Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection

Size: px
Start display at page:

Download "Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection"

Transcription

1 Supplemental Materials Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic hepatitis B infection Cai-Feng Chen 1#, Xia Feng 2#, Hui-Yu Liao 2#, Wen-Jing Jin 1, Jian Zhang 3, Yu Wang 4 Lu-Lu Gong 1, Jing-Jun Liu 1, Xiao-Hui Yuan 1, Bin-Bin Zhao 1, Ding Zhang 1, Guo-Feng Chen 3 Ying Wan 5, Jian Guo 4 Hui-Ping Yan 2, and You-Wen He 4 1

2 Table S1. Characteristics of treatment-naïve CHB patients and healthy donors. Characteristic Value CHB patients Healthy donors Number %Men 67% 51% Median Age 35 (20-69) 32(24-54) Median HBV DNA(copies/ml) (< ) <500 Median ALT level(u/l) 56.8( ) 18( ) Median AST level(u/l) 49.2( ) 22(10-42) Median TBIL level(µm/l) HBeAg postive (number) 16.1( ) ( ) 0 ALT, alanine aminotransferase; AST, aspartate aminotransferase; TBIL, total bilirubin. 2

3 Table S2 List of primer sequences for qpcr detection of 32 cell cycle regulators. Primers for real time PCR Official Symbol Forward Reverse BAX GACATGTTTTCTGACGGCAAC AAGTCCAATGTCCAGCCC PCNA CCGAAACCAGCTAGACTTTCC GATGAGGTCCTTGAGTGCC RAD9A AGAAGTTCCGCTCACTGTTC AGGCTTCAGGTTCTTGGTTC TP53 GCCATCTACAAGCAGTCACAG TCATCCAAATACTCCACACGC RBL2 GAACCTGGGAACTTTGGAGAG GCGTTCAGACACCTTGAGAG CDKN2B GTTAAGTTTACGGCCAACGG ACCTTCTCCACTAGTCCCC TFDP1 ACTCACTTTGCCTCTCAGAAC CTTTCCTCTGCACCTTCTCG CCND2 CCTCCAAACTCAAAGAGACCAG TTCCACTTCAACTTCCCCAG BRCA2 TTCATGGAGCAGAACTGGTG AGGAAAAGGTCTAGGGTCAGG BCL2 ACTGGAGAGTGCTGAAGATTG AGTCTACTTCCTCTGTGATGTTG CDK8 AAGAGGAAAGATGGGAAGGATG GAAGAGAAATGACGTTTGGATGC MKI67 AAAAGAATTGAACCTGCGGAAG AGTCTTATTTTGGCGTCTGGAG BIRC5 CTTCATCCACTGCCCCAC ACTTTCTCCGCAGTTTCCTC SUMO1 GGGAAGGGAGAAGGATTTGTAA GTCCTCAGTTGAAGGTTTTGC UBE1 GTCACAAAGTTTTCGGCAGTC AATGTGCCAAGTCCAGATCC CDKN3 ACAATATCACCAGAGCAAGCC GCAGCTAATTTGTCCCGAAAC CDK6 TCGATGAACTAGGCAAAGACC AGGTGGGAATCCAGGTTTTC CDK5R1 AGATAAATGCCGACCCACAC TGAATCCTTGAGCCATGACG DNM2 CAGTAAGCTCAGTTCCTACCC AGTCCTCATGGTTCGTGTTG CDC20 GATGTAGAGGAAGCCAAGATCC AAGGAATGTAACGGCAGGTC GTF2HI TCCACATCCAATCATAAGCAGG CTTAGACCGTTACAGCCATCAG ARHI ACGTATCTCCCCTCCGAATC GCGGTAATCTCTGATCTTCCTG RPA3 TGTGGAAGTGGTTGGAAGAG AGGATAAAACTGAGGGAAGTCATG MNAT1 CTTGAAGCTGATGGTGAATGTG AGTTGTACCCTGAAGTTGCTC GTSE1 AAGTACTGCCACAGAAGTAGC CGATGAGAGGAAGGTCAATGAG GADD45A GGGAAAGTCGCTACATGGATC GTGTAGGGAGTAACTGCTTGAG ATM ATTCCGACTTTGTTCCCTCTG CATCTTGGTCCCCATTCTAGC MAD2L1 GACAGATCACAGCTACGGTG GGCGGACTTCCTCAGAATTG NBN AGACCAACTCCATCAGAAACTAC AATGAGGGTGTAGCAGGTTG MRE GTAACCCAAGCCATACAAAGC ACCTCCACTATAGTCCACTCG P21 TGTCACTGTCTTGTACCCTTG GGCGTTTGGAGTGGTAGAA CDK4 TTCCCATCAGCACAGTTCG TCTACATGCTCAAACACCAGG Forward, sense primer; Reverse, anti-sense primer. 3

4 Table S3. Characteristics of treatment responsive and unresponsive CHB patients. Characteristic Value HBeAg seroconversion HBeAg non-seroconversion Baseline EOT Baseline EOT Number %Men 80% 80% 80% 80% Age 32(25-47) 33(26-49) 45(27-61) 46(28-62) HBV DNA(copies/ml) ( ) < ( ) <500 ALT level(u/l) 82.16( ) 26( ) 73( ) 19( ) AST level(u/l) 51.96( ) 32( ) 49.1( ) 28(12-45) TBIL level(µm/l) 64.68( ) 6.8( ) 31.6( ) 7.2( ) HBeAg 1150( ) 0.21( ) 814( ) 118.9( ALT, alanine aminotransferase; AST, aspartate aminotransferase; TBIL, total bilirubin. 4

5 Table S4. Treatment details of 10 CHB patients. HBV1-5 were patients who underwent HBeAg seroconversion and HBV6-10 were patients who did not undergo HBeAg seroconversion Groups Drug names Course(months) HBV1 AdefovirDipivoxil Tablets 18 HBV2 AdefovirDipivoxil Tablets 15 HBeAg serological Conversion Non-HBeAg serological Conversion HBV3 AdefovirDipivoxil Tablets 17 HBV4 Peginterferon alfa-2a 15 HBV5 Peginterferon alfa-2a 18 HBV6 AdefovirDipivoxil Tablets 17 HBV7 Peginterferon alfa-2a 23 HBV8 AdefovirDipivoxil Tablets 12 HBV9 AdefovirDipivoxil Tablets 17 HBV10 AdefovirDipivoxil Tablets 13 5

6 Fig. S1. Regulation of T cell function by CDKN3 and JMJD6. (a-c) Effect of CDKN3 sirna treatment on proliferation, cell cycle status and cytokine production of JMJD6- silenced CD4 + and CD8 + T cells. PBMCs from HDs were transfected with NC sirna, JMJD6 sirna, JMJD6 sirna plus CDKN3 sirna, or CDKN3 sirna alone. Transfected 6

7 PBMCs were analyzed for CFSE dilution (n=5) (a), Ki67 expression (n=4) (b) and intracellular IL-2 production (c) of CD4 + and CD8 + T cells. (d) IL-2R expression on T cells upon JMJD6 sirna treatment. (e) IL-2R expression on T cells upon PDGF-BB treatment. PBMCs were cultured in the presence of PDGF-BB for 48 h and CD132, CD122 and CD25 were detected by FACS on CD4 + T cells. Labels in d and e are: NC si, non-specific control sirna; JMJD6 si, JMJD6 specific sirna; Iso, isotype control. 7

8 Fig. S2. CDKN3 isoform expression in human PBMCs with or without JMJD6 sirna treatment and effect of CHB sera on the proliferation of CD8 + T cells from healthy donors. (a) PBMCs were separately transfected with NC sirna or JMJD6 sirna and cultured for 2 d. CDKN3 isoforms were detected in the treated cells by PCR using CDKN3 isoform specific primers. GAPDH serves as a loading control. (b) The effect of sera from ALT(high) or ALT(low) CHB patients on CD8 + T cell proliferation. T cells from healthy donors were cultured with CHB patients sera and measured for proliferation as described in the Method. 8

9 Fig. S3. Inverse correlation between JMJD6 mrna expression and liver function in CHB patients (n=23). (a) Correlation between JMJD6 mrna expression in total PBMCs and patients ALT and AST levels. (b) Correlation between JMJD6 mrna expression in total PBMCs and patients HBV DNA load. (c) Correlation between JMJD6 mrna expression in total PBMCs and patients TBIL and DBIL. (d) Correlation between patients ALT or AST and TBIL in CHB patients. P values and r-square values are indicated. 9

10 Fig. S4. Expression of JMJD6 mrna in CD4 + T cells and PDGF-BB in the plasma of CHB patients was correlated with their treatment outcome. (a) JMJD6 mrna expression in purified CD4 + T cells from treatment-responsive and unresponsive CHB patients. Frozen PBMCs from CHB patients before treatment (Baseline) and at the end of the treatment period (EOT) were used for CD4 + T cell isolation and measurement of JMJD6 mrna expression by qpcr. (b) PDGF-BB levels in the plasma of treatment-responsive and unresponsive CHB patients as measured by ELISA. 10

11 11

SYNOPSIS. Clinical Study Report AI Addendum #1. Open-label Dosing Phase

SYNOPSIS. Clinical Study Report AI Addendum #1. Open-label Dosing Phase Name of Sponsor/Company: Bristol-Myers Squibb Name of Finished Product: Individual Study Table Referring to the Dossier (For National Authority Use Only) Name of Active Ingredient: Entecavir SYNOPSIS Clinical

More information

Supplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a

Supplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a Supplementary materials: Predictors of response to pegylated interferon in chronic hepatitis B: a real-world hospital-based analysis Yin-Chen Wang 1, Sien-Sing Yang 2*, Chien-Wei Su 1, Yuan-Jen Wang 3,

More information

Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54

Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54 CORRECTION NOTICE Nat. Genet. 42, 759 763 (2010); published online 22 August 2010; corrected online 27 August 2014 Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects

More information

[DOI] /j.issn , China

[DOI] /j.issn , China Med J Chin PLA, Vol. 41, No. 5, May 1, 2016 351 HBsAg HBs S N- [ ] (HBV)HBsAg+ HBs S (MHR) N- HBsAg+ HBs 284 HBsAg+ HBs 314 HBsAg HBV S 1 MHR N- N- S/S HepG2 HBsAg+ HBs MHR N- 11.3%(32/284) HBsAg 2.9%(9/314)(P

More information

Title:Identification of a novel microrna signature associated with intrahepatic cholangiocarcinoma (ICC) patient prognosis

Title:Identification of a novel microrna signature associated with intrahepatic cholangiocarcinoma (ICC) patient prognosis Author's response to reviews Title:Identification of a novel microrna signature associated with intrahepatic cholangiocarcinoma (ICC) patient prognosis Authors: Mei-Yin Zhang (zhangmy@sysucc.org.cn) Shu-Hong

More information

EMPEROR'S COLLEGE MTOM COURSE SYLLABUS HERB FORMULAE II

EMPEROR'S COLLEGE MTOM COURSE SYLLABUS HERB FORMULAE II COURSE DESCRIPTION The second of three courses in the Herb Formulae series. Categories covered in Formulae II include the Tonify Qi and Blood, Regulate Qi, Invigorate the Blood, Stop Bleeding, Stabilize

More information

Xiao-Ling Chi, Mei-Jie Shi, Huan-Ming Xiao, Yu-Bao Xie, and Gao-Shu Cai. Correspondence should be addressed to Xiao-Ling Chi;

Xiao-Ling Chi, Mei-Jie Shi, Huan-Ming Xiao, Yu-Bao Xie, and Gao-Shu Cai. Correspondence should be addressed to Xiao-Ling Chi; Evidence-Based Complementary and Alternative Medicine Volume 2016, Article ID 3743427, 6 pages http://dx.doi.org/10.1155/2016/3743427 Research Article The Score Model Containing Chinese Medicine Syndrome

More information

Y. Xiang*, P. Chen*, J.R Xia and L.P. Zhang

Y. Xiang*, P. Chen*, J.R Xia and L.P. Zhang A large-scale analysis study on the clinical and viral characteristics of hepatitis B infection with concurrence of hepatitis B surface or E antigens and their corresponding antibodies Y. Xiang*, P. Chen*,

More information

Cornerstones of Hepatitis B: Past, Present and Future

Cornerstones of Hepatitis B: Past, Present and Future Cornerstones of Hepatitis B: Past, Present and Future Professor Man-Fung Yuen Queen Mary Hospital The University of Hong Kong Hong Kong 1 Outline Past Natural history studies Development of HBV-related

More information

Researches on Fermentation Engineering of Polysaccharide of

Researches on Fermentation Engineering of Polysaccharide of 13 1 Vol13 No1 1 2009 2 Life Science Research Feb 2009 1a 1b, 2, 1 416000 2 416000 3 410300 : (Cordyceps militaris), :, 6% 1% 25, ; 6% 1% 22, : ; ; ; ; ; : TQ92 : A : 1007-7847(2009)01-0065-06 Researches

More information

CORRELATION BETWEEN SURVIVIN OVEREXPRESSION AND CLINICO-PATHOLOGICAL FEATURES OF INVASIVE CERVICAL CANCER: A META-ANALYSIS

CORRELATION BETWEEN SURVIVIN OVEREXPRESSION AND CLINICO-PATHOLOGICAL FEATURES OF INVASIVE CERVICAL CANCER: A META-ANALYSIS Acta Medica Mediterranea, 2018, 34: 1091 CORRELATION BETWEEN SURVIVIN OVEREXPRESSION AND CLINICO-PATHOLOGICAL FEATURES OF INVASIVE CERVICAL CANCER: A META-ANALYSIS HUI-RONG LI 1, JI-LI BAI 2*, RUI XU 2,

More information

A preliminary report on the influence of baseline cellular immunity to the therapeutic responses of peg-interferon

A preliminary report on the influence of baseline cellular immunity to the therapeutic responses of peg-interferon 146 2009 9 4 3 Journal of Microbes and Infection, September 2009, Vol. 4, No. 3 e 2a 1, 2, 1, 1, 1, 1, 1, 1 1., 200025; 2., 200032 : ( CHB) ( IFN), IFN IFN, e ( HBeAg) CHB 19, 14, IFN- 2a 180 g, 1, 48,

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,

More information

Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan

Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan Overexpression of FAM83H-AS1 indicates poor patient survival and knockdown impairs cell proliferation and invasion via MET/EGFR signaling in lung cancer Jie Zhang 1,2, Shumei Feng 3, Wenmei Su 4, Shengbin

More information

The Human Cathelicidin LL37 Peptide has High Plasma Levels in B and C Hepatitis Related to Viral Activity but not to 25-Hydroxyvitamin D Plasma Level

The Human Cathelicidin LL37 Peptide has High Plasma Levels in B and C Hepatitis Related to Viral Activity but not to 25-Hydroxyvitamin D Plasma Level The Human Cathelicidin LL37 Peptide has High Plasma Levels in B and C Hepatitis Related to Viral Activity but not to 25-Hydroxyvitamin D Plasma Level SIMONA ALEXANDRA IACOB 1, EUGENIA PANAITESCU 2, DIANA

More information

Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:

Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author: Title:Eplerenone restores -h blood pressure circadian rhythm and reduces advanced glycation end-products in rhesus macaques with spontaneous hypertensive metabolic syndrome Yan Zhang,,Wen Zheng,, Yuli

More information

How to use pegylated Interferon for Chronic Hepatitis B in 2015

How to use pegylated Interferon for Chronic Hepatitis B in 2015 How to use pegylated Interferon for Chronic Hepatitis B in 215 Teerha Piratvisuth NKC Institute of Gastroenterology and Hepatology Prince of Songkla University, Thailand ASIAN-PACIFIC CLINICAL PRACTICE

More information

Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.

Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. a. 12 14 Relative apob mrna (%) 8 6 4 2 Relative apob mrna (%) 12 8 6 4 2 5

More information

Final Clinical Study Report. to the Dossier SYNOPSIS. Final Clinical Study Report for Study AI463110

Final Clinical Study Report. to the Dossier SYNOPSIS. Final Clinical Study Report for Study AI463110 BMS-475 AI463 Name of Sponsor/Company: Bristol-Myers Squibb Individual Study Table Referring to the Dossier For National Authority Use Only) Name of Finished Product: Baraclude Name of Active Ingredient:

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

Role of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation

Role of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation BRIEF REPORT Role of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation Man-Fung Yuen, 1 Erwin Sablon, 2 Danny Ka-Ho Wong, 1 He-Jun Yuan, 1 Benjamin Chun-Yu Wong, 1 Annie On-On Chan, 1 and

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Scottish Medicines Consortium

Scottish Medicines Consortium Scottish Medicines Consortium pegylated Interferon alfa 2a, 180 mcg for subcutaneous injection (Pegasys ) No. (186/05) Roche New indication (chronic hepatitis B) 10 June 2005 The Scottish Medicines Consortium

More information

Supplementary Information:

Supplementary Information: Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema

More information

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,

More information

Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism

Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism Supplementary Materials Organochloride pesticides impaired mitochondrial function in hepatocytes and aggravated disorders of fatty acids metabolism Qian Liu 1,2,3*, Qihan Wang 4*, Cheng Xu 2,3, Wentao

More information

Diagnostic Accuracy of Intracellular Mycobacterium. tuberculosis Detection for Tuberculous Meningitis

Diagnostic Accuracy of Intracellular Mycobacterium. tuberculosis Detection for Tuberculous Meningitis Diagnostic Accuracy of Intracellular Mycobacterium tuberculosis Detection for Tuberculous Meningitis Running title: Laboratory diagnosis of tuberculous Guo-Dong Feng (MD PhD);Ming Shi(MD PhD); Lei Ma(MD

More information

Abstract AIM: To analyze the clinical features of druginduced liver injury (DILI), and discuss the risk factors affecting its prognosis.

Abstract AIM: To analyze the clinical features of druginduced liver injury (DILI), and discuss the risk factors affecting its prognosis. : http://www.baishideng.com/wcjd/ch/index.aspx : http://www.wjgnet.com/esps/helpdesk.aspx DOI: 10.11569/wcjd.v24.i8.1257 2016 3 18 ; 24(8): 1257-1263 ISSN 1009-3079 (print) ISSN 2219-2859 (online) 2016

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

Drug Class Monograph

Drug Class Monograph Drug Class Monograph Class: Chronic Hepatitis B Drug: Baraclude (entecavir), Epivir (lamivudine), Hepsera (adefovir), Intron A (interferon alfa- 2b), Pegasys (peginterferon alfa-2a), Tyzeka (telbivudine),

More information

Hepatitis B Virus therapy. Maria Buti Hospital Universitario Valle Hebron Barcelona Spain

Hepatitis B Virus therapy. Maria Buti Hospital Universitario Valle Hebron Barcelona Spain Hepatitis B Virus therapy Maria Buti Hospital Universitario Valle Hebron Barcelona Spain Disclosures Advisor: AbbVie, Boehringer Ingelheim, Bristol-Myers Squibb, Gilead Sciences, Janssen, Merck Sharp &

More information

Medicine. Ka Zhang, MD a, Hong Cao, MD a, Jiayi Liang, MD b, Xin Shu, MD a, Haixia Sun, MD a, Gang Li, PhD a, Qihuan Xu, PhD a,

Medicine. Ka Zhang, MD a, Hong Cao, MD a, Jiayi Liang, MD b, Xin Shu, MD a, Haixia Sun, MD a, Gang Li, PhD a, Qihuan Xu, PhD a, Clinical Trial/Experimental Study Medicine CONSORT: Effects of adding adefovirdipivoxil to peginterferon alfa-2a at different time points on HBeAg-positivepatients A prospective, randomized study Ka Zhang,

More information

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus

More information

Hepatitis B Prior Authorization Policy

Hepatitis B Prior Authorization Policy Hepatitis B Prior Authorization Policy Line of Business: Medi-Cal P&T Approval Date: November 15, 2017 Effective Date: January 1, 2018 This policy has been developed through review of medical literature,

More information

Hepatitis B Virus therapy. Maria Buti Hospital Universitario Valle Hebron Barcelona Spain

Hepatitis B Virus therapy. Maria Buti Hospital Universitario Valle Hebron Barcelona Spain Hepatitis B Virus therapy Maria Buti Hospital Universitario Valle Hebron Barcelona Spain Disclosures Advisor: AbbVie, Boehringer Ingelheim, Bristol-Myers Squibb, Gilead Sciences, Janssen, Merck Sharp &

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Pan CQ, Duan Z, Dai E, et al. Tenofovir to prevent hepatitis

More information

Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters

Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters Supplementary Data: Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters Tiffany Hung 1,2, Yulei Wang 3, Michael F. Lin 4,5, Ashley K. Koegel 1,2, Yojiro Kotake 6-8, Gavin

More information

Treatment of Chronic Delta Hepatitis: A Nine-Year Retrospective Analysis

Treatment of Chronic Delta Hepatitis: A Nine-Year Retrospective Analysis . DOI: 10.5812/kowsar.1735143X.728 KOWSAR Journal home page: www.hepatmon.com Treatment of Chronic Delta Hepatitis: A Nine-Year Retrospective Analysis Serda Gulsun 1 *, Recep Tekin 2, Fatma Bozkurt 2 1

More information

RT 2 Profiler PCR Array:

RT 2 Profiler PCR Array: RT 2 Profiler PCR Array: Rat Cell Cycle Catalog Number For Real-Time Instruments: PARN-020A ABI Standard Blocks; Bio-Rad icycler, MyiQ, and (MJ Research) Chromo 4; and Stratagene Mx3005p, Mx3000p PARN-020C

More information

Scottish Medicines Consortium

Scottish Medicines Consortium Scottish Medicines Consortium tenofovir disoproxil (as fumarate), 245 mg film-coated tablet (Viread ) No. (479/08) Gilead Sciences 06 June 2008 The Scottish Medicines Consortium has completed its assessment

More information

TRPM8 in the negative regulation of TNFα expression during cold stress

TRPM8 in the negative regulation of TNFα expression during cold stress in the negative regulation of TNFα expression during cold stress Xin-Pei Wang 1, Xuan Yu 1, Xiao-Jin Yan 1, Fan Lei 2, Yu-Shuang Chai 1, Jing-Fei Jiang 1, Zhi- Yi Yuan 1, Dong-Ming Xing 1, Li-Jun Du 1*

More information

Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by

Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by Marine Streptomyces sp. derived antimycin analogues suppress HeLa cells via depletion HPV E6/E7 mediated by ROS-dependent ubiquitin proteasome system Weiyi Zhang 1, +, Qian Che 1, 2, +, Hongsheng Tan 1,

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

Appropriate Quality regarde as

Appropriate Quality regarde as A systematic review of antibiotic prescription associated with upper respiratory tract infections in China (Jing Li, MS 1 ) Supplemental Digital Content-Table 1. Quality assessment of included studies

More information

CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt

CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt Supplementary Information CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt Jae Hyang Lim, Hirofumi Jono, Kensei Komatsu, Chang-Hoon Woo, Jiyun Lee, Masanori Miyata,

More information

Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced

Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis implicating regulation of energy metabolism Xu-Guang Jiang 1,2,, Kai Sun 1,3,4,5,, Yu-Ying Liu 1,4,5, Li Yan 1,4,5,

More information

A 20 year-old university student Known chronic HBV infection since he was 12 year-old.

A 20 year-old university student Known chronic HBV infection since he was 12 year-old. Case 1 A 20 year-old university student Known chronic HBV infection since he was 12 year-old. His father died from HCC. Two of his 3 brothers also have chronic hepatitis B Still asymptomatic with persistent

More information

AVINASH CHANDRA, MD. September 16 th, Business Address: Buffalo Neuroimaging Analysis Center

AVINASH CHANDRA, MD. September 16 th, Business Address: Buffalo Neuroimaging Analysis Center AVINASH CHANDRA, MD September 16 th, 2014 Title: MRI Fellow Business Address: Buffalo Neuroimaging Analysis Center 100 High Street; Buffalo, NY 14203 Work: 716 859 7040 Email: achandra@bnac.net Education

More information

Bringing quantitative HBsAg to the US provider, drug development and patient network

Bringing quantitative HBsAg to the US provider, drug development and patient network Bringing quantitative HBsAg to the US provider, drug development and patient network Presenter Robert G Gish MD Adjunct Professor, Stanford University Medical Director HBV Foundation HBV Forum 3 October

More information

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

ORIGINAL ARTICLE. Jun Zheng 1, Rong-chun Xing 1, Wei-hong Zheng 2, Wei Liu 1, Ru-cheng Yao 1, Xiao-song Li 1, Jian-ping Du 1, Lin Li 1.

ORIGINAL ARTICLE. Jun Zheng 1, Rong-chun Xing 1, Wei-hong Zheng 2, Wei Liu 1, Ru-cheng Yao 1, Xiao-song Li 1, Jian-ping Du 1, Lin Li 1. JBUON 2017; 22(3): 709-713 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE A comparative study on postoperative mortality prediction of SFLI scoring

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against

More information

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1. A B C T cell count (1 6 ) 3. 2. 1.. * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index 2.5 2. 1.5 1. * Division Index 2. 1.5 1..5. D E %Ki67+ cells 1 8 6 4 2 % of Cells 8 ormoxia 6 ypoxia 4 2 *

More information

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

Modeling Kinetics of HBV Infection and Recommendations for Moving Forward

Modeling Kinetics of HBV Infection and Recommendations for Moving Forward Modeling Kinetics of HBV Infection and Recommendations for Moving Forward Alan S. Perelson Theoretical Biology and Biophysics Los Alamos National Laboratory Los Alamos, NM HBV Models Hepatology 1999 Tsiang

More information

Original Article Expression profile and clinical significance of mirnas at different stages of chronic hepatitis B virus infection

Original Article Expression profile and clinical significance of mirnas at different stages of chronic hepatitis B virus infection Int J Clin Exp Med 2015;8(4):5611-5620 www.ijcem.com /ISSN:1940-5901/IJCEM0006508 Original Article Expression profile and clinical significance of mirnas at different stages of chronic hepatitis B virus

More information

Original Article Application of AFP whole blood one-step rapid detection kit in screening for HCC in Qidong

Original Article Application of AFP whole blood one-step rapid detection kit in screening for HCC in Qidong Am J Cancer Res 2017;7(6):1384-1388 www.ajcr.us /ISSN:2156-6976/ajcr0048028 Original Article Application of AFP whole blood one-step rapid detection kit in screening for HCC in Qidong Jie Jin 1*, Xiao-yan

More information

A Preliminary Study on the Safety and Efficacy of HD-03/ES Therapy in Patients with Chronic Hepatitis B

A Preliminary Study on the Safety and Efficacy of HD-03/ES Therapy in Patients with Chronic Hepatitis B C linical S tudy Janardan Singh* Anupam Chakraborty* Mukul Chandra Dhar* Sudhakaran C** Mitra SK** A Preliminary Study on the Safety and Efficacy of HD-03/ES Therapy in Patients with Chronic Hepatitis

More information

More significance of TB- IGRA except for the diagnose of tuberculosis

More significance of TB- IGRA except for the diagnose of tuberculosis Received: 16 August 2016 Accepted: 20 January 2017 DOI: 10.1002/jcla.22183 RESEARCH ARTICLE More significance of TB- IGRA except for the diagnose of tuberculosis Jun-Chi Xu 1,2 Ze-Yi Li 1 Xin-Nian Chen

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Joint Department of Biomedical Engineering

Joint Department of Biomedical Engineering Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for

More information

Corresponding author: M.H. Lu

Corresponding author: M.H. Lu Changes in peripheral blood natural killer T cells in hepatitis B e antigen-positive chronic hepatitis B patients and efficacy prediction after pegylated interferon therapy F. Huang 1,2, M.H. Lu 1, H.Y.

More information

Dynamic analysis of lymphocyte subsets of peripheral blood in patients with acute self-limited hepatitis B

Dynamic analysis of lymphocyte subsets of peripheral blood in patients with acute self-limited hepatitis B Vol.2, No.7, 736-741 (2010) doi:10.4236/health.2010.27112 Health Dynamic analysis of lymphocyte subsets of peripheral blood in patients with acute self-limited hepatitis B Bo Liu, Jun Li*, Yaping Han,

More information

Pegasys Hepatitis B. Pegasys (peginterferon alfa-2a) Description

Pegasys Hepatitis B. Pegasys (peginterferon alfa-2a) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.03.02 Subject: Pegasys Hepatitis B Page: 1 of 5 Last Review Date: September 18, 2015 Pegasys Hepatitis

More information

STUDY IN BETWEEN SERUM HBsAg, HBV DNA & BLOOD IMMUNE CELLS IN VIRAL HEPATITIS-B INFECTION OF NORTH INDIANS

STUDY IN BETWEEN SERUM HBsAg, HBV DNA & BLOOD IMMUNE CELLS IN VIRAL HEPATITIS-B INFECTION OF NORTH INDIANS STUDY IN BETWEEN SERUM HBsAg, HBV DNA & BLOOD IMMUNE CELLS IN VIRAL HEPATITIS-B INFECTION OF NORTH INDIANS *Javed B. Mulla Department of Medical Biochemistry, F H Medical College &Hospital, Firozabad *Author

More information

Short title: BENEFIT STUDY, STUDY REPORT (ML25614) Synopsis/Abstract

Short title: BENEFIT STUDY, STUDY REPORT (ML25614) Synopsis/Abstract A Multicenter, prospective, Non-Interventional Study Evaluating Response Parameters during and after Therapy with PEGASYS (Peginterferon alfa-2a 40KD) in Subjects with HBeAg positive or HBeAg negative

More information

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing

More information

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,

More information

Department of Hematopoietic Stem Cell Transplantation, 307 Hospital of PLA, Academy of Military Medical Sciences, Beijing , China

Department of Hematopoietic Stem Cell Transplantation, 307 Hospital of PLA, Academy of Military Medical Sciences, Beijing , China Med J Chin PLA, Vol. 41, No. 10, October 1, 2016 827 [ ] (DC) (CIK) 27 (PBMC) DC CIK 7 9 11 13 DC 11 13 CIK 3 27 DC-CIK 37% 85% 2 81.5% CD3 + CD4 + CD8 CD3 + CD4 CD8 + CD3 + CD19 CD3 CD19 + CD3 CD16 +

More information

Who to Treat? Consider biopsy Treat. > 2 ULN Treat Treat Treat Treat CIRRHOTIC PATIENTS Compensated Treat HBV DNA detectable treat

Who to Treat? Consider biopsy Treat. > 2 ULN Treat Treat Treat Treat CIRRHOTIC PATIENTS Compensated Treat HBV DNA detectable treat Who to Treat? Parameter AASLD US Algorithm EASL APASL HBV DNA CRITERIA HBeAg+ >, IU/mL > 2, IU/mL > 2, IU/mL >, IU/mL HBeAg- > 2, IU/mL > 2, IU/mL > 2, IU/mL > 2, IU/mL ALT CRITERIA PNALT 1-2 ULN Monitor

More information

SYNOPSIS Final Clinical Study Report for Study AI444031

SYNOPSIS Final Clinical Study Report for Study AI444031 Name of Sponsor/Company: Bristol-Myers Squibb Name of Finished Product: Name of Active Ingredient: () Individual Study Table Referring to the Dossier (For National Authority Use Only) SYNOPSIS for Study

More information

Characteristics, Diagnosis and Prognosis of Acute-on-Chronic Liver. Failure in Cirrhosis Associated to Hepatitis B.

Characteristics, Diagnosis and Prognosis of Acute-on-Chronic Liver. Failure in Cirrhosis Associated to Hepatitis B. Supplementary Appendix Characteristics, Diagnosis and Prognosis of Acute-on-Chronic Liver Failure in Cirrhosis Associated to Hepatitis B. Hai Li, Liu-Ying Chen, Nan-nan Zhang, Shu-Ting Li, Bo Zeng, Marco

More information

Diabetes mellitus may affect the long-term survival of hepatitis B virus-related hepatocellular carcinoma patients after liver transplantation

Diabetes mellitus may affect the long-term survival of hepatitis B virus-related hepatocellular carcinoma patients after liver transplantation Submit a Manuscript: http://www.wjgnet.com/esps/ Help Desk: http://www.wjgnet.com/esps/helpdesk.aspx DOI: 10.3748/wjg.v22.i43.9571 World J Gastroenterol 2016 November 21; 22(43): 9571-9585 ISSN 1007-9327

More information

Liu et al., Afr J Tradit Complement Altern Med. (2013) 10(4):78-82

Liu et al., Afr J Tradit Complement Altern Med. (2013) 10(4):78-82 78 A COMPARATIVE STUDY OF ANTI-GASTRIC CANCER ACTIVITY BETWEEN AQUEOUS EXTRACT AND ETHANOL EXTRACT OF FOLIUM CORDYLINES FRUTICOSAE Shaojun Liu 1, Dongbo Cao 2, Zhiming Xiao 1, Fen Liu 1, Xiaoyan Wang 1,

More information

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT

More information

Viral hepatitis. The word hepatitis means inflammation of the liver. There are five main types of viral hepatitis: A, B, C, D, E

Viral hepatitis. The word hepatitis means inflammation of the liver. There are five main types of viral hepatitis: A, B, C, D, E Viral hepatitis The word hepatitis means inflammation of the liver There are five main types of viral hepatitis: A, B, C, D, E Hepatitis A and E are typically caused by ingestion of contaminated food or

More information

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Author's response to reviews Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Authors: Yan Zhang (zhangy2@sysucc.org.cn) Chun-Fang

More information

Lamivudine Therapy for Korean Children with Chronic Hepatitis B

Lamivudine Therapy for Korean Children with Chronic Hepatitis B Yonsei Med J 48(6):927-933, 2007 DOI 10.3349/ymj.2007.48.6.927 Original Article Lamivudine Therapy for Korean Children with Chronic Hepatitis B Hong Koh, Seoung Yon Baek, and Ki Sup Chung Department of

More information

Bisphenol A Exposure May Induce Hepatic Lipid Accumulation via. Reprogramming the DNA Methylation Patterns of Genes Involved in Lipid.

Bisphenol A Exposure May Induce Hepatic Lipid Accumulation via. Reprogramming the DNA Methylation Patterns of Genes Involved in Lipid. Title Page Bisphenol A Exposure May Induce Hepatic Lipid Accumulation via Reprogramming the DNA Methylation Patterns of Genes Involved in Lipid Metabolism Zhang-Hong Ke 1, *, Jie-Xue Pan 1,4, *, Lu-Yang

More information

Received 30 May 2004/Returned for modification 6 August 2004/Accepted 12 August 2004

Received 30 May 2004/Returned for modification 6 August 2004/Accepted 12 August 2004 JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 2004, p. 5036 5040 Vol. 42, No. 11 0095-1137/04/$08.00 0 DOI: 10.1128/JCM.42.11.5036 5040.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved.

More information

Supporting Information: Enhanced Therapeutic Effects of MSC-derived Exosomes with an Injectable Hydrogel for Hindlimb Ischemia Treatment

Supporting Information: Enhanced Therapeutic Effects of MSC-derived Exosomes with an Injectable Hydrogel for Hindlimb Ischemia Treatment Supporting Information: Enhanced Therapeutic Effects of MSC-derived Exosomes with an Injectable Hydrogel for Hindlimb Ischemia Treatment Kaiyue Zhang 1,2, Xiangnan Zhao 1, Xiaoniao Chen 3, Yongzhen Wei

More information

A Message to Presenters

A Message to Presenters A Message to Presenters As a healthcare professional speaking on behalf of Bristol-Myers Squibb (BMS), any presentation you make on our behalf must be consistent with the current FDA-approved product labeling

More information

Study No.: ADF Title: Phase III study of adefovir dipivoxil (ADV) tablets in patients with compensated chronic hepatitis B -comparative study

Study No.: ADF Title: Phase III study of adefovir dipivoxil (ADV) tablets in patients with compensated chronic hepatitis B -comparative study Study No.: ADF105220 Title: Phase III study of adefovir dipivoxil () tablets in patients with compensated chronic hepatitis B -comparative study against lamivudine ()- Rationale: This study wass a confirmatory

More information

Pathological Features and Prognosis in Chronic Hepatitis B Virus Carriers

Pathological Features and Prognosis in Chronic Hepatitis B Virus Carriers The Journal of International Medical Research 2011; 39: 71 77 Pathological Features and Prognosis in Chronic Hepatitis B Virus Carriers ZH LU, W CHEN, ZC JU, H PEI, XJ YANG, XB GU AND LH HUANG Department

More information

IL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B

IL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B IL10 rs1800896 polymorphism is associated with liver cirrhosis and chronic hepatitis B L.N. Cao 1, S.L. Cheng 2 and W. Liu 3 1 Kidney Disease Department of Internal Medicine, Xianyang Central Hospital,

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Min Weng, Wei-Zheng Zeng *, Xiao-Ling Wu, Yong Zhang, Ming-De Jiang, Zhao Wang, De-Jiang Zhou and Xuan He

Min Weng, Wei-Zheng Zeng *, Xiao-Ling Wu, Yong Zhang, Ming-De Jiang, Zhao Wang, De-Jiang Zhou and Xuan He Weng et al. Virology Journal 2013, 10:277 RESEARCH Open Access Quantification of serum hepatitis B surface antigen in predicting the response of pegylated interferon alfa-2a in HBeAg-positive chronic hepatitis

More information

Prediction of HBsAg Loss by Quantitative HBsAg Kinetics during Long-Term 2015

Prediction of HBsAg Loss by Quantitative HBsAg Kinetics during Long-Term 2015 THAI J 16 GASTROENTEROL Treatment with Nucleos(t)ide Original Analogues Article Prediction of HBsAg Loss by Quantitative HBsAg Kinetics during Long-Term Treatment with Nucleos(t)ide Analogues Sombutsook

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Antiviral therapy for hepatitis B virus-related hepatocellular carcinoma after radical hepatectomy

Antiviral therapy for hepatitis B virus-related hepatocellular carcinoma after radical hepatectomy Cancer Biol Med 2013;10:158-164. doi: 10.7497/j.issn.2095-3941.2013.03.006 ORIGINAL ARTICLE Antiviral therapy for hepatitis B virus-related hepatocellular carcinoma after radical hepatectomy Yang Ke*,

More information

ratio in patients treated by sorafenib alone decreased after treatment (P<0.05), while CD 8

ratio in patients treated by sorafenib alone decreased after treatment (P<0.05), while CD 8 Int J Clin Exp Med 2016;9(2):4625-4629 www.ijcem.com /ISSN:1940-5901/IJCEM0015836 Original Article Effect of sorafenib combined with CIK cell treatment on immunity and adverse events in patients with late-stage

More information

Diabetes Care Publish Ahead of Print, published online August 19, 2010

Diabetes Care Publish Ahead of Print, published online August 19, 2010 Diabetes Care Publish Ahead of Print, published online August 19, 2010 Neck circumference positively related with central obesity, overweight and metabolic syndrome in Chinese people with type 2 diabetes:

More information

Supplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells

Supplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells Chien 1 Supplementary information Manuscript: SREP-16-42480A Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by Repeated Stimulation of Antigen-Presenting B Cells Chien-Hui Chien 1, Hui-Chieh

More information

PROGRAMME AND CALL FOR PAPERS

PROGRAMME AND CALL FOR PAPERS 193 XXXIVth of the ISFR 193 FIRST ANNOUNCEMENT AND CALL FOR ABSTRACTS: XXXIVTH CONFERENCE OF THE INTERNATIONAL SOCIETY FOR FLUORIDE RESEARCH, GUIYANG, PEOPLE S REPUBLIC OF CHINA, OCTOBER 18 20, 2018 On

More information

Comparing Subtypes of Breast Cancer Using a Message-Passing Network

Comparing Subtypes of Breast Cancer Using a Message-Passing Network Dana-Farber Cancer Institute Comparing Subtypes of Breast Cancer Using a Message-assing Network Kamrine oels Outline Breast cancer and its molecular subtypes assing Attributes between Networks for Data

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Intron A Hepatitis B. Intron A (interferon alfa-2b) Description

Intron A Hepatitis B. Intron A (interferon alfa-2b) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.01.01 Subject: Intron A Hepatitis B Page: 1 of 7 Last Review Date: November 30, 2018 Intron A Hepatitis

More information