3), (GRO-gamma), rhuman 10 µg 32,000 D15303 C IFN Inducible Protein 10 (CXCL10), (IP-10), rhuman 25 µg 32,000 D15304 C Lymphotactin, rhuman 20 µg 32,000 D15305 C Maspin, rhuman 25 µg 32,000 D15306 C Monocyte Chemotactic Protein 2 (CCL8), (MCP-2), rhuman 10 µg 32,000 D15307 C Monocyte Chemotactic Protein 3 (CCL7), (MCP-3), rhuman 10 µg 32,000 D15308 C Monocyte Chemotactic Protein 4 (CCL13), (MCP-4), rhuman 10 µg 32,000 D15309 C Monokine Induced by Interferon gamma (CXCL9), (MIG), rhuman 20 µg 32,000 D15310 C Mesoderm Inducing Factor, (MIF), rhuman 25 µg 32,000 D15311 C Mesoderm Inducing Factor (active), (MIF (active)), rhuman 10 µg 32,000 D15312 C Melanoma Inhibitory Activity Protein, (MIA), rhuman 20 µg 32,000 D15313 C Melanoma Inhibitory Activity Protein 2, (MIA-2), rhuman 20 µg 32,000 D15314 C Macrophage Inflammatory Protein 1-beta (CCL4), (MIP-1 beta), rhuman 10 µg 32,000 D15315 C Macrophage Inflammatory Protein 1-alpha (CCL3; E. coli-derived), (MIP-1 alpha), rhuman 20 µg 32,000 D15316 C LD78 beta (CCL3L1), rhuman 20 µg 32,000 D15317 C Lymphocyte Activation Gene 1 (CCL4L1), (LAG-1), rhuman 20 µg 32,000 D15318 C Macrophage Inflammatory Protein 3 (MPIF-1, CCL23), (MIP-3), rhuman 20 µg 32,000 D15319 C D15320 C Macrophage Inflammatory Protein 3-alpha (CCL20), (MIP-3 alpha), rhuman Macrophage Inflammatory Protein 3-beta (CCL19), (MIP-3 beta), rhuman 20 µg 32, µg 32,000 D15321 C Macrophage Inflammatory Protein 4 (CCL18), (MIP-4), rhuman 10 µg 32,000 D15322 C Macrophage Inflammatory Protein 5 (CCL15), (MIP-5), rhuman 25 µg 32,000 D15323 C Myostatin, rhuman 10 µg 32,000 D15324 C Myostatin Propeptide, rhuman 25 µg 32,000 D15325 C Platelet Factor 4 (CXCL4), (PF-4), rhuman 20 µg 32,000 D15326 C Platelet Activating Factor (Acetylhydrolase), (PAF-AH), rhuman 20 µg 32,000 D15327 C Placenta Growth Factor 2 (Sf9 insect cell-derived), (PLGF-2), rhuman 10 µg 32,000 近日発売 D15328 C Placenta Growth Factor 1 (Sf9 insect cell-derived), (PLGF-1), rhuman 10 µg 32,000 近日発売 D15329 C Placenta Growth Factor 1 (E. coli-derived), (PLGF-1), rhuman 25 µg 32,000 D15330 C Placenta Growth Factor 2 (E. coli-derived), (PLGF-2), rhuman 10 µg 32,000 8
9 D15331 C Placenta Growth Factor 3, (PLGF-3), rhuman 25 µg 32,000 D15332 C Nerve Growth Factor beta (E. coli-derived), (beta-ngf), rhuman 20 µg 32,000 D15333 C Nerve Growth Factor beta (CHO cell-derived), (beta-ngf), rhuman 20 µg 32,000 D15334 C Pro-Nerve Growth Factor, (Pro-NGF), rhuman 10 µg 32,000 D15335 C C-Reactive Protein, (CRP), rhuman 500 µg 44,000 D15336 C Ciliary Neurotrophic Factor, (CNTF), rhuman 20 µg 32,000 D15337 C Brain Derived Neurotrophic Factor, (BDNF), rhuman 10 µg 32,000 D15338 C Glial Derived Neurotropic Factor (E. coli-derived), (GDNF), rhuman 10 µg 32,000 D15339 C Persephin, rhuman 20 µg 32,000 D15340 C Novel Neurotrophin-1 (BCSF-3), (NNT-1), rhuman 10 µg 32,000 D15341 C Neurotrophin 3, (NT-3), rhuman 10 µg 32,000 D15342 C Neurotrophin 4, (NT-4), rhuman 10 µg 32,000 D15343 C Exodus 2, rhuman 20 µg 32,000 D15344 C BB Ligand (CD137L), rhuman 20 µg 32,000 D15345 C BB soluble Receptor (CD137), rhuman 20 µg 32,000 D15346 C B-cell Maturation Protein, (BCMA), rhuman 20 µg 32,000 D15347 C Human Breast and Kidney Chemokine (CXCL14), (BRAK), rhuman 20 µg 32,000 D15348 C Cutaneous T-cell Attracting Chemokine (CCL27), (CTACK), rhuman 20 µg 32,000 D15349 C CXC Ligand 16, (CXCL16), rhuman 25 µg 32,000 D15350 C soluble Fas Ligand, rhuman 10 µg 32,000 D15351 C soluble Fas Receptor (CD95, TNFRSF6), rhuman 20 µg 32,000 D15352 C D15353 C D15354 C D15355 C Adiponectin (Adipocyte Complement Related Protein of 30 kda; E. coliderived, His-tagged), (Acrp30), rhuman Adiponectin (Adipocyte Complement Related Protein of 30 kda; E. coliderived), (Acrp30), rhuman Adiponectin (Adipocyte Complement Related Protein of 30 kda; HEK cell-derived), (Acrp30), rhuman Adiponectin (Adipocyte Complement Related Protein of 30 kda; Hi-5 insect cell-derived), (Acrp30), rhuman 50 µg 32, µg 32, µg 32, µg 32,000 近日発売 D15356 C globular Acrp30 (Adipolean), rhuman 25 µg 32,000 D15357 C globular Acrp30/Adipolean Variant, rhuman 25 µg 32,000 D15358 C Pleiotrophin (PTN), rhuman 20 µg 32,000 D15359 C Parathyroid Hormone-like Related Protein, (PTHrP), rhuman 50 µg 32,000 D15360 C Resistin-like Molecule beta, (RELM beta), rhuman 25 µg 32,000 D15361 C Resistin, rhuman 25 µg 32,000 D15362 C Relaxin 2, rhuman 25 µg 32,000 D15363 C Relaxin 3, rhuman 25 µg 32,000 D15364 C Sonic Hedgehog (E. coli-derived), (Shh), rhuman 25 µg 32,000 D15365 C Desert Hedgehog, (DHH), rhuman 25 µg 32,000 D15366 C Retinol Binding Protein 4, (RBP-4), rhuman 20 µg 32,000 D15367 C Transmembrane Activator and CAML Interactor, (TACI), rhuman 20 µg 32,000 D15368 C LIGHT, rhuman 15 µg 32,000 D15369 C flt-3 Ligand (E. coli-derived), rhuman 10 µg 32,000 D15370 C-67110A flt-3 Ligand (plant-derived), rhuman 10 µg 32,000 D15371 C flt-3 Ligand (Sf9 insect cell-derived), rhuman 10 µg 32,000 近日発売 D15372 C flt-3 Ligand (HEK cell-derived), rhuman 10 µg 32,000 D15373 C Stromal Cell Derived Factor 1-alpha (CXCL12), (SDF-1 alpha), rhuman 10 µg 32,000 D15374 C Pro Bone Morphogenetic Protein 2, (ProBMP-2), rhuman 10 µg 32,000 D15375 C Bone Morphogenetic Protein 2, (BMP-2), rhuman 10 µg 32,000 9
10 D15376 C Bone Morphogenetic Protein 3, (BMP-3), rhuman 20 µg 32,000 D15377 C Bone Morphogenetic Protein 4, (BMP-4), rhuman 10 µg 32,000 D15378 C Bone Morphogenetic Protein 5, (BMP-5), rhuman 20 µg 32,000 D15379 C Bone Morphogenetic Protein 7(E. coli-derived), (BMP-7), rhuman 10 µg 32,000 D15380 C-67318A Bone Morphogenetic Protein 7 (plant-derived), (BMP-7), rhuman 10 µg 32,000 D15381 C Bone Morphogenetic Protein 7 (CHO cell-derived), (BMP-7), rhuman 10 µg 32,000 D15382 C Stromal Cell Derived Factor 1-beta (CXCL12), (SDF-1 beta), rhuman 10 µg 32,000 D15383 C Growth & Differentiation Factor 2, (GDF-2), rhuman 10 µg 32,000 D15384 C Growth & Differentiation Factor 3, (GDF-3), rhuman 20 µg 32,000 D15385 C Growth & Differentiation Factor 11, (GDF-11), rhuman 20 µg 32,000 D15386 C Growth & Differentiation Factor 15 (MIC-1), (GDF-15), rhuman 20 µg 32,000 D15387 C Growth & Differentiation Factor 5, (GDF-5), rhuman 50 µg 32,000 D15388 C Growth & Differentiation Factor 8 (Myostatin Propeptide), rhuman 25 µg 32,000 D15389 C Growth Hormone (GH), rhuman 100 µg 32,000 D15390 C-67335A Growth Hormone (GH, plant-derived), rhuman 50 µg 36,000 D15391 C Pituitary Growth Hormone 20K, (GH-20K-pit), rhuman 100 µg 44,000 D15392 C Placental Growth Hormone 20K, (GH-20K-pl), rhuman 100 µg 44,000 D15393 C Growth Hormone Binding Protein, (GHBP), rhuman 100 µg 44,000 D15394 C Placental Growth Hormone 22K, (GH-22K-pl), rhuman 100 µg 44,000 D15395 C Bone Morphogenetic Protein 13 (CDMP-2), (BMP-13), rhuman 50 µg 32,000 D15396 C Bone Morphogenetic Protein 14 (CDMP-1), (BMP-14), rhuman 50 µg 32,000 D15397 C soluble Bone Morphogenetic Protein Receptor 1A (Sf9 insect cellderived), (sbmpr-1a), rhuman 100 µg 54,000 近日発売 D15398 C NOGGIN (E. coli-derived), rhuman 20 µg 32,000 D15399 C NOGGIN (HEK cell-derived), rhuman 20 µg 32,000 D15400 C Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (Sf9 insect cellderived), (slyve-1), rhuman 25 µg 54,000 近日発売 D15401 C Prox-1 (fragment), rhuman 5 µg 28,000 D15402 C Cardiotrophin-1 (CT-1), rhuman 10 µg 32,000 D15403 C Fractalkine (CX3CL1), rhuman 20 µg 32,000 D15404 C Heregulin beta-1 (HRG1-beta1, NRG1-beta1), rhuman 50 µg 32,000 D15405 C Neuregulin 1 (NRG-1, Heregulin beta-2; E. coli-derived), rhuman 50 µg 32,000 D15406 C Human LeukinFeron, rhuman 10,000 IU 32,000 D15407 C Klotho, rhuman 20 µg 32,000 D15408 C Neuritin, rhuman 20 µg 32,000 D15409 C Osteopontin (SPP-1), rhuman 50 µg 32,000 D15410 C Human Granulocyte Chemotactic Peptide 2 (CXCL6), (GCP-2), rhuman 20 µg 32,000 D15411 C Hemofiltrate CC-Chemokine 1 (72 aa variant, CCL14), (HCC-1), rhuman 10 µg 32,000 D15412 C Hemofiltrate CC-Chemokine 1 (66 aa variant, CCL14), (HCC-1), rhuman 10 µg 32,000 D15413 C Hepatoma-Derived Growth Factor, (HDGF), rhuman 20 µg 32,000 D15414 C I-309 (CCL1), rhuman 10 µg 32,000 D15415 C Interferon-inducible T-cell alpha Chemoattractant (CXCL11), (I-TAC), rhuman 20 µg 32,000 D15416 C Liver-Expressed Chemokine (CCL16, NCC-4), (LEC), rhuman 20 µg 32,000 D15417 C D15418 C Macrophage Derived Chemokine (67 amino acid variant), (MDC (CCL22)), rhuman Macrophage Derived Chemokine (69 amino acid variant), (MDC (CCL22)), rhuman 20 µg 32, µg 32,000 10
11 D15419 C Mucosae Associated Epithelial Chemokine (CCL28), (MEC), rhuman 20 µg 32,000 D15420 C Midkine, rhuman 20 µg 32,000 D15421 C Galectin-1, rhuman 50 µg 32,000 D15422 C Galectin-3, rhuman 50 µg 32,000 D15423 C Galectin 4, rhuman 25 µg 32,000 D15424 C Thymus and Activation Regulated Chemokine (CCL17), (TARC), rhuman 20 µg 32,000 D15425 C Connective Tissue Growth Factor (98 aa variant), (CTGF), rhuman 20 µg 32,000 D15426 C Connective Tissue Growth Factor (His-tagged), (CTGF), rhuman 10 µg 32,000 D15427 C Connective Tissue Growth Factor ( aa variant; His-tagged), (CTGF), rhuman 20 µg 32,000 D15428 C Connective Tissue Growth Factor (HEK cell-derived), (CTGF), rhuman 10 µg 58,000 D15429 C Connective Tissue Growth Factor Like Protein (WISP-2), (CTGFL (WISP-2)), rhuman 20 µg 32,000 D15430 C Thymus Expressed Chemokine (CCL25), (TECK), rhuman 20 µg 32,000 D15431 C D15432 C soluble TIE-1/Fc Chimera (Sf9 insect cell-derived), (stie-1/fc Chimera), rhuman soluble TIE-2/Fc Chimera (Sf9 insect cell-derived), (stie-2/fc Chimera), rhuman 20 µg 28,000 近日発売 20 µg 28,000 近日発売 D15433 C Toll-like Receptor 3 (CD283), (TLR-3), rhuman 25 µg 32,000 D15434 C soluble Delta-like Protein 1, (sdll-1), rhuman 25 µg 32,000 D15435 C soluble Delta-like Protein 4, (sdll-4), rhuman 25 µg 32,000 D15436 C Osteoclast Stimulating Factor 1, (OSTF-1), rhuman 50 µg 32,000 D15437 C Neurturin (NTN), rhuman 20 µg 32,000 D15438 C Epstein-Barr Virus Induced Gene 3, (EBI-3), rhuman 10 µg 32,000 D15439 C Herpes Virus Entry Mediator (Fc Chimera), (HVEM/Fc), rhuman 100 µg 32,000 D15440 C Leptin (Anti-Obesity Protein), rhuman 1 mg 32,000 D15441 C Leptin Binding Domain, (Leptin Receptor), rhuman 50 µg 32,000 D15442 C Apolipoprotein D, rhuman 10 µg 32,000 D15443 C Apolipoprotein J (ApoJ, Clusterin), rhuman 10 µg 32,000 D15444 C Apolipoprotein Serum Amyloid A, (Apo-SAA), rhuman 50 µg 32,000 D15445 C Apolipoprotein Serum Amyloid A1, (Apo-SAA1), rhuman 50 µg 32,000 D15446 C Endostatin, rhuman 100 µg 32,000 D15447 C WNT-1-Inducible Signaling Pathway Protein 1, (WISP-1), rhuman 20 µg 32,000 D15448 C WNT-1-Inducible Signaling Pathway Protein 3, (WISP-3), rhuman 20 µg 32,000 D15449 C WNT-1, rhuman 10 µg 32,000 D15450 C Dickkopf-Related Protein-1, (DKK-1), rhuman 10 µg 32,000 D15451 C Slit2-N, rhuman 25 µg 32,000 D15452 C Vaspin, rhuman 25 µg 32,000 D15453 C Visfatin, rhuman 25 µg 32,000 D15454 C WNT Inhibitory Factor 1, (WIF-1), rhuman 5 µg 44,000 D15455 C Epigen (EPGN), rhuman 25 µg 32,000 D15456 C Epiregulin (EREG), rhuman 25 µg 32,000 D15457 C Tissue Inhibitor of Metalloproteinases 1, (TIMP-1), rhuman 10 µg 32,000 D15458 C Tissue Inhibitor of Metalloproteinases 2, (TIMP-2), rhuman 10 µg 32,000 D15459 C Vitronectin, rhuman 250 µg 32,000 D15460 C E-selectin (CD62E), rhuman 10 µg 32,000 D15461 C L-selectin (CD62L), rhuman 10 µg 32,000 D15462 C P-selectin (CD62P), rhuman 10 µg 32,000 D15463 C beta2-microglobulin (b2-m, BDGF-2, CRG-8; E. coli-derived), rhuman 50 µg 32,000 11
12 D15464 C-69310A Liver X Receptor beta (LBD; plant-derived), (LXR-beta (LBD)), rhuman 10 µg 32,000 D15465 C-69312A Tissue Factor Protein Inhibitor 2 (Domain 1; plant-derived), (TFPI-2 (Domain 1)), rhuman 1 mg 54,000 D16001 D Prolactin, rmouse 50 µg 32,000 D16002 D Leukemia Inhibitory Factor (E. coli-derived), (LIF), rmouse 10 µg 32,000 D16003 D-60050A Leukemia Inhibitory Factor (plant-derived), (LIF), rmouse 10 µg 28,000 D16004 D soluble CD105 (Endoglin, Sf9-insect cell-derived), rmouse 25 µg 54,000 近日発売 D16005 D Epidermal Growth Factor, (EGF), rmouse 500 µg 32,000 D16006 D Fibroblast Growth Factor 9, (FGF-9), rmouse 10 µg 32,000 D16007 D basic Fibroblast Growth Factor 2 (FGF-b), rmouse 50 µg 32,000 D16008 D acidic Fibroblast Growth Factor 1 (FGF-a), rmouse 50 µg 32,000 D16009 D Granulocyte/Macrophage Colony Stimulating Factor (E. coli-derived), (GM-CSF), rmouse 10 µg 32,000 D16010 D Granulocyte Colony Stimulating Factor, (G-CSF), rmouse 10 µg 32,000 D16011 D Macrophage Colony Stimulating Factor, (M-CSF), rmouse 10 µg 32,000 D16012 D Fibroblast Growth Factor 21, (FGF-21), rmouse 10 µg 32,000 D16013 D Betacellulin (BTC), rmouse 20 µg 32,000 D16014 D Interferon gamma, (IFN-gamma), rmouse 100 µg 32,000 D16015 D Interferon lambda-2 (IL-28A), (IFN-lambda-2), rmouse 20 µg 32,000 D16016 D Insulin Like Growth Factor I, (IGF-I), rmouse 50 µg 32,000 D16017 D Interleukin 1-alpha, (IL-1 alpha), rmouse 10 µg 32,000 D16018 D Interleukin 1-beta, (IL-1 beta), rmouse 10 µg 32,000 D16019 D Interleukin 2, (IL-2), rmouse 20 µg 32,000 D16020 D Interleukin 3, (IL-3), rmouse 10 µg 32,000 D16021 D Interleukin 4, (IL-4), rmouse 10 µg 32,000 D16022 D Interleukin 5, (IL-5), rmouse 25 µg 32,000 D16023 D Interleukin 6, (IL-6), rmouse 10 µg 32,000 D16024 D Interleukin 7, (IL-7), rmouse 10 µg 32,000 D16025 D Interleukin 9, (IL-9), rmouse 10 µg 32,000 D16026 D Interleukin 10, (IL-10), rmouse 10 µg 32,000 D16027 D Interleukin 11, (IL-11), rmouse 10 µg 32,000 D16028 D Interleukin 12 (CHO cell-derived), (IL-12), rmouse 10 µg 32,000 D16029 D Interleukin 13, (IL-13), rmouse 10 µg 32,000 D16030 D Interleukin 15, (IL-15), rmouse 10 µg 32,000 D16031 D Interleukin 16, (IL-16), rmouse 10 µg 32,000 D16032 D Interleukin 17A, (IL-17), rmouse 25 µg 32,000 D16033 D Interleukin 17E (IL-25, SF20), (IL-17E), rmouse 25 µg 32,000 D16034 D Interleukin-17F, (IL-17F), rmouse 25 µg 32,000 D16035 D Interleukin 17A/F Heterodimer, (IL-17A/F), rmouse 10 µg 32,000 D16036 D Interleukin 19, (IL-19), rmouse 10 µg 32,000 D16037 D Interleukin 20, (IL-20), rmouse 10 µg 32,000 D16038 D Interleukin 21, (IL-21), rmouse 10 µg 32,000 D16039 D Interleukin 22, (IL-22), rmouse 10 µg 32,000 D16040 D Interleukin 27 (p28), (IL-27), rmouse 10 µg 32,000 D16041 D Interleukin 31, (IL-31), rmouse 10 µg 32,000 D16042 D Interleukin 33, (IL-33), rmouse 10 µg 32,000 D16043 D Interleukin 25 (SF20), (IL-25), rmouse 10 µg 32,000 D16044 D Platelet Derived Growth Factor AA, (PDGF-AA), rmouse 10 µg 32,000 12
13 D16045 D Platelet Derived Growth Factor BB, (PDGF-BB), rmouse 10 µg 32,000 D16046 D soluble CD40 Ligand (TNFSF5, TRAP, CD154, gp39), (scd40 Ligand), rmouse 25 µg 32,000 D16047 D Stem Cell Factor (E. coli-derived), (SCF), rmouse 10 µg 32,000 D16048 D-63120A Stem Cell Factor (plant-derived), (SCF), rmouse 10 µg 32,000 D16049 D soluble Receptor Activator of NF-Kappa B Ligand, (srankl), rmouse 10 µg 32,000 D16050 D CD14 (CHO cell-derived), rmouse 2 µg 32,000 D16051 D TRAIL (Tumor Necrosis Factor-Related Apoptosis Inducing Ligand), (TRAIL (Apo2L)), rmouse 50 µg 32,000 D16052 D Tumor Necrosis Factor alpha (E. coli-derived), (TNF-alpha), rmouse 20 µg 32,000 D16053 D APRIL (A Proliferation Inducing Ligand; TALL-2, TRDL-1a, TNFSF13), rmouse 20 µg 32,000 D16054 D JE (Monocyte Chemotactic Protein, CCL2), (MCP-1), rmouse 10 µg 32,000 D16055 D RANTES (CCL5), rmouse 20 µg 32,000 D16056 D D16057 D-64408A D16058 D D16059 D D16060 D Vascular Endothelial Growth Factor 164 (insect cell-derived), (VEGF- 164), rmouse Vascular Endothelial Growth Factor 164 (plant-derived), (VEGF-164), rmouse Recombinant Murine Vascular Endothelial Cell Growth Factor 121, (VEGF-121), rmouse Vascular Endothelial Growth Factor 165 (E. coli-derived), (VEGF-165), rmouse Vascular Endothelial Growth Factor 165 (Sf9-insect cell-derived), (VEGF-165), rmouse 20 µg 50,000 近日発売 10 µg 32, µg 32, µg 32, µg 32,000 近日発売 D16061 D Thrombopoietin, (TPO), rmouse 10 µg 32,000 D16062 D Human B-cell Attracting Chemokine 1 (CXCL13), (BCA-1 (BLC), rmouse 20 µg 32,000 D16063 D Eotaxin (CCL11), rmouse 20 µg 32,000 D16064 D C-10 (CCL6), rmouse 10 µg 32,000 D16065 D Eotaxin-2 (CCL24), rmouse 20 µg 32,000 D16066 D IFN Inducible Protein 10 (CXCL10), (IP-10), rmouse 25 µg 32,000 D16067 D Cuteaneous T-cell Attracting Chemokine (CCL27), (CTACK), rmouse 20 µg 32,000 D16068 D Keratinocyte Chemoattractant (GRO-alpha, CXCL1), (KC), rmouse 20 µg 32,000 D16069 D Macrophage Inflammatory Protein 2 (CXCL2), (MIP-2 (GRO-beta), rmouse 20 µg 32,000 D16070 D Monocyte Chemotactic Protein 2 (CCL8), (MCP-2), rmouse 20 µg 32,000 D16071 D Monocyte Chemotactic Protein 3 (CCL7), (MCP-3), rmouse 10 µg 32,000 D16072 D Monocyte Chemotactic Protein 5 (CCL12), (MCP-5), rmouse 20 µg 32,000 D16073 D Monokine Induced by Interferon-gamma (CXCL9), (MIG), rmouse 20 µg 32,000 D16074 D Macrophage Inflammatory Protein 1-beta (CCL4), (MIP-1 beta), rmouse 10 µg 32,000 D16075 D Macrophage Inflammatory Protein 1-alpha (CCL3), (MIP-1), rmouse 10 µg 32,000 D16076 D D16077 D D16078 D Macrophage Inflammatory Protein 1-gamma, (MIP-1 gamma (CCL9/10)), rmouse Macrophage Inflammatory Protein 3-alpha (CCL20), (MIP-3 alpha), rmouse Macrophage Inflammatory Protein 3-beta (CCL19), (MIP-3 beta), rmouse 20 µg 32, µg 32, µg 32,000 D16079 D Neuropoietin (NP, NPO), rmouse 25 µg 32,000 D16080 D Platelet Factor 4 (CXCL4), (PF-4 (CXCL4)), rmouse 20 µg 32,000 D16081 D Placenta Growth Factor 2 (E. coli-derived), (PLGF-2), rmouse 10 µg 32,000 D16082 D Nerve Growth Factor beta, (beta-ngf), rmouse 20 µg 32,000 D16083 D Glial Derived Neurotropic Factor, (GDNF), rmouse 10 µg 32,000 13
14 D16084 D Persephin, rmouse 20 µg 32,000 D16085 D Neurotrophin 3, (NT-3), rmouse 10 µg 32,000 D16086 D Exodus-2 (CCL21), rmouse 20 µg 32,000 D16087 D D16088 D Lipopolysaccharide Induced CXC Chemokine (CXCL5, 70 aa variant), (LIX), rmouse Lipopolysaccharide Induced CXC Chemokine (CXCL5, 93 aa variant), (LIX), rmouse 20 µg 32, µg 32,000 D16089 D Lungkine (CXCL15), rmouse 20 µg 32,000 D16090 D CXC Ligand 16, (CXCL16), rmouse 25 µg 32,000 D16091 D D16092 D Adiponectin (Adipocyte Complement Related Protein of 30 kda, glycosylated; HEK cell-derived), (Acrp30), rmouse Adiponectin (Adipocyte Complement Related Protein of 30 kda; E. coliderived), (Acrp30), rmouse 10 µg 32, µg 32,000 D16093 D globular Acrp30 (Adipolean), rmouse 25 µg 32,000 D16094 D Resistin-like Molecule alpha, (RELM-alpha), rmouse 25 µg 32,000 D16095 D Resistin-like Molecule beta, (RELM-beta), rmouse 25 µg 32,000 D16096 D Resistin-like Molecule gamma, (RELM-gamma), rmouse 25 µg 32,000 D16097 D Resistin, rmouse 25 µg 32,000 D16098 D Sonic Hedgehog, (Shh), rmouse 25 µg 32,000 D16099 D Interferon-inducible T-cell alpha Chemoattractant (CXCL11), (I-TAC), rmouse 20 µg 32,000 D16100 D LIGHT, rmouse 20 µg 32,000 D16101 D flt-3 Ligand, rmouse 10 µg 32,000 D16102 D Stromal Cell-Derived Factor 1-alpha (CXCL12), (SDF-1 alpha), rmouse 10 µg 32,000 D16103 D Stromal Cell-Derived Factor 1-beta (CXCL12), (SDF-1 beta), rmouse 10 µg 32,000 D16104 D Growth Hormone (GH), rmouse 100 µg 58,000 D16105 D NOGGIN, rmouse 20 µg 32,000 D16106 D soluble Lymphatic Vessel Endothelial Hyaluronan Receptor 1 (Sf9 insect cell-derived), (slyve-1), rmouse 25 µg 54,000 近日発売 D16107 D Cardiotrophin-1 (CT-1), rmouse 10 µg 32,000 D16108 D Macrophage Derived Chemokine (CCL22), (MDC), rmouse 20 µg 32,000 D16109 D Mucosae-Associated Epithelial Chemokine (CCL28), (MEC), rmouse 20 µg 32,000 D16110 D soluble TIE-1/Fc Chimera (Sf9-insect cell-derived), rmouse 20 µg 28,000 近日発売 D16111 D soluble TIE-2/Fc Chimera (Sf9-insect cell-derived), rmouse 20 µg 28,000 近日発売 D16112 D Epstein-Barr Virus Induced Gene 3, (EBI-3), rmouse 10 µg 32,000 D16113 D Leptin, rmouse 1 mg 32,000 D16114 D Apolipoprotein J (ApoJ, Clusterin), rmouse 10 µg 32,000 D16115 D WNT-3a, rmouse 10 µg 32,000 D16116 D Visfatin, rmouse 25 µg 32,000 D16117 D Granzyme B, rmouse 10 µg 32,000 D16118 E Prolactin, rrat 50 µg 32,000 D16119 E Prolactin Receptor (Prlr), rrat 50 µg 32,000 D16120 E Epidermal Growth Factor, (EGF), rrat 100 µg 32,000 D16121 E basic Fibroblast Growth Factor 2 (FGF-b), rrat 50 µg 32,000 D16122 E Fibroblast Growth Factor 9, (FGF-9), rrat 10 µg 32,000 D16123 E Granulocyte/Macrophage Colony Stimulating Factor, (GM-CSF), rrat 10 µg 32,000 D16124 E Macrophage Colony Stimulating Factor, (M-CSF), rrat 10 µg 32,000 D16125 E Interferon gamma, (IFN-gamma), rrat 100 µg 32,000 D16126 E Insulin Like Growth Factor I, (IGF-I), rrat 50 µg 32,000 14
15 D16127 E Interleukin 1-alpha, (IL-1 alpha), rrat 10 µg 32,000 D16128 E Interleukin 1-beta, (IL-1 beta), rrat 10 µg 32,000 D16129 E Interleukin 2, (IL-2), rrat 20 µg 32,000 D16130 E Interleukin 3, (IL-3), rrat 10 µg 32,000 D16131 E Interleukin 3-beta, (IL-3 beta), rrat 20 µg 32,000 D16132 E Interleukin 4, (IL-4), rrat 10 µg 32,000 D16133 E Interleukin 5, (IL-5), rrat 10 µg 32,000 D16134 E Interleukin 6, (IL-6), rrat 10 µg 32,000 D16135 E Interleukin 7, (IL-7), rrat 10 µg 32,000 D16136 E Interleukin 9, (IL-9), rrat 10 µg 32,000 D16137 E Interleukin 10, (IL-10), rrat 10 µg 32,000 D16138 E Interleukin 12, (IL-12), rrat 10 µg 32,000 D16139 E Interleukin 13 (113 aa variant), (IL-13), rrat 10 µg 32,000 D16140 E Interleukin 13 (109 aa variant), (IL-13), rrat 10 µg 32,000 D16141 E Interleukin 15, (IL-15), rrat 10 µg 32,000 D16142 E Interleukin 17A, (IL-17), rrat 25 µg 32,000 D16143 E Interleukin 17E (IL-25, SF20), (IL-17E), rrat 25 µg 32,000 D16144 E Interleukin 17F, (IL-17F), rrat 25 µg 32,000 D16145 E Stem Cell Factor, (SCF), rrat 10 µg 32,000 D16146 E soluble Receptor Activator of NF-Kappa-B Ligand, (srankl), rrat 10 µg 32,000 D16147 E Tumor Necrosis Factor alpha, (TNF-alpha), rrat 20 µg 32,000 D16148 E Monocyte Chemoattractant Protein-1 (CCL2), (MCP-1), rrat 10 µg 32,000 D16149 E RANTES (CCL5), rrat 20 µg 32,000 D16150 E Vascular Endothelial Growth Factor A, (VEGF-165), rrat 10 µg 32,000 D16151 E Vascular Endothelial Growth Factor C, (VEGF-C), rrat 10 µg 32,000 D16152 E Vascular Endothelial Growth Factor C (152 aa variant), (VEGF-C152S), rrat 10 µg 32,000 D16153 E Oncostatin M (OSM), rrat 10 µg 32,000 D16154 E Thrombopoietin (Mp1-ligand, MGDF), (TPO), rrat 10 µg 32,000 D16155 E IFN Inducible Protein 10 (CXCL10), (IP-10), rrat 25 µg 32,000 D16156 E Growth Regulated Oncogene alpha (KC, CXCL1), (GRO-alpha), rrat 25 µg 32,000 D16157 E Growth Regulated Oncogene beta (MIP-2, CXCL2), (GRO-beta), rrat 25 µg 32,000 D16158 E Macrophage Inflammatory Protein 1-beta (CCL4), (MIP-1 beta), rrat 20 µg 32,000 D16159 E Macrophage Inflammatory Protein 1-alpha (CCL3), (MIP-1), rrat 20 µg 32,000 D16160 E Ciliary Neurotrophic Factor, (CNTF), rrat 25 µg 32,000 D16161 E Glial Derived Neurotropic Factor, (GDNF), rrat 10 µg 32,000 D16162 E Resistin, rrat 25 µg 32,000 D16163 E Stromal Cell Derived Factor 1-alpha (CXCL12), (SDF-1 alpha), rrat 10 µg 32,000 D16164 E Stromal Cell Derived Factor 1-beta (CXCL12), (SDF-1 beta), rrat 10 µg 32,000 D16165 E Growth Hormone (GH), rrat 100 µg 44,000 D16166 E Fractalkine (CX3CL1), rrat 20 µg 32,000 D16167 E Leptin, rrat 1 mg 32,000 D16168 E Apolipoprotein J (ApoJ, Clusterin), rrat 10 µg 32,000 D20001 PK-AB Rabbit Anti-Human PARP, D20002 PK-AB Mouse Anti-Human/Mouse Caspase-3, Monoclonal D20003 PK-AB Mouse Anti-Human/Mouse/Dog FADD, Monoclonal 100 µg 48,000 近日発売 D20004 PK-AB Mouse Anti-Human/Mouse/Rat Caspase-7 (IgG1, clone B4-G2), Monoclonal 15
Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )
1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo
More informationFirePlex Multiplex Immunoassay product list
FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More information2017 Price List. Published by: PeproTech, INC. Rocky Hill, New Jersey USA
2014 Price List 2017 Price List Published by: PeproTech, INC. Rocky Hill, New Jersey USA Toll Free Number (in the United States) (800) 436-9910 (609) 497-0253 Fax Orders (609) 497-0321 1 PEPROTECH Ordering
More informationImmunology Research Related Cytokine Products
Immunology Research Related Cytokine Products Copyright 2017 by PeproTech, Inc. PeproTech, Inc. 5 Crescent Avenue Rocky Hill, NJ 08553-0275 Tel: (800) 436-9910 (609) 497-0253 Fax: (609) 497-0321 email:
More informationOUR QUALITY YOUR DEDICATION PRICE LIST
PRICE LIST 2018 Price List 2018 Price List Published by: PeproTech, INC. Rocky Hill, New Jersey USA PEPROTECH Ordering Information Hours of Operation: Extended hours from 8:00 AM to 8:00 PM (Eastern Standard
More information细胞因子绝对定量检测 RayBio 平面型抗体芯片
细胞因子绝对定量检测 RayBio 平面型抗体芯片 RayBio 细胞因子定量检测抗体芯片技术服务 ()I Catalog duct Species QAH-ADI- y Obesity IGF-I, IL- alpha, IL-6, IL-8, Insulin, Leptin, MCP-, PAI-, Adipokines Resistin, TNF alpha QAH-ADI-2 y Obesity
More informationPEPROTECH. Manufacturer of Quality Cytokine Products. Published by PeproTech Inc. Rocky Hill, New Jersey USA
PEPROTECH Manufacturer of Quality Cytokine Products Published by PeproTech Inc. Rocky Hill, New Jersey USA Copyright 2011 by PeproTech Inc. 1 2011-2012 2 PEPROTECH 用 力力 立立 大 虫 白 用 高 長 大 高 力力 大 士 力力 3 2011-2012
More informationAssessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018
Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect
More informationDilution Factor Serum Plasma Urine CSF (Other)
R-PLEX s and Assay/Antibody Combinations The tables below provide the dilution factors and primary diluent combinations for samples tested with R-PLEX s. These dilution factors and diluent combinations
More informationSupplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p
More informationData Package. Multiplex Oncology I 96 96
Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection
More informationMultiplex Suspension Arrays NF-k p65 EGFR Smad2 TGF- c-jun Akt IL-17A/F Stat1 IL-12p70 IGF-IR MEK1 Bio-Plex
Multiplex Suspension Arrays NF-kβ p65 TGF-β1 c-jun Smad2 EGF IL-17A/F Akt IGF-IR Stat1 MEK1 IL-12p70 Bio-Plex Multiplex Immunoassays Analyte Guide Summer 2014 2014 Bio-Rad Laboratories, Inc. The Power
More informationCytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones
Cytokines Luděk Šefc Cytokines Protein regulators of cellular communication Cytokines x hormones Hormones Cytokines Production sites few many Cell targets few many Presence in blood yes rarely Biological
More informationGeneration of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
More informationHuman Cytokine Antibody Array
Li StarFish S.r.l. Via Cavour, 35-20063 Cernusco S/N (MI), Italy Tel. +39-02-92150794 - Fax. +39-02-92157285 info@listarfish.it -www.listarfish.it Human Cytokine Antibody Array Patent Pending Technology
More informationELISA kits for Cancer
ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL
More informationTITLE: Biomarkers of Renal Tumor Burden and Progression in TSC. CONTRACTING ORGANIZATION: Massachusetts General Hospital Boston, MA
AD Award Number: W81XWH-10-1-0433 TITLE: Biomarkers of Renal Tumor Burden and Progression in TSC PRINCIPAL INVESTIGATOR: Elahna Paul, M.D., Ph.D. CONTRACTING ORGANIZATION: Massachusetts General Hospital
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More information2018/2019 Catalog ReliaTech GmbH 2018/2019. Catalog
2018/2019 Catalog ReliaTech GmbH 2018/2019 Catalog +49-5331-8586 987 +49-5331-8586 989 www.reliatech.de orders@reliatech.de A B mouse anti-human CD31 rabbit anti-human EGFR C D CD31/EGFR control Double
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationThe Role of Microenvironment in the Control of Tumor Angiogenesis
The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,
More informationAUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA.
AUTOANTIBODY PROFILING SYSTEM ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. Detect Quantify Classify Phone: +1-814-262-7331; Fax: +1-814-262-7334, Email: itsi@itsibio.com Website:
More informationLEGENDplex Multi-Analyte Flow Assay Kits
LEGENDplex Multi-Analyte Flow Assay Kits BioLegend is ISO 9001:2008 and ISO 13485:2003 Certified 02-0009-03 World-Class Quality Superior Customer Support Outstanding Value LEGENDplex Multi-Analyte Flow
More informationRayBiotech, Inc. RayBio Mouse Cytokine Antibody Array. Please read manual carefully before starting experiment. Patent Pending Technology
RayBio Mouse Cytokine Antibody Array Patent Pending Technology User Manual (Revised June 14, 2009) RayBio Mouse Cytokine Antibody Array 1 (Cat# AAM-CYT-1) RayBio Mouse Cytokine Antibody Array 2 (Cat# AAM-CYT-2)
More informationProcartaPlex multiplex immunoassays for the Luminex platform
ProcartaPlex multiplex immunoassays for the Luminex platform Get exactly the panel you want Optimize your research with ProcartaPlex multiplex immunoassays What would the ability to simultaneously quantitate
More informationDATA PACKAGE. Multiplex CVD I 96 96
DATA PACKAGE Multiplex CVD I 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection limit
More informationRayBio Label-based (L-Series) Mouse Antibody Array L-308 Membrane Kit
RayBio Label-based (L-Series) Mouse Antibody Array L-308 Membrane Kit Patent Pending Technology User Manual (Revised August 8, 2017) For the simultaneous detection of the relative expression of 308 (L-308)
More informationGrowth Factors. BIT 230 Walsh Chapter 7
Growth Factors BIT 230 Walsh Chapter 7 3 Definitions Autocrine: a mode of hormone action in which a hormone affects the function of the cell type that produced it. Paracrine: Relating to the release of
More informationCytokine Profiling in Human Colostrum and Milk by Protein Array
Papers in Press. Published March 15, 2007 as doi:10.1373/clinchem.2006.077107 The latest version is at http://www.clinchem.org/cgi/doi/10.1373/clinchem.2006.077107 Clinical Chemistry 53:5 000 000 (2007)
More informationSpeciality and Research Controls
Controls Speciality and Research Product Range Product Antimicrobial Array 1 Plus Control 3 x 1 ml AMC5084 Antimicrobial Control II 3 x 1 ml AMC5035 Antimicrobial Control III 3 x 1 ml AMC5036 Growth Promoter
More informationBasis of Immunology and
Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie
More informationMCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration
Units: pg/ml pg/ml pg/ml pg/ml Assay Name RnD Systems Millipore Magnetic Hormone ELISA Adipokine Panel 2 Panel Catalog Number DCP HADK2MAG-61K HCYTOMAG-6K HMHMAG-34K EGF, FGF-2, Eotaxin, TGF-a, G-CSF,
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More informationProcartaPlex Multiplex Immunoassays
ProcartaPlex Immunoassay ProcartaPlex Multiplex Immunoassays Get exactly the panel you want What would the ability to simultaneously quantitate more than 60 cytokines or other soluble biomarkers from a
More informationExtend and pre-amplify 92 unique DNA reporter sequences by proximity extension.
VALIDATION DATA 1. Introduction Olink Inflammation is a reagent kit measuring 92 inflammation related human protein biomarkers simultaneously. The analytical performance of the product has been carefully
More informationGenetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
More informationImmunoassays LEGENDplex & ELISA Kits
Immunoassays LEGENDplex & ELISA Kits BioLegend is ISO 13485:2003 Certified Toll-Free Tel: (US & Canada): 1.877.BIOLEGEND (246.5343) Tel: 858.768.5800 biolegend.com 02-0017-00 World-Class Quality Superior
More informationCirculating Levels of Inflammatory Proteins and Survival in Patients with
Circulating Levels of Inflammatory Proteins and Survival in Patients with Gallbladder Cancer Zhiwei Liu 1 *, Troy J. Kemp 2, Yu-Tang Gao 3, Amanda Corbel 1, Emma E. McGee 1, Juan Carlos Roa 4,5, Bingsheng
More informationSystematic Reviews Protocols. A Reingold --- PI, Epidemiology review A Pollard -- PI, Immunological review
Systematic Reviews Protocols A Reingold --- PI, Epidemiology review A Pollard -- PI, Immunological review Two systematic reviews EPIDEMIOLOGICAL STUDIES Evidence available to document magnitude of any
More informationAntibodies. Product Name Cat. No. Size. GH (Growth Hormone) Antibody µg, 100 µg GM-CSF Antibody µg, 100 µg
JAK/STAT Signaling The JAK/STAT signaling pathway transmits a signal from outside the cell eventually resulting in DNA transcription and activity in the cell. Leptin (a product of the obese gene) can induce
More informationActivated mast cells promote differentiation of B cells into effector cells
Supplementary,information, Activated mast cells promote differentiation of B cells into effector cells Anna-Karin E. Palm 1, Gianni Garcia Faroldi 2, Marcus Lundberg 1, Gunnar Pejler 3, 2 and Sandra Kleinau
More informationSubject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
More informationElectrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it.
Electrolytes Version: 1 Edited by: Jason Kim (note that the following list should be linked to the appropriate location.) Summary Reagents and Materials Protocol Reagent Preparation Reagent 1 Reagent 2
More informationCytokines and Growth Factors
Cytokines and Growth Factors Cytokines are a category of signalling proteins and glycoproteins that, like hormones and neurotransmitters, are used extensively in cellular communication. While hormones
More informationImmunologic messenger molecules: Cytokines, interferons, and chemokines
Immunologic messenger molecules: Cytokines, interferons, and chemokines Scott P. Commins, MD, PhD, Larry Borish, MD, and John W. Steinke, PhD Charlottesville, Va Cytokines and chemokines are secreted proteins
More informationSupplemental Material
Supplemental Material The metabolic syndrome, inflammation and colorectal cancer risk; an evaluation of large panels of plasma protein markers using repeated, prediagnostic samples Sophia Harlid, Robin
More informationCytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,
Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under
More informationAVAILABLE BIOMARKER ASSAYS
AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationREPRODUCTIVE CYCLE OF FEMALE MAMMAL
REPRODUCTIVE CYCLE OF FEMALE MAMMAL Fig. 8-12 Secondary follicles growing follicles increase in number of layers of granulosa cells Tertiary follicles maturing follicles antrum formation fluid filled space
More informationLQ SCIENTIFIC & CLINICAL MONOGRAPH
LQ143.001 SCIENTIFIC & CLINICAL MONOGRAPH OrthoFlo Lyophilized Product Description OrthoFlo is a purified human amniotic fluid allograft that is intended for homologous use to protect and cushion, provide
More informationACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
More informationtoxins ISSN
Toxins 2013, 5, 336-362; doi:10.3390/toxins5020336 Review OPEN ACCESS toxins ISSN 2072-6651 www.mdpi.com/journal/toxins The Possible Diagnostic and Prognostic Use of Systemic Chemokine Profiles in Clinical
More informationC M. Chimerigen Laboratories C M. Biologically Active BULK Proteins. Butyrophilin-like 2 [BTNL2] mil-35/fc An Inhibitory Cytokine.
www.adipogen.com 2014 fusion Proteins Laboratories The Experts for High Quality Fusion Proteins NEW NEW Butyrophilin-like 2 [BTNL2] Butyrophilin-like 2 (BTNL2) is a butyrophilin family member with homology
More informationImmunology lecture: 14. Cytokines: Main source: Fibroblast, but actually it can be produced by other types of cells
Immunology lecture: 14 Cytokines: 1)Interferons"IFN" : 2 types Type 1 : IFN-Alpha : Main source: Macrophages IFN-Beta: Main source: Fibroblast, but actually it can be produced by other types of cells **There
More informationChapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues
Allergy and Immunology Review Corner: Chapter 3, Part A (pages 37-45) of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 3, Part A (Pages
More informationTNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationNeuroscience Research Related Cytokine Products
Neuroscience Research Related Cytokine Products Copyright 2017 by PeproTech, Inc. PeproTech, Inc. 5 Crescent Avenue Rocky Hill, NJ 08553-0275 Tel: (800) 436-9910 (609) 497-0253 Fax: (609) 497-0321 email:
More informationinvited review Chemokines and chemokine receptors in leukocyte trafficking
Am J Physiol Regulatory Integrative Comp Physiol 283: R7 R28, 2002; 10.1152/ajpregu.00738.2001. Chemokines and chemokine receptors in leukocyte trafficking invited review TIMOTHY S. OLSON AND KLAUS LEY
More informationWhich molecules of the initial phase of wound healing may be used as markers for early detection of skin damage?
Which molecules of the initial phase of wound healing may be used as markers for early detection of skin damage? L.H. Cornelissen October 2004 BMTE 04.53 Promotor: prof.dr.ir. F.P.T. Baaijens Coach: dr.ir.
More informationHIV AND INFLAMMATION: A NEW THREAT
HIV AND INFLAMMATION: A NEW THREAT KAP ANNUAL SCIENTIFIC CONFERENC MAY 2013 DR JOSEPH ALUOCH FRCP,EBS Basic Components of the Immune System Immunology: cells and tissues involved in recognizing and attacking
More informationAssay Kits
Assay Kits www.biogenuix.com» Immuno Assays Human Mouse Rat Rabbit Bovine Swine Equine Goat Faline Canine Chicken www.biogenuix.com Your leading RUO Assay supplier offering more than 800 Assays & Kits
More informationMultiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer
Original Article Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer Hongyan Huang, Yanbin Zhang, Sha Li, Jing Zhao, Xiaoli
More informationEditor Journal of Allergy and Therapy
Editor Journal of Allergy and Therapy Biography Prof. Domenico Ribatti was awarded his MD degree on October 1981 with full marks. His present position is of a full-time professor of Human Anatomy at the
More informationSTI and BV prevalence in young women in Cape Town and Soweto
STI and BV prevalence in young women in Cape Town and Soweto Shaun Barnabas Genital Mucosal and STI lab Desmond Tutu HIV Foundation University of Cape Town FAMCRU University of Stellenbosch WISH: Women
More informationMonocyte/macrophage infiltration in tumors: modulators of angiogenesis
Monocyte/macrophage infiltration in tumors: modulators of angiogenesis Anita E. M. Dirkx,* Mirjam G. A. oude Egbrink, John Wagstaff, and Arjan W. Griffioen*,1 *Angiogenesis Laboratory, Research Institute
More informationSeeds and soil theory by Stephen Paget at the end of the XIX century.
Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationCytokine 56 (2011) Contents lists available at SciVerse ScienceDirect. Cytokine
Cytokine 56 (211) 641 647 Contents lists available at SciVerse ScienceDirect Cytokine journal homepage: www. elsevier. com/ locate/ is sn/ 1434666 Macrophage Colony Stimulating Factor and Monocyte Chemoattractant
More informationBiomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers
Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest
More informationAirway Inflammation in Asthma Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan.
REVIEW ARTICLE Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan. 2 Division of Pediatric Pulmonology, Department of Pediatrics, Chang Gung Memorial
More informationThe g c Family of Cytokines Prof. Warren J. Leonard M.D.
The Family of Cytokines Chief, Laboratory of Molecular Immunology Director, Immunology Center National Heart, Lung, and Blood Institute National Institutes of Health Department of Health and Human Services
More informationSupplementary Online Content
Supplementary Online Content Willeit K, Pechlaner R, Willeit P, et al. Association between vascular cell adhesion molecule 1 and atrial fibrillation. JAMA Cardiol. Published online March 2, 2017. doi:10.1001/jamacardio.2017.0064
More informationLIST OF AVAILABLE ASSAYS. Methods/Platforms. Biomarkers Core Laboratory 622 West 168th Street PH New York, NY
Biomarkers Core Laboratory 622 West 168th Street PH10-105 New York, NY 10032 212.305.9306 Tel LIST OF AVAILABLE ASSAYS Assay Methods/Platforms 25 hydroxy Vitamin D2, D3 3-Aminopropanol Acetoacetate ACY-1215
More information4/18/2011. Physiology 67 Lecture on Neural Development
Physiology 67 Lecture on Neural Development 1 2 3 4 5 6 Neural cell categories After the ectodermal tissue has folded into the neural tube, another series of signaling interactions determine the type of
More informationReview Article Diabetic Retinopathy: Vascular and Inflammatory Disease
Journal of Diabetes Research Volume 2015, Article ID 582060, 16 pages http://dx.doi.org/10.1155/2015/582060 Review Article Diabetic Retinopathy: Vascular and Inflammatory Disease F. Semeraro, 1 A. Cancarini,
More informationRegulation of Wound Healing by Growth Factors and Cytokines
Physiol Rev 83: 835 870, 2003; 10.1152/physrev.00031.2002. Regulation of Wound Healing by Growth Factors and Cytokines SABINE WERNER AND RICHARD GROSE Institute of Cell Biology, Department of Biology,
More informationWideScreen BeadPlex Multiplex Assays. Spring 2010
WideScreen BeadPlex Multiplex Assays Spring 2010 Cancer Panels Cancer Biomarkers Cancer Panel 1 (Biomarkers) Cancer Panel 2 (Growth Factors) MMP Panel Cat No: BPHCP001-6 CA 125 CEA (Carcinoembryonic Antigen)
More informationACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY
ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through
More informationBiomarkers in drug discovery and development. Margit Wissenbach, PhD Dir Business Development Scandinavia
Biomarkers in drug discovery and development Margit Wissenbach, PhD Dir Business Development Scandinavia Aptuit: A Truly Integrated R&D Offering Integrated Discovery Integrated Development IND Candidate
More informationTargeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
More informationsilent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
More informationReview Article Understanding the Role of Chemokines and Cytokines in Experimental Models of Herpes Simplex Keratitis
Hindawi Immunology Research Volume 2017, Article ID 7261980, 5 pages https://doi.org/10.1155/2017/7261980 Review Article Understanding the Role of Chemokines and Cytokines in Experimental Models of Herpes
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More informationRayBio Human Thyroglobulin ELISA Kit
RayBio Human Thyroglobulin ELISA Kit Catalog #: ELH-Thyroglobulin User Manual Last revised July 6, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite
More informationB-cell. Astrocyte SCI SCI. T-cell
RF #2015 P-01 PI: Azizul Haque, PhD Grant Title: Targeting Enolase in Spinal Cord Injury 12-month Technical Progress Report Progress Report (First Six Months): Enolase is one of the most abundantly expressed
More informationImmunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,
Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity
More information* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
More informationTest Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas
Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas Chapter 04: Antigen Recognition in the Adaptive Immune System Test Bank MULTIPLE CHOICE 1. Most T lymphocytes
More informationTissue repair. (3&4 of 4)
Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid
More informationAllergic rhinitis (Hay fever) Asthma Anaphylaxis Urticaria Atopic dermatitis
Hypersensitivity Disorders Hypersensitivity Disorders Immune Response IgE Disease Example Ragweed hay fever IgG Cytotoxic Immune complex T Cell Hemolytic anemia Serum sickness Poison ivy IgE-mediated Diseases
More informationIRA-International Journal of Applied Sciences ISSN Vol. 03 Issue 02 (May, 2016) Paper DOI:
IRA-International Journal of Applied Sciences ISSN 2455-4499 Vol. 03 Issue 02 (May, 2016) Paper DOI: https://dx.doi.org/10.21013/jas.v3.n2.p8 Pathophysiology of Giant Cell Formation in Giant Cell Tumor
More informationGCP-2. Alternative names. Discovery. Structure. Anja Wuyts*, Paul Proost and Jo Van Damme SUMMARY BACKGROUND
Anja Wuyts*, Paul Proost and Jo Van Damme Laboratory of Molecular Immunology, Rega Institute ± University of Leuven, Minderbroedersstraat 10, Leuven, 3000, Belgium * corresponding author tel: 32-16-337384,
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More informationCopyright 2017 by PeproTech, Inc. PeproTech, Inc. 5 Crescent Avenue Rocky Hill, NJ
Copyright 2017 by PeproTech, Inc. PeproTech, Inc. 5 Crescent Avenue Rocky Hill, NJ 08553-0275 Tel: (800) 436-9910 (609) 497-0253 Fax: (609) 497-0321 email: info@peprotech.com sales@peprotech.com customerservice@peprotech.com
More informationInstant ELISA Kits. Accelerate Time to Result
Instant ELISA Kits Accelerate Time to Result High quality by design equals performance. 1 Our ELISA portfolio provides you with a complete offering of kits with a reputation of: High sensitivity Reliable
More information