Supplementary Materials for
|
|
- Norah Wright
- 5 years ago
- Views:
Transcription
1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime Chazal, Laura Sinigaglia, Lise Chauveau, Olivier Schwartz, Philippe Desprès, Nolwenn Jouvenet* The PDF file includes: *Corresponding author. jouvenet@pasteur.fr Published 3 March 2015, Sci. Signal. 8, ra25 (2015) DOI: /scisignal.aaa1552 Fig. S1. Analysis of the depletion or isolation of pdcs from human PBMCs. Fig. S2. TLR7 agonist induced type I IFN production by pdcs is efficiently blocked by the specific TLR7 inhibitor IRS661. Fig. S3. YF-17D replicates in Gen2.2 cells and stimulates the RIG-I signaling pathway. Fig. S4. YF-17D induces nuclear translocation of IRF3 but not IRF7 in Gen2.2 cells. Fig. S5. SeV stimulates RIG-I signaling in Gen2.2 cells. Fig. S6. YF-17D infected Huh7 cells stimulate IFNA expression in Gen2.2 cells. Fig. S7. Sensing of YF-17D infected cells stimulates nuclear translocation of IRF7 but not IRF3 in Gen2.2 cells. Fig. S8. Infection with YF-17D stimulates nuclear translocation of IRF3 in Vero cells. Fig. S9. Schematic representation of the proposed YF-17D mediated signaling pathways in human pdcs. Table S1. Primers used for semiquantitative and real-time PCR analysis. Table S2. Reagents. Table S3. Antibodies. Table S4. Viruses. Table S5. Primary cells and cell lines. Table S6. shrna sequences for knockdown experiments.
2 Intact PBMCs pdc-depleted PBMCs isolated pdcs Fig. S1. Analysis of the depletion or isolation of pdcs from human PBMCs. pdcs were depleted from intact PBMCs with CD304 (BDCA-4/Neuropilin-1) beads. The negative fraction was designated as containing pdc-depleted PBMCs. Alternatively, pdcs were isolated by the depletion of non-pdcs with pdc isolation kits. pdcs were defined as cells stained with antibodies specific for CD303 and CD123. The purity of isolated preparations of pdcs was always >94% as assessed by flow cytometric staining.
3 Fig. S2. TLR7 agonist induced type I IFN production by pdcs is efficiently blocked by the specific TLR7 inhibitor IRS661. (A and B) Freshly isolated pdcs were left untreated (Mock) or were treated with the TLR7 agonist CL264 in the presence or absence of the TLR7 inhibitor IRS661. (A) The relative abundances of IFNA and IFNB mrnas were determined by qpcr analysis. (B) Culture medium of the indicated cells was analyzed by ELISA to determine the amounts of secreted IFN-α. Data are means ± SD of at least three independent experiments.
4
5 Fig. S3. YF-17D replicates in Gen2.2 cells and stimulates the RIG-I signaling pathway. (A and B) Gen 2.2 cells or Vero cells were left uninfected (Mock) or were infected for 24 hours with live or UV-inactivated YF-17D (both at an MOI of 1). (A) Cells were analyzed by flow cytometry with an antibody specific for dsrna. Flow cytometry plots are representative of three independent experiments. (B) Quantitative analysis of the percentages of the indicated Vero cells that were positive for dsrna as determined by flow cytometric analysis. Data are means ± SD of three independent experiments. (C) Gen2.2 cells, human pdcs, and Huh7 cells were analyzed by RT-PCR to detect mrnas encoding RIG-I, Mda-5, TLR7, and GAPDH. (D to G) Gen2.2-sh-Scrambled and Gen2.2-sh-RIG-I cells were left uninfected or were infected with YF-17D at an MOI of 50 for 24 hours. Densitometric analysis of Western blots from two independent experiments shows the relative abundances of (D) ptbk1 to total TBK1, (E) pirf3 to total IRF3, (F) pstat1 to total STAT1, and (G) RIG-I to β-actin. Data are expressed as a percentage of the values of Gen2.2-sh-Scrambled cells, and are means ± SD.
6 Fig. S4. YF-17D induces the nuclear translocation of IRF3 but not IRF7 in Gen2.2 cells. (A to C) Gen2.2 cells were left uninfected (Mock) or were infected with YF-17D for 24 hours. The cells were then stained with antibodies specific for dsrna (green), DAPI (blue) and either (A) anti-irf3 antibody (red) or (B) anti-irf7 antibody (red) and analyzed by confocal microscopy. (C) The percentages of infected cells displaying nuclear or cytosolic localization of IRF3 or IRF7 are shown. At least 100 cells were counted for each sample. Data are representative of three independent experiments. Scale bar: 2 µm.
7 Fig. S5. SeV stimulates RIG-I signaling in Gen2.2 cells. (A to E) Gen2.2-sh-Scrambled and Gen2.2-sh-RIG-I cells were left uninfected (Mock), infected with SeV (50 HAU/ml), or treated with CL264 (10 μg/ml) for 8 hours. Whole-cell lysates were then analyzed by Western blotting as displayed in Fig. 3. Densitometric analysis of Western blots from two independent experiments shows the relative abundances of (A) RIG-I to β-actin, (B) ptbk1 to total TBK1, (C) pirf3 to total IRF3, (D) total STAT1 to β-actin, and (E) pstat1 to total STAT1. Data are means ± SD and are expressed as a percentage of the values of Gen2.2-sh-Scrambled cells.
8 Fig. S6. YF-17D infected Huh7 cells stimulate IFNA expression in Gen2.2 cells. (A and B) Huh7 cells or Gen2.2 cells were infected for 24 hours with YF-17D at an MOI of 1. The relative abundances of (A) viral RNA and (B) IFNA mrna were determined by qpcr analysis. (C and D) Huh7 cells were infected for 16 hours with YF-17D at an MOI of 1 and then were co-cultured with Gen2.2 cells for a further 24 hours. The co-cultures either were or were not separated by transwell chambers. Suspension cells (predominantly Gen2.2 cells) were collected with the cell culture medium after gentle shaking, whereas adherent cells (predominantly Huh7 cells) were collected separately. The indicated groups of cells were then subjected to qpcr analysis to determine the relative amounts of (C) viral RNA and (D) IFN-A mrna. Data in all bar graphs are means ± SD of at least three independent experiments. *P < 0.05; **P < 0.01 by two-tailed Student's t-test.
9 Fig. S7. The sensing of YF-17D infected cells stimulates nuclear translocation of IRF7 but not IRF3 in Gen2.2 cells. (A to C) CFSE-labeled Vero cells (green) were left uninfected (Mock) or were infected for 16 hours with YF-17D and then were co-cultured with Gen2.2 cells for 24 hours. The cells were stained with DAPI (blue) to visualize nuclei, together with (A) anti-irf3 antibody (red) or (B) anti-irf7 antibody (red). (C) The percentages of infected cells displaying nuclear or cytosolic localization of IRF3 or IRF7 are shown. At least 100 cells were counted for each sample. Data are representative of three independent experiments. Scale bar: 2 μm. (C).
10 Fig. S8. Infection with YF-17D stimulates nuclear translocation of IRF3 in Vero cells. (A to C) CFSE-labeled Vero cells (green) were left uninfected (green) or were infected with YF- 17D for 40 hours. Cells were stained with DAPI (blue) to visualize nuclei, together with (A and B) anti-irf3 antibody (red) or (C) anti-irf7 antibody (red). (B) The percentages of infected cells displaying nuclear or cytosolic localization of IRF3 are shown. At least 100 cells were counted for each sample. Data are representative of three independent experiments. Scale bar: 5 μm.
11 Fig. S9. Schematic representation of the proposed YF-17D mediated signaling pathways in human pdcs. The live attenuated vaccine YF-17D replicates in human pdcs and pdc-like cells and stimulates RIG-I mediated responses. Replication of YF-17D leads to the phosphorylation of TBK1 and IRF3, which suggests that the RIG-I IRF3 axis is activated in pdcs. Note that the virus-mediated activation of IRF3 appears to be restricted to the RIG-I pathway, because the TLR7 agonist did not stimulate IRF3 phosphorylation. Stimulation of pdcs and Gen2.2 cells by YF-17D infected cells is TLR7-dependent. The production of viral particles by infected cells is required for the induction of a type I IFN response, because the expression of YF-17D RNA in infected cells was not sufficient. The mechanism through which the cell-to-cell transfer of virions occurs is not well-characterized. We suggest that newly-assembled viruses are transferred from donor cells to pdcs through physical connections. The virions might eventually fuse with TLR7-containing lysosomal compartments, in which their degradation would render the viral RNA accessible to TLR7. In contrast, the RNA of penetrating cell-free YF-17D virions would be protected by its capsid during its transit through endosomal compartments and would therefore not be accessible to TLR7.
12 Table S1. Primers used for semiquantitative and real-time PCR analysis. GAPDH Forward Reverse ggtcggagtcaacggatttg actccacgacgtactcagcg a Forward gcaagcccagaagtatctgc Reverse actggttgccatcaaactcc IFNB RIG-I MDA5 TLR7 YF-NS3 Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse tgcattacctgaaggccaag aagcaattgtccagtccca agagcacttgtggacgcttt tgcaatgtcaatgccttcat acacgttctttgcgatttcc accaaatacaggagccatgc ccttgaggccaacaacatct gtagggacggctgtgacatt aggtccagttgatcgcggc gagcgacagccccgatttct a Of note, the primers for IFNA detect subtypes 1 and 13.
13 Table S2. Reagents. Reagent a Source Final concentration used (references) MRT67307 (TBK1/IKKε kinase Sigma-Aldrich 1 μm (33 35) inhibitor) IRAK1/4 kinase inhibitor Sigma-Aldrich 1 μm (35) IRS661 (TLR7-specific ODN antagonists) IRS1040 (non-specific ODN) Dynavax Technologies Dynavax Technologies 5.6 μm (36) 5.6 μm (36) CL264 (TLR7 agonist) InvivoGen 10 µg/ml CFSE (5(6)-Carboxyfluorescein-Nhydroxysuccinimidyl ester) Abcam 1 μm a None of the reagents caused any evident toxicity or cell death, nor did they cause any variation in the GAPDH Ct values (compared to the GAPDH Ct values of untreated samples) as determined by qpcr analysis.
14 Table S3. Antibodies. WB: Western blotting; IF: immunofluorescence; F: flow cytometry. Antibody target Source Application IRF3 (ps386) clone EPR2346 Abcam WB NAK/TBK1 (ps172) antibody [EPR2867(2)] Abcam WB TLR7 Abcam WB RIG-I (clone Alme-1) Adipogen WB IRF3 (FL-425) Santa Cruz WB, IF IRF7 Abcam IF TBK1 (M-375) Santa Cruz WB STAT1 (py701, 58D6) Cell Signalling WB STAT1 (42H3) Cell Signalling WB β-actin (AC-15) Sigma-Aldrich WB NS1 Gift from M. IF dsrna J2 Flamand a English & Scientific Consulting Kft IF, F Capsid Agro-Bio WB (56) 4G2 (Env) (57) IF, F Alexa Fluor 488 Goat Anti-Mouse IgG (H+L) Life Technologies IF, F Alexa Fluor 647 Goat Anti-Mouse IgG (H+L) Life Technologies IF, F Cy3 Goat Anti-Mouse IgG (H+L) Life Technologies IF, F DyLight 800 conjugated IgG (H+L) Fisher Scientific WB CD303 (BDCA-2)-APC Miltenyi F Mouse IgG1-APC Miltenyi F
15 CD123-FITC Miltenyi F Mouse IgG2A-FITC Miltenyi F a Institut Pasteur, Paris, France.
16 Table S4.Viruses. Virus Source (citation) Concentrati on YF-17D-204 (STAMARIL vaccine) Sanofi Pasteur (57) MOI of 1 a SeV defective interfering RNA Dominique Garcin (44) 50 HAU/ml. a Unless otherwise stated.
17 Table S5. Primary cells and cell lines. Cells Media/Information Species (source) Vero DMEM + 10% FCS +1% PS Monkey (ATCC) Huh7 DMEM + 10% FCS +1% PS Human (46) Gen2.2 PBMC/pDC RPMI % FCS +1% PS + 1% nonessential amino acids + 1% sodium pyruvate RPMI % FCS +1% PS + 1% nonessential amino acids + 1% sodium pyruvate Human (39) Human (healthy donors) YFRP DMEM + 10% FCS +1% PS Monkey HCVRP DMEM + 10% FCS +1% PS Human (46) a Dulbecco's modified eagle's medium (DMEM) containing GlutaMAX I and sodium pyruvate (Invitrogen), heat-inactivated fetal calf serum (FCS, Sigma-Aldrich), penicillin (100 IU/ml) and streptomycin (100 μg/ml) (1% PS, InvivoGen). b RPMI was obtained from Life Technologies; non-essential amino acids and sodium pyruvate were obtained from InvivoGen.
18 Table S6. shrna sequences for knockdown experiments. Name TLR7 (NM_016562; Clone ID: TRCN ) shrna Control shrna RIG-I shrna Source OpenBiosystem OpenBiosystem Rick Randall a a University of St. Andrews, Scotland, UK.
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More informationNature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationControl GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
More informationSerafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
More informationSupplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationTrim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
More informationSupplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).
Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationMANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function
MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen
More informationVasoactive intestinal peptide inhibits IFN-α secretion and modulates the immune function of plasmacytoid dendritic cells
Excerpt from MACS&more Vol 12 1/21 Vasoactive intestinal peptide inhibits IFN-α secretion and modulates the immune function of plasmacytoid dendritic cells Dorit Fabricius 1, 2,, M. Sue O Dorisio 1, 2,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationDynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in
Dynamic Interaction of Stress Granule, and Mediates Multiple Functions in Hepatitis C Virus Infection Véronique Pène, Qisheng Li#, Catherine Sodroski, Ching-Sheng Hsu, T. Jake Liang# Liver Diseases Branch,
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationNature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
More informationComparative analysis of IRF and IFN-alpha expression in human plasmacytoid and monocyte-derived dendritic cells
Comparative analysis of IRF and IFN-alpha expression in human plasmacytoid and monocyte-derived dendritic cells Alexander Izaguirre,*,,1 Betsy J. Barnes,,1 Sheela Amrute,* Wen-Shuz Yeow, Nicholas Megjugorac,*,
More informationPKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationSupplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationSupplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationGFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
More informationSupplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationSupplementary Information
Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara
More informationSupplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationCD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer
CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu
More informationFang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More informationIntrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationName Animal source Vendor Cat # Dilutions
Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSupplemental Figure 1. IL-3 blockade with Fab CSL362 depletes plasmacytoid dendritic cells (pdcs), but not basophils, at higher doses.
Supplemental Figure 1. IL-3 blockade with Fab CSL362 depletes plasmacytoid dendritic cells (pdcs), but not basophils, at higher doses. Percentage of viable (A) pdcs (Sytox Blue-, Lin1-, HLADR+, BDCA2++)
More informationSUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In this manuscript, Song et al. identified FBXW7 as a new positive regulator for RIG-Itriggered type I IFN signaling pathway. The authors observed
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationSUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis
SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,
More informationInnate Immunity & Inflammation
Innate Immunity & Inflammation The innate immune system is an evolutionally conserved mechanism that provides an early and effective response against invading microbial pathogens. It relies on a limited
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationFigure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor
Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)
More informationAntibodies for human plasmacytoïd dendritic cells studies Dendritics SAS, 60 avenue Rockefeller, F Lyon
Antibodies for human plasmacytoïd dendritic cells studies Dendritics SAS, 60 avenue Rockefeller, F-69008 Lyon www.dendritics.net Human plasmacytoïd dendritic cells (PDCs) are considered the main sentinels
More informationTitle: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1
1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting
More informationBoucher et al NCOMMS B
1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationEx vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2*
Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2* 1 Department of Laboratory Medicine - Laboratory of Hematology, Radboud University
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationCommercially available HLA Class II tetramers (Beckman Coulter) conjugated to
Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,
More informationTumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplemental Information. Inhibition of the Proteasome b2 Site Sensitizes. Triple-Negative Breast Cancer Cells
Cell Chemical Biology, Volume 24 Supplemental Information Inhibition of the Proteasome b2 Site Sensitizes Triple-Negative Breast Cancer Cells to b5 Inhibitors and Suppresses Nrf1 Activation Emily S. Weyburne,
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
More informationEphrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationFIG S1 Examination of eif4b expression after virus infection. (A) A549 cells
Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed
More informationInnate Sensing of HIV-Infected Cells
Innate Sensing of HIV-Infected Cells Alice Lepelley 1", Stéphanie Louis 1", Marion Sourisseau 1", Helen K. W. Law 2, Julien Pothlichet 3, Clémentine Schilte 4, Laurence Chaperot 5, Joël Plumas 5, Richard
More informationSD-1 SD-1: Cathepsin B levels in TNF treated hch
SD-1 SD-1: Cathepsin B levels in TNF treated hch. A. RNA and B. protein extracts from TNF treated and untreated human chondrocytes (hch) were analyzed via qpcr (left) and immunoblot analyses (right) for
More informationFigure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,
More informationF-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
More informationYork criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationWest Nile Virus-Induced Interferon Production Is Mediated by the Double-Stranded RNA-Dependent Protein Kinase PKR
JOURNAL OF VIROLOGY, Oct. 2007, p. 11148 11158 Vol. 81, No. 20 0022-538X/07/$08.00 0 doi:10.1128/jvi.00446-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. West Nile Virus-Induced
More information33VASTVNGATSANNHGEPPS51PADARPR58
Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationVpu Reduces Innate Sensing of HIV-1-infected cells by PDCs via a BST2-dependent process
Vpu Reduces Innate Sensing of HIV-1-infected cells by PDCs via a -dependent process Mariana G. Bego, Édouard Bérubé-Côté, Johanne Mercier, and Éric A. Cohen Institut de Recherches Cliniques de Montréal.
More informationStochastic Expression of the Interferon-b Gene
Mingwei Zhao 1, Jiangwen Zhang 2., Hemali Phatnani 3., Stefanie Scheu 4, Tom Maniatis 1,3 * 1 Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, United States of
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
More informationMII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
More informationa surface permeabilized
a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
More information