B6.SJL (Ly5.2) mice were obtained from Taconic Farms. Rag1-deficient mice were

Size: px
Start display at page:

Download "B6.SJL (Ly5.2) mice were obtained from Taconic Farms. Rag1-deficient mice were"

Transcription

1 Supplementary Methods Mice. B6.SJL (Ly5.2) mice were obtained from Taconic Farms. Rag1-deficient mice were purchased from The Jackson Laboratory. Real-time PCR Total cellular RNA was extracted from the indicated sorted cells supplemented with 10 μg glycogen using Trizol reagent (Invitrogen). RNA samples were treated with RNasefree DNase I (Invitrogen) before reverse-transcription to eliminate contaminating genomic DNA. Total RNA was reverse transcribed using Superscript II reversetranscriptase and oligo(dt) primer (Invitrogen). Real-time PCR was performed on a 7300 Real Time PCR system (Applied Biosystems). Analyses were performed using primers (Invitrogen), an internal fluorescent Taqman probe (Biosearch Technologies) specific to ThPOK and HPRT, and Universal PCR Master Mix (Applied Biosystems). The primer and Taqman probe sequences were as follows. ThPOK primers: 5 - AGAAGCCCTTTGCCTGTGA-3 and 5 -TGTGGATCTTCAGCTTGT CATTC-3 ; ThPOK probe: 5 -FAM-TCTGCGGCGTCCGCTTCAC-3 ; HPRT primers: 5 - TGAAGAGCTACTGTAATGATCAGTCAAC-3 and 5 -AGCAAGCTTGCAACC TTAACCA-3 ; HPRT probe: 5 -FAM-TGCTTTCCCTGGTTAAGCAGTACAGCC C- 3. Generation of mixed bone marrow chimeric mice Bone marrow cells from femur and tibia were incubated with anti-cd3-biotin, anti- 1

2 CD4-biotin, and anti-cd8-biotin antibodies (ebioscience) followed by anti-biotin MACS beads (Milteneyi). After T cell depletion, 3 x 10 6 bone marrow cells from each of the indicated donors were injected intravenously into sublethally irradiated Rag1 deficient hosts (600 rad). Mice were infected 8-12 weeks after reconstitution. 2

3 Supplementary Reference S1. Beere, H. M., and D. R. Green. Stress management- heat shock protein-70 and the regulation of apoptosis Trends Cell Biol 11: 6-10 S2. Panaretou, B., Siligardi, G., Meyer, P., Maloney, A., Sullivan, J. K., Singh, S., Millson, S. H., Clarke, P. A., Naaby-Hansen, S., Stein, R., Cramer, R., Mollapour, M., Workman, P., Piper, P. W., Pearl, L. H., Prodromou, C Activation of the ATPase activity of hsp90 by the stress-regulated cochaperone aha1. Mol Cell 10: S3. Ohtsu, M., Sakai, N., Fujita, H., Kashiwagi, M., Gasa, S., Shimizu, S., Eguchi, Y., Tsujimoto, Y., Sakiyama, Y., Kobayashi, K., Kuzumaki, N Inhibition of apoptosis by the actin-regulatory protein gelsolin. Embo J 16: S4. de Souza-Pinto, N. C., Maynard, S., Hashiguchi, K., Hu, J., Muftuoglu, M., Bohr, V The Recombination Protein Rad52 Cooperates with the Excision Repair Protein Ogg1 for the Repair of Oxidative Lesions in Mammalian Cells. Mol Cell Biol. S5. Potts, P. R., Porteus, M. H., Yu, H Human SMC5/6 complex promotes sister chromatid homologous recombination by recruiting the SMC1/3 cohesin complex to double-strand breaks. Embo J 25:

4 CD4+ day46 +LCMV day 20 day 8 CD44 low CD8+ N.D Normalized ThPOK Supplementary Figure 1. ThPOK mrna levels increase in polyclonal Ag-specific CD8 T cells after LCMV infection. B6 mice were infected with LCMV. D b /GP33 tetramer-positive CD8 T cells in infected mice at the indicated time-points, and CD44 low CD8 T cells or CD4 T cells in naïve mice were purified using FACS sorting. ThPOK mrna expression levels were assessed by real-time quantitative PCR (normalized to HPRT). The ThPOK mrna level in CD4 T cells was defined as 100. N.D., none detected.

5 ThPOK/GFP Supplementary Figure 2. Downregulation of ThPOK expression levels in activated CD4 + T cells. hpok expression levels in naïve CD4 T cells (black line) and activated CD44 hi CD4 T cells (blue ine) in ThPOK wt/gfp mice infected with LCMV 8 days post-infection were analyzed by flow cytometry. Numbers in the histograms are mean fluorescent intensity of gfp in naïve CD4 + T cells (black) and ctivated CD44 hi CD4 + T cells (blue). Results are representative of three independent experiments.

6 TCRβ+ CD8+CD4-T Vα2 CD4 92 CD8 CD8+CD4-CD44 low T CD8 CD44 CD8+CD4-CD44 hi T ThPOK/GFP Supplementary Figure 3. ThPOK expression in naïve T cells of ThPOK gfp/gfp mice. ThPOK expression levels in CD44 hi CD4 - and CD44 low CD4 - T cells of naïve ThPOK gfp/gfp mice were analyzed by flow cytometry. Numbers in the dot plots are the percentages. Results are representative of three independent experiments.

7 A CD28 CD27 KLRG1 CD127 CD62L CCR7 B CD28 CD27 KLRG1 CD127 CD62L CCR7 C CD28 CD27 KLRG1 CD127 CD62L CCR7 Supplementary Figure 4. Surface phenotypes of control and ThPOK-mutant naïve, effector, and memory T cells. A, The expression levels of representative surface molecules on naïve CD44 low ThPOK hd/hd and ThPOK wt/wt T cells in the spleen. B, The expression pattern of epresentative surface markers on effector ThPOK hd/hd and ThPOK wt/wt T cells in the spleen days after LCMV infection. C, The surface phenotype of memory ThPOK hd/hd and ThPOK wt/wt 14 T cells in the spleen. The expression levels were analyzed more than 90 days post-infection. esults are representative of two independent experiments.

8 A number per spleen (x 10-3 ) 10 1 p= ThPOK wt/wt ThPOK hd/hd B 100 p= p=0.004 % thy p= days post infection Supplementary Figure 5. The kinetics of expansion of ThPOK hd/hd and ThPOK wt/wt T cells fter primary infection. A, Four days after LCMV infection, the percentages of CD8 T cells were nalyzed in total spleen cells. The percentages of T cells (Thy1.1) among CD8 T cells in the pleen were determined after enrichment of CD8 T cells. The absolute numbers of T cells are hown. B, The percentages of ThPOK hd/hd (open circles) and ThPOK wt/wt (closed circles) T cells in blood are shown on 5, 6, and 7 days post-infection.

9 A 60 p=0.02 % reduction B6 vs B6 ThPOK wt/hd vs B6 B C number per spleen (x 10-6 ) ThPOK wt/wt p= ThPOK wt/hd number per spleen (x 10-6 ) ThPOK wt/wt p= ThPOK wt/gfp Supplementary Figure 6. Polyclonal ThPOK wt/hd Ag-specific CD8 T cells, ThPOK wt/hd T cells, nd ThPOK wt/gfp T cells show a mild impairment in accumulation. A, Sublethally irradiated Rag1 -deficient mice were reconstituted with a 1:1 mixture of T cell-depleted bone marrow cells from either Ly5.1 B6 and Ly5.2 B6 mice, or from Ly5.1 B6 and Ly5.2 ThPOK wt/hd mice. Ten to twelve weeks later, he distribution of CD8 T cells in peripheral blood of the chimeras was checked using congenic markers. he distribution among GP33-specific CD8 T cells in peripheral blood was analyzed 8 days after LCMV nfection. The percentages of reduction signify a relative reduction of Ly5.2 + BM-derived cells among P33-specific CD8 T cells 8 days after infection. B, The absolute numbers of transferred ThPOK wt/hd T cells and ThPOK wt/wt T cells in the spleen 8 days after LCMV infection. C, The absolute numbers of transferred ThPOK wt/gfp T cells and ThPOK wt/w t T cells in the spleen 8 days ost-infection.

10 gene name fold change known function reference Heat shock protein 1B DNA repair/anti apoptotic Heat shock protein 1A DNA repair/anti apoptotic Integrin alpha cell adhesion Integrin alpha cell adhesion AHA response to stimulus CD160 antigen receptor activity/negative signaling Alcam cell adhesion gelsolin barbed-end actin filament capping/anti apoptotic Rad DNA repair S4 Smc DNA repair S5 S1 S1 S2 ref. 21 S3 Supplementary Table 1. Gene expression in ThPOK hd/hd T cells versus ThPOK wt/wt T cells during the memory phase. Genes encoding products involved in survival or immune responses are listed among genes whose expression levels differ more than 1.5 fold between the two groups.

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice

More information

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

Eosinophils are required. for the maintenance of plasma cells in the bone marrow Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance

More information

Supplemental Figure 1. Protein L

Supplemental Figure 1. Protein L Supplemental Figure 1 Protein L m19delta T m1928z T Suppl. Fig 1. Expression of CAR: B6-derived T cells were transduced with m19delta (left) and m1928z (right) to generate CAR T cells and transduction

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray

More information

D CD8 T cell number (x10 6 )

D CD8 T cell number (x10 6 ) IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p

More information

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Peli1 negatively regulates T-cell activation and prevents autoimmunity Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

T Cell Differentiation

T Cell Differentiation T Cell Differentiation Ned Braunstein, MD MHC control of Immune Responsiveness: Concept Whether or not an individual makes an immune response to a particular antigen depends on what MHC alleles an individual

More information

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic

More information

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)

More information

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human

PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

SUPPLEMENT Supplementary Figure 1: (A) (B)

SUPPLEMENT Supplementary Figure 1: (A) (B) SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with

More information

Supplementary Materials for

Supplementary Materials for www.sciencemag.org/content/348/6241/aaa825/suppl/dc1 Supplementary Materials for A mucosal vaccine against Chlamydia trachomatis generates two waves of protective memory T cells Georg Stary,* Andrew Olive,

More information

Supporting Information

Supporting Information Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or

More information

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,

More information

Nature Immunology: doi: /ni.3412

Nature Immunology: doi: /ni.3412 Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1175194/dc1 Supporting Online Material for A Vital Role for Interleukin-21 in the Control of a Chronic Viral Infection John S. Yi, Ming Du, Allan J. Zajac* *To whom

More information

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1). Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

NK1.1 þ CD8 þ T cells escape TGF-b control and contribute to early microbial pathogen response

NK1.1 þ CD8 þ T cells escape TGF-b control and contribute to early microbial pathogen response Received 24 Apr 214 Accepted 5 Sep 214 Published 6 Oct 214 DOI: 1.138/ncomms615 NK1.1 þ CD8 þ T cells escape TGF-b control and contribute to early microbial pathogen response Anne L. Ruiz 1,2,3,4, Saidi

More information

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice. competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Surface thiol groups and reduction of activated T cells. (a) Activated CD8 + T-cells have high expression levels of free thiol groups on cell surface proteins.

More information

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplementary. presence of the. (c) mrna expression. Error. in naive or Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated

More information

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supporting Information

Supporting Information Supporting Information van der Windt et al. 10.1073/pnas.1221740110 SI Materials and Methods Mice and Reagents. C57BL/6 and major histocompatibility complex class I-restricted OVA-specific T-cell receptor

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets. Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

Pair-fed % inkt cells 0.5. EtOH 0.0

Pair-fed % inkt cells 0.5. EtOH 0.0 MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong

More information

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Supplemental Table I.

Supplemental Table I. Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,

More information

Supplementary Table 1. Oligonucleotide primers used in quantitative and qualitative PCRs of this study.

Supplementary Table 1. Oligonucleotide primers used in quantitative and qualitative PCRs of this study. Supplementary Table 1. Oligonucleotide primers used in quantitative and qualitative PCRs of this study. Primer Sequence Qualitative PCR primers Universal 16S rdna forward 5 - GACGCTGAGGCATGAGAGCA-3 Universal

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas

More information

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection

More information

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described

More information

CELLULAR AND MOLECULAR REQUIREMENTS FOR REJECTION OF B16 MELANOMA IN THE SETTING OF REGULATORY T CELL DEPLETION AND HOMEOSTATIC PROLIFERATION

CELLULAR AND MOLECULAR REQUIREMENTS FOR REJECTION OF B16 MELANOMA IN THE SETTING OF REGULATORY T CELL DEPLETION AND HOMEOSTATIC PROLIFERATION CELLULAR AND MOLECULAR REQUIREMENTS FOR REJECTION OF B16 MELANOMA IN THE SETTING OF REGULATORY T CELL DEPLETION AND HOMEOSTATIC PROLIFERATION Justin Kline 1, Long Zhang 1, and Thomas F. Gajewski 1,2 Departments

More information

Pearson r = P (one-tailed) = n = 9

Pearson r = P (one-tailed) = n = 9 8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable

More information

pplementary Figur Supplementary Figure 1. a.

pplementary Figur Supplementary Figure 1. a. pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective

More information

NK cell flow cytometric assay In vivo DC viability and migration assay

NK cell flow cytometric assay In vivo DC viability and migration assay NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with

More information

Supplementary Figure 1. Ex vivo IFNγ production by Tregs. Nature Medicine doi: /nm % CD127. Empty SSC 98.79% CD25 CD45RA.

Supplementary Figure 1. Ex vivo IFNγ production by Tregs. Nature Medicine doi: /nm % CD127. Empty SSC 98.79% CD25 CD45RA. SSC CD25 1.8% CD127 Empty 98.79% FSC CD45RA CD45RA Foxp3 %IFNγ + cells 4 3 2 1 + IL-12 P =.3 IFNγ p=.9 %IL-4+ cells 3 2 1 IL-4 P =.4 c %IL-1 + cells IFNγ 4 3 2 1 Control Foxp3 IL-1 P =.41.64 4.76 MS 2.96

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Nature Medicine: doi: /nm.2109

Nature Medicine: doi: /nm.2109 HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*

More information

CD40-Activated B Cells Can Efficiently Prime Antigen- Specific Naïve CD8 + T Cells to Generate Effector but Not Memory T cells

CD40-Activated B Cells Can Efficiently Prime Antigen- Specific Naïve CD8 + T Cells to Generate Effector but Not Memory T cells CD40-Activated B Cells Can Efficiently Prime Antigen- Specific Naïve CD8 + T Cells to Generate Effector but Not Memory T cells Mélissa Mathieu 1,2, Natacha Cotta-Grand 1,2, Jean-François Daudelin 1, Salix

More information

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)

More information

SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish

SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,

More information

Supplementary Information. Paired immunoglobulin-like receptor A is an intrinsic, self-limiting

Supplementary Information. Paired immunoglobulin-like receptor A is an intrinsic, self-limiting Supplementary Information Paired immunoglobulin-like receptor A is an intrinsic, self-limiting suppressor of IL-5-induced eosinophil development Netali Ben Baruch-Morgenstern 1,4, Dana Shik 1,4, Itay Moshkovits

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Supplemental Information. Checkpoint Blockade Immunotherapy. Induces Dynamic Changes. in PD-1 CD8 + Tumor-Infiltrating T Cells

Supplemental Information. Checkpoint Blockade Immunotherapy. Induces Dynamic Changes. in PD-1 CD8 + Tumor-Infiltrating T Cells Immunity, Volume 50 Supplemental Information Checkpoint Blockade Immunotherapy Induces Dynamic Changes in PD-1 CD8 + Tumor-Infiltrating T Cells Sema Kurtulus, Asaf Madi, Giulia Escobar, Max Klapholz, Jackson

More information

Low Avidity CMV + T Cells accumulate in Old Humans

Low Avidity CMV + T Cells accumulate in Old Humans Supplementary Figure Legends Supplementary Figure 1. CD45RA expressing CMVpp65-specific T cell populations accumulate within HLA-A*0201 and HLA-B*0701 individuals Pooled data showing the size of the NLV/HLA-A*0201-specific

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Text Results In vitro activation experiments established that treatment with anti-cd3 plus anti- CD28 was sufficient to promote EBI2 transcript on CD4 T cells (Extended Data Fig. 1d, e).

More information

Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated

Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated 1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells 1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from

More information

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation IMMUNOLOGICAL MEMORY CD4 T Follicular Helper Cells Memory CD8 T Cell Differentiation CD4 T Cell Differentiation Bcl-6 T-bet GATA-3 ROR t Foxp3 CD4 T follicular helper (Tfh) cells FUNCTION Provide essential

More information

B and T lymphocyte attenuator regulates CD8 + T cell intrinsic homeostasis and memory cell generation

B and T lymphocyte attenuator regulates CD8 + T cell intrinsic homeostasis and memory cell generation 27 Nature Publishing Group http://www.nature.com/natureimmunology B and T lymphocyte attenuator regulates CD8 + T cell intrinsic homeostasis and memory cell generation Carsten Krieg 1, Onur Boyman 1,2,

More information

Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs.

Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs. Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs. Predicted CD28H protein sequences from human, chimpanzee (pan

More information

Supporting Information

Supporting Information Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were

More information

Different Competitive Capacities T Cells during Lymphophenia-Driven Proliferation

Different Competitive Capacities T Cells during Lymphophenia-Driven Proliferation This information is current as of December 30, 2018. Different Competitive Capacities and Stat6-Deficient CD4 + of Stat4- T Cells during Lymphophenia-Driven Proliferation Vanesa Sanchez-Guajardo, José

More information

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

HD1 (FLU) HD2 (EBV) HD2 (FLU)

HD1 (FLU) HD2 (EBV) HD2 (FLU) ramer staining + anti-pe beads ramer staining a HD1 (FLU) HD2 (EBV) HD2 (FLU).73.11.56.46.24 1.12 b CD127 + c CD127 + d CD127 - e CD127 - PD1 - PD1 + PD1 + PD1-1 1 1 1 %CD127 + PD1-8 6 4 2 + anti-pe %CD127

More information

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information