Supplementary figure 1

Size: px

Start display at page:

Download "Supplementary figure 1"

Solomon Joseph
5 years ago
Views:

Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.

7 Sl glnd Blood 1 4 1 3 1 2 1 4 1 3 1 2 5.63.73 1 2 1 3 1 4 1 5 6.8.14 1 2 1 3 1 4 1 5 1 5.11.74 1 5.11.74 IEL 1 4 1 3 1 4 1 3 Kidney 1 2 1.29 98.5 1 2 1 3 1 4 1 5 1 2 97.7 2.

CD69 expression nd KLF2 downregultion correlte with prenchyml P14 T cells in NLT.

(A) IV nti-cd8 ntiody ws used to distinguish P14 cells in tissue prenchym (lck) versus vsculrssocited (red). Dt re overlid with wildtype P14 cells (grey filled) s control.

Showing CD8 IV versus CD69 (left) or KLF2-GFP (right). Horizontl dotted line represents the seprtion etween red pulp nd white pulp of the spleen, sed on previous studies (25).

1 Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection Blood Sl glnd Blood IEL Kidney Brin CD8 IV CD8 Frequency KLF2-GFP Supplementry figure 1. CD69 expression nd KLF2 downregultion correlte with prenchyml P14 T cells in NLT. Anlysis of KLF2-GFP expression in doptively trnsferred P14 cells 8 dys () or 3 dys post LCMV infection (). (A) IV nti-cd8 ntiody ws used to distinguish P14 cells in tissue prenchym (lck) versus vsculrssocited (red). Dt re overlid with wildtype P14 cells (grey filled) s control. Representtive of n=9 from 3 independent experiments. () Gted on live congeniclly mrked P14 cells isolted from different tissues. Showing CD8 IV versus CD69 (left) or KLF2-GFP (right). Horizontl dotted line represents the seprtion etween red pulp nd white pulp of the spleen, sed on previous studies (25). Representtive of 4 independent experiments with 3 mice ech. Arevitions s in Fig. 1. LPL Kidney Sl glnd Brin CD8 IV CD KLF2-GFP Nture Immunology: doi:1.138/ni.2745

Supplementry figure 2 Dy 5 Dy 8 Dy 3 Blood LPL Brin Frequency 1 2 1 4 1 2 1 4 1 2 1 4 KLF2-GFP KLF2-GFP MFI (ckground sutrcted) Blood IEL LPL Kidney Sl Brin glnd Supplementl figure 2.

() KLF2-GFP expression on live, non-vsculr-ssocited P14 cells t the indicted dys following LCMV infection, in lymphoid tissues (lck) nd NLT (red) (representtive of n=9 from 3 independent experiments).

2 Supplementry figure 2 Dy 5 Dy 8 Dy 3 Blood LPL Brin Frequency KLF2-GFP KLF2-GFP MFI (ckground sutrcted) Blood IEL LPL Kidney Sl Brin glnd Supplementl figure 2. Kinetics of KLF2 downregultion in lymphoid nd non-lymphoid tissues. Wildtype (grey filled) nd KLF2-GFP P14 cells (lck or red) were doptively co-trnsferred nd host mice infected with LCMV. () KLF2-GFP expression on live, non-vsculr-ssocited P14 cells t the indicted dys following LCMV infection, in lymphoid tissues (lck) nd NLT (red) (representtive of n=9 from 3 independent experiments). Cells in lood exhiit slightly lower KLF2-GFP levels reltive to spleen/, especilly t memory timepoints, for uncler resons. () GFP MFI from KLF2-GFP P14 cells isolted from vrious tissues 3 dys post LCMV infection. GFP MFI from wildtype P14 cells ws sutrcted from KLF2-GFP MFI to eliminte ckground vriility from tissue to tissue (this grph ws compiled from 2 independent, representtive experiments; n=6). Nture Immunology: doi:1.138/ni.2745

3 Supplementry figure 3 Supplementl figure 3. Schemtic for priosis experiments. Congeniclly distinct KLF2-GFP P14 cells were trnsferred into norml C57BL/6 mice, which were infected with LCMV the following dy. A prllel set of mice were infected ut did not receive P14 doptive trnsfer. At 3-65 dys post-infection, pris of trnsferred nd non-trnsferred mice underwent priotic surgery, nd dys fter surgery, pired nimls were scrificed nd tissues hrvested. The mice originlly receiving the KLF2-GFP P14 cell popultion is termed the "Donor" while the other niml in priotic pir is termed the "Priont". Nture Immunology: doi:1.138/ni.2745

Supplementry figure 4 Mock c Cellulr fold chnge 4.5 4. 3.5 3. 2. 1.5 1..5. Retrovirus constructs: Flg- vector: Empty vector (): Mock 1-3 Mock IRES 3-5 Additionl dys in vitro Thy-1.

() Retrovirl constructs used for trnsduction contined cdna in the first expression csette, or lcked gene t this site (Empty vector, ).

() Mock, or -trnsduced P14 cells incuted in vitro for 2 dys with 1 ng/ml hil-2 nd 25 nm gp33 peptide. Cells were stined for Thy-1.

Expression of the retrovirl is indicted y cell surfce Flgepitope stining, nd loss of stining for CD69 (which competes with for surfce expression). Gted on live CD8+ cells.

Dt show the fold-chnge in live cell numers over 2 dy increments. Dt were compiled from t lest 3 independent experiments (n=5-8).

4 Supplementry figure 4 Mock c Cellulr fold chnge Retrovirus constructs: Flg- vector: Empty vector (): Mock 1-3 Mock IRES 3-5 Additionl dys in vitro Thy-1.1 Mock CD69 Flg Thy1.1 trnsduced Supplementry figure 4. Retrovirl trnsduction system used for forced nd KLF2 expression. () Retrovirl constructs used for trnsduction contined cdna in the first expression csette, or lcked gene t this site (Empty vector, ). A similr construct ws used for forced KLF2 expression (Fig 1f). In ll cses, Thy-1.1 ws used s trnsduction mrker. (-d) Chrcteriztion of trnsduction system using vector. () Mock, or -trnsduced P14 cells incuted in vitro for 2 dys with 1 ng/ml hil-2 nd 25 nm gp33 peptide. Cells were stined for Thy-1.1 (the trnsduction mrker) nd for CD69 or the Flg-epitope (which ws cloned into the N- terminus of the retrovirl ). Expression of the retrovirl is indicted y cell surfce Flgepitope stining, nd loss of stining for CD69 (which competes with for surfce expression). Gted on live CD8+ cells. (c) Mock (grey), (red), nd (lck) trnsduced P14 cells were cultured in vitro for dditionl dys with 2ng/ml hil-2. Dt show the fold-chnge in live cell numers over 2 dy increments. Dt were compiled from t lest 3 independent experiments (n=5-8). (d) Trnsduction efficiency of live (top) nd (ottom) trnsduced P14 cells cultured in vitro s in (). Ech line is from n independent experiment (n=7). Note tht prolifertion is not impired in the trnsduced popultion (reltive to mock or trnsduced) (c), nd tht there is no selective disdvntge of trnsduced cells for expnsion (d). d % trnsduction trnsduced D2 D4 D6 D2 D4 D Additionl dys in vitro Nture Immunology: doi:1.138/ni.2745

5 Supplementry figure 5 Congenic P14 cells: Non-vsculr ssocited: % trnsduced: c # P14 cells CD CD8 IV CD45.1 CD8 Thy1.1 % trnsduced P14 in tissue % trnsduced P14 in spleen = rtio Frequency # trnsduced P14 cells IEL LPL Sl glnd Supplementry figure 5. Gting strtegy nd numer of ulk nd trnsduced P14 cells for trnsduction model in vivo. () Gting strtegy for clculting percent trnsduction per tissue nd eqution for clculting normlized trnsduction reltive to the spleen. Adoptively co-trnsferred P14 cells were identified using congenic mrkers, non-vsculr-ssocited cells were detected using CD8 IV dministrtion, nd percent trnsduction ws clculted using the Thy1.1 mrker. () Numer of totl non-vsculr-ssocited P14 T cells from spleen nd tht underwent (red) or (lck) trnsduction prior to doptive trnsfer. The dte rnges re the times of scrifice following in vivo LCMV infection. (c) Numer of trnsduced, non-vsculr-ssocited P14 T cells for (lck) or (red) vectors in indicted tissues within the time rnges following LCMV infection in vivo. (-c) Dt re compiled from 4 independent experiments (n=9-15) Nture Immunology: doi:1.138/ni.2745

Supplementry figure 6 Frequency trnsduced reltive to SPL IEL Percent CD13 +ve 9 LPL 8 7 6 5 4 3 2 1 ns ** ns 5 8 3 9 8 7 6 5 4 3 2 1 Sl glnd ns ns ns 5 8 3 Supplementry figure 6.

6 Supplementry figure 6 Frequency trnsduced reltive to SPL IEL Percent CD13 +ve 9 LPL ns ** ns Sl glnd ns ns ns Supplementry figure 6. Compred to -trnsduced P14 cells, there is no skewing towrd CD13 expression on the few -trnduced P14 cells tht remin in non-lymphoid tissue. () Shows percent trnsduction (reltive to spleen) of (lck) nd (red) vectortrnsduced P14 cells in the prenchym of IEL 28-6 dys post LCMV. The frequency of trnsduced cells ws more vrile in the IEL versus other non-lymphoid tissue (see Fig. 4,4d). N=15-18 from t lest 5 independent experiments. () The percentge of CD13+ P14 cells trnsduced y (lck) or (red) vectors in the indicted tissue prenchym isolted t 5, 8 nd 3 dys post LCMV infection (n=9 from 3 independent experiments). (-) All nlyses used gting on live, non-vsculr-ssocited CD8+ P14 T cells. Nture Immunology: doi:1.138/ni.2745

Supplementry figure 7 c KLF2-GFP MFI e Normlized KLF2-GFP Time (h) No dditionl cytokines LY2942 (TGF-β+IL-33) Time (h) TGF-β/ IL-33 no cytokines

M um 5uM 1uM TGF-β + IL-33 no cytokines Normlized KLF2-GFP M 1. 1.25

um No cytokine 5uM 1uM LY2942 (No dditionl cytokines) *** (ns) IL-15 TGF-β+ IL-33 d *** TGF-β + IL-33+ IL-15 GFP-KLF2 KLF2-GFP MFI MFI (Bckground

TGF/IL-33 + AKTi TGF-β /IL-33 + Ly (ns) No Cyt. + Ly TGF-β /IL-33 + AKTi No Cyt. + Ly No Cyt. + AKTi No Cyt. + AKTi % CD13+ 7.5 5.

TGF-β nd IL-33 induce loss of KLF2 expression in PI3K/Akt dependent pthwy.

() Splenocytes were cultured with TGF-β nd IL-33 (grey) or no dditionl cytokines (lck) (set s one) for 1-4 hours (n=11-13 from t lest 4

7 Supplementry figure 7 c KLF2-GFP MFI e Normlized KLF2-GFP Time (h) No dditionl cytokines LY2942 (TGF-β+IL-33) Time (h) TGF-β/ IL-33 no cytokines TGF-β+IL uM um 5uM 1uM TGF-β + IL-33 no cytokines Normlized KLF2-GFP TGF-β+IL uM ** um No cytokine 5uM 1uM LY2942 (No dditionl cytokines) *** (ns) IL-15 TGF-β+ IL-33 d *** TGF-β + IL-33+ IL-15 GFP-KLF2 KLF2-GFP MFI MFI (Bckground (Bckground sutrcted) sutrcted) No Cytokine No Cytokine *** *** *** TGF/IL-33 TGF-β /IL-33 No dditionl cytokines (ns) TGF/IL-33 + Ly TGF/IL-33 + AKTi TGF-β /IL-33 + Ly (ns) No Cyt. + Ly TGF-β /IL-33 + AKTi No Cyt. + Ly No Cyt. + AKTi No Cyt. + AKTi % CD LY2942 (um) AKTi (um). None LY2942 (um) AKTi (um) Supplementry figure 7. TGF-β nd IL-33 induce loss of KLF2 expression in PI3K/Akt dependent pthwy. (-c, e) Wildtype nd KLF2-GFP P14 cells were co-trnsferred nd recipients infected with LCMV for 4.5 dys efore scrifice nd splenocyte preprtion. () Splenocytes were cultured with TGF-β nd IL-33 (grey) or no dditionl cytokines (lck) (set s one) for 1-4 hours (n=11-13 from t lest 4 independent experiments). () Splenocytes were cultured with the indicted cytokines for 4 hrs ex vivo (s in Fig. 7)(n=8 from 3 independent experiments). The grph shows men (+/- SEM) of KLF2-GFP expression in P14 cells, normlized to P14 cells cultured with no dded cytokines. (c) Splenocytes were exposed to TGF-β nd IL-33 (left) or no dditionl cytokines (right) in the presence of indicted LY2942 concentrtions for 4 hrs ex vivo). Grph shows KLF2-GFP men fluorescent intensity of P14 cells (representtive of 4 independent experiments (n=8)). (d) Wildtype nd KLF2-GFP P14 CD8+ T cells were ctivted in vitro for 48 hours nd then cultured with cytokines nd inhiitors s in Fig. 7d. Dt compiled from 4 independent experiments (e) Percentge of CD13+ P14 cells from splenocytes cultured in indicted cytokines nd inhiitors (similr to Fig. 7c). Dt re compiled from 4 experiments (n=12). Nture Immunology: doi:1.138/ni.2745

8 Supplementry figure 8 KLF2-GFP gmfi (vehicle set s 1) IEL * (ns) Sl glnd ** Vehicle only LY2942 LPL **.5.5. Vehicle only LY2942 Vehicle only LY2942. Vehicle only LY2942 Vehicle only LY2942 Normlized Foxo SPL ** ** SG Sl glnd Supplementry figure 8. In vivo dministrtion of the PI3K inhiitor LY2942 leds to upregultion of KLF2 in the slivry glnd nd LPL; Foxo1 expression is reduced in memory P14 CD8+ T cells from NLT versus lymphoid sites. () Wildtype nd KLF2-GFP P14 CD8+ T-cells were co-trnsferred into C57BL/6 nimls which were then infected with LCMV. Four dys post infection, nimls were treted with LY2942 or vehicle only, s in Fig. 7f. N=12 from 5 independent experiments. () KLF2-GFP gmfi (minus wildtype gmfi) ws clculted nd nlyzed (with vehicle only group set s 1). () P14 cells were isolted from spleen nd slivry glnd 3-6 dys post LCMV nd stined for intrcellulr Foxo1 protein (n=9 from 3 independent experiments). Dt re normlized on isotype control nd gted on live P14 CD8+ T cells. Sttisticl nlysis for () used ANOVA, while () used Student s t-test. Nture Immunology: doi:1.138/ni.2745

9 Supplementry Tle 1. Antiody Clone CD4 GK1.5 CD CD CD45.1 A2 CD CD62L MEL-14 CD69 H1-2F3 CD13 M29 Thy1.1 OX-7/H1551 Antiodies were purchsed, s vrious fluorochrome conjugtes from ebioscience, BD Bioscience, R&D Systems or BioLegend (conjugtes of the sme ntiody clone were purchsed from vrious vendors, hence we do not list the vendor providing prticulr ntiody). Nture Immunology: doi:1.138/ni.2745

10 Supplementry Tle 2. Gene Forwrd (5 to 3 ) Reverse (5 to 3 ) Klf2 ACCAACTGCGGCAAGACCTA CATCCTTCCCAGTTGCAATGA S1pr1 GTGTAGACCCAGAGTCCTGCG AGCTTTTCCTTGGCTGGAGAG Sell CTAATTTCCCCTCGCTCATTCAT GCATTAGCTTCTGTGCTGAATTGA Cd69 TGGTCCTCATCACGTCCTTAATAA TCCAACTTCTCGTACAAGCCTG Cd8 AAGAAAATGGACGCCGAACTT AAGCCATATAGACAACGAAGGTG Hprt CATTATGCCGAGGATTTGGAA CACACAGAGGGCCACAATGT Gpdh TGGCCTACATGGCCTCCA TCCCTAGGCCCCTCCTGTTAT Nture Immunology: doi:1.138/ni.2745

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized