membrane form secreted form 13 aa 26 aa K K V V K K 3aa

Size: px
Start display at page:

Download "membrane form secreted form 13 aa 26 aa K K V V K K 3aa"

Transcription

1 Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai secreted form membrane form 13 aa 26 aa K K V V K K 3aa

2 Hapten monosaccharide Polyvalent antigen polysaccharide antigen receptor NO SIGNAL SIGNAL TRANSDUCTION

3 Y Y Igβ Igα Src-family kinase Y Y ITAM

4 ITAM YxxL/IxxxxxxYxxL/I Immune-receptor Tyrosine based Activation Motif

5 Y Y Y Y Igβ Igα Activated Syk Y Y Y Y ITAM Inactive Syk

6 The T cell receptor α β γ ε ε δ ζζ ITAM

7 CO-RECEPTORS CELL SURFACE PROTEINS THAT BIND TO THE SAME ANTIGEN AS THE ANTIGEN RECEPTOR DISTINGUISHABLE FROM COSTIMULATORS

8 CD4 TCR α β γ ε ε δ ζζ Lck Fyn Zap-70

9 CO-RECEPTORS CD4 ON HELPER T CELLS CD8 ON CYTOTOXIC T CELLS CD21/CR2 ON B CELLS

10 CD21/CR2 is a co-receptor and a positive regulator of BCR signaling CR2/CD21 YYYY Immune complex BCR CD19 CD81 β α Lyn Fyn Syk Vav PI3K

11 Generation of Diversity 1. V(D)J Recombination Combinatorial Diversity Junctional Diversity N Regions P nucleotides 2. Somatic Mutation

12 V D J - C V D J DNA junctional diversity, bases added and removed mrna

13 Rearrangement is temporally ordered B LINEAGE T LINEAGE IgH D to J Then Vto DJ Then Ig Kappa V to J TCR D beta to J beta Then V beta to DJ Then TCR V alpha to J alpha

14 L VDJ µ Poly A sites Cµ1 Cµ2 Cµ3 Cµ4 µm1 µm2 AAAA Choice of first polyadenylation site AAAA Choice of second polyadenylation site AAAA µs mrna AAAA µm mrna

15 V(D)J Recombination Lymphoid specific Locus-specific, cell-type specific, stage specific Accessibility model

16 Heptamer 12-bp spacer 23-bp spacer Heptamer Coding segment Nonamer Nonamer Coding segment RAG-2 RAG-1 NICK PRECEDES CUT OH P CLEAVE AND MAKE HAIRPINS

17 SIGNAL JOINT TRIM ADD N REGIONS JOIN RAG-1/RAG-2 still required TdT DNA-PK/Ku70/Ku80 XRCC4/DNA ligase CODING JOINT + N-region

18 RAG time RAG-1 dimers associate with RAG-2 dimers RAG-1 dimers bind to nonamers, cleave DNA RAG-2 has a beta-propeller like structure - probably brings in other proteins such as accessibility factors Rag genes evolved from a transposable element?

19 coding segment RSS RSS coding segment Looping out and Deletion Inversion

20 The 12/23 Rule Heptamer 12 bp spacer 23 bp spacer Heptamer Coding segment Nonamer Nonamer Coding segment

21 Cleave at heptamer junction ATTCTTTGAGATAGCTCGA TAAGAAACTCTATCGAGCT heptamer ATTCTTTGAGATAGCTCGA TAAGAAACTCTATCGAGCT Open up hairpin ATTCTTTGAGATAGCTCGATCG TAAGAAACTCTATCGAGCTAGC Add P nucleotides

22 HAIRPINS Resolved by Artemis, an enzyme which works in conjunction with DNA-PKcs

23 Severe Combined Immunodeficiency Rag-1 and Rag-2 deficiencies: SCID No VDJ recombination Artemis deficiency: SCID Defective coding joints Many other causes of SCID

24 V(D)J recombination and human lymphomas Many human lymphomas involve chromosomal translocations In some lymphomas (e.g. follicular lymphomas, lymphomas associated with Ataxia Telangiectasia, etc) the machinery involved in V(D)J recombination drives the translocation process

25 Regulation of V(D)J recombination 1. Allelic exclusion - role of pre-antigen receptors 2. Receptor editing

26 pre-bcr MEDIATED POSITIVE SELECTION (defective in X-linked agammaglobulinemia) V H to DJ H rearrangement Ψ Large pre-b C' pre-bcr Ψ Large pre-b C' pre-bcr Early pro-b Intermediate pro-b Late pro-b Ψ Large pre-b pre-bcr Small pre-b Y Immature B YY A B C C' D E F IgM IgD Mature B D H to J H rearrangement BONE MARROW Ψ Large pre-b C' pre-bcr V L to J L rearrangement Ψ Large pre-b C' pre-bcr

27 Pre-B receptor µ vpreb λ5 Igβ Igα S y k ITAM Blk/Lyn/Fyn

28 Pre-TCR No known ligand β ptα γ ε ε δ ζζ ITAM

29 Pre-antigen receptors Select cells that have made in-frame rearrangements Signals for survival, proliferation and allelic exclusion (rearrangement at second allele is shut off)

30 Central lymphoid organs Periphery antigen receptor "The death/ editing window" Proliferation and activation Rearrangement of Ig heavy chain or TCR β chain genes Selection by pre-antigen receptor of cells with in- frame Ig heavy chain or TCR β chain rearrangements Elimination or editing of self reactive cells F i n a l repertoire in responders

31 For more information and examples, see Immunobiology, by Janeway,C., Travers, P., Walport, M. and Capra, J., Garland Publishing, 5th edition, 2001 & Cellular and Molecular Immunology by Abbas, A., Pober, J., and Lichtman, A., W B Saunders; 4th edition.

Stage I Stage II Stage III Stage IV

Stage I Stage II Stage III Stage IV Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Stage I Stage II Stage III Stage IV Receptor gene Rearrangement Elimination

More information

Introduction. Introduction. Lymphocyte development (maturation)

Introduction. Introduction. Lymphocyte development (maturation) Introduction Abbas Chapter 8: Lymphocyte Development and the Rearrangement and Expression of Antigen Receptor Genes Christina Ciaccio, MD Children s Mercy Hospital January 5, 2009 Lymphocyte development

More information

T cell Receptor. Chapter 9. Comparison of TCR αβ T cells

T cell Receptor. Chapter 9. Comparison of TCR αβ T cells Chapter 9 The αβ TCR is similar in size and structure to an antibody Fab fragment T cell Receptor Kuby Figure 9-3 The αβ T cell receptor - Two chains - α and β - Two domains per chain - constant (C) domain

More information

Development of B and T lymphocytes

Development of B and T lymphocytes Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell

More information

B Lymphocyte Development and Activation

B Lymphocyte Development and Activation Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai 09/26/05; 9 AM Shiv Pillai B Lymphocyte Development and Activation Recommended

More information

The Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D.

The Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D. The Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D. OBJECTIVES 1. To understand how ordered Ig gene rearrangements lead to the development

More information

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow. Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature

More information

Andrea s SI Session PCB Practice Test Test 3

Andrea s SI Session PCB Practice Test Test 3 Practice Test Test 3 READ BEFORE STARTING PRACTICE TEST: Remember to please use this practice test as a tool to measure your knowledge, and DO NOT use it as your only tool to study for the test, since

More information

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow. Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature

More information

Ig light chain rearrangement: Rescue pathway

Ig light chain rearrangement: Rescue pathway B Cell Development Ig light chain rearrangement: Rescue pathway There is only a 1:3 chance of the join between the V and J region being in frame Vk Jk Ck Non-productive Rearrangement Light chain has a

More information

PATHOGEN INNOCUOUS ANTIGEN. No Danger- very low expression of costimulatory ligands Signal One Only

PATHOGEN INNOCUOUS ANTIGEN. No Danger- very low expression of costimulatory ligands Signal One Only Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv illai AICD Naive Activated Effector Memory Activated Effector Naive AICD Activated

More information

SPECIFIC IMMUNITY = ACQUIRED IMMUNITY = ADAPTIVE IMMUNITY SPECIFIC IMMUNITY - BASIC CHARACTERISTIC

SPECIFIC IMMUNITY = ACQUIRED IMMUNITY = ADAPTIVE IMMUNITY SPECIFIC IMMUNITY - BASIC CHARACTERISTIC SPECIFIC IMMUNITY - BASIC CHARACTERISTIC SPECIFIC IMMUNITY = ACQUIRED IMMUNITY = ADAPTIVE IMMUNITY BASIC TERMINOLOGY SPECIFIC IMMUNITY humoral mediated with antibodies cellular mediated with T lymphocytes

More information

B cell development in the bone marrow.

B cell development in the bone marrow. development in the bone. s develop from multipotent haematopoietic stem s in the bone that produce lymphoid progenitors which in turn generate s. s with a unique antibody specificity develop by initial

More information

Andrea s Final Exam Review PCB 3233 Spring Practice Final Exam

Andrea s Final Exam Review PCB 3233 Spring Practice Final Exam NOTE: Practice Final Exam Although I am posting the answer key for this practice exam, I want you to use this practice to gauge your knowledge, and try to figure out the right answer by yourself before

More information

Antibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity

Antibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity Antibodies and T Cell Receptor Genetics 2008 Peter Burrows 4-6529 peterb@uab.edu Generation of Antigen Receptor Diversity Survival requires B and T cell receptor diversity to respond to the diversity of

More information

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development. Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy

More information

Molecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU

Molecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU Molecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU Lecture outline Time 10:00 11:00 11:15 12:10 12:20 13:15 Content Introduction to lymphoma Review of lymphocyte biology

More information

The Adaptive Immune Response. B-cells

The Adaptive Immune Response. B-cells The Adaptive Immune Response B-cells The innate immune system provides immediate protection. The adaptive response takes time to develop and is antigen specific. Activation of B and T lymphocytes Naive

More information

Chapter 19: IgE-Dependent Immune Responses and Allergic Disease

Chapter 19: IgE-Dependent Immune Responses and Allergic Disease Allergy and Immunology Review Corner: Chapter 19 of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 19: IgE-Dependent Immune Responses

More information

Introduction. Abbas Chapter 10: B Cell Activation and Antibody Production. General Features. General Features. General Features

Introduction. Abbas Chapter 10: B Cell Activation and Antibody Production. General Features. General Features. General Features Introduction Abbas Chapter 10: B Cell Activation and Antibody Production January 25, 2010 Children s Mercy Hospitals and Clinics Humoral immunity is mediated by secreted antibodies (Ab) Ab function to

More information

Development Team. Head, Department of Zoology, University of Delhi. Department of Zoology, University of Delhi

Development Team. Head, Department of Zoology, University of Delhi. Department of Zoology, University of Delhi Paper No.: 10: Module : 03: cells, BCR, TCR, Co-receptors, properties of antigen recognized by Development Team Principal Investigator: Co-Principal Investigator: Paper Coordinator: Content Writer: Content

More information

remember that T-cell signal determine what antibody to be produce class switching somatical hypermutation all takes place after interaction with

remember that T-cell signal determine what antibody to be produce class switching somatical hypermutation all takes place after interaction with بسم هللا الرحمن الرحيم The last lecture we discussed the antigen processing and presentation and antigen recognition then the activation by T lymphocyte and today we will continue with B cell recognition

More information

T cell development October 28, Dan Stetson

T cell development October 28, Dan Stetson T cell development October 28, 2016 Dan Stetson stetson@uw.edu 441 Lecture #13 Slide 1 of 29 Three lectures on T cells (Chapters 8, 9) Part 1 (Today): T cell development in the thymus Chapter 8, pages

More information

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response

Two categories of immune response. immune response. infection. (adaptive) Later immune response. immune response Ivana FELLNEROVÁ E-mail: fellneri@hotmail.com, mob. 732154801 Basic immunogenetic terminology innate and adaptive immunity specificity and polymorphism immunoglobuline gene superfamily immunogenetics MHC

More information

The Adaptive Immune Response. T-cells

The Adaptive Immune Response. T-cells The Adaptive Immune Response T-cells T Lymphocytes T lymphocytes develop from precursors in the thymus. Mature T cells are found in the blood, where they constitute 60% to 70% of lymphocytes, and in T-cell

More information

all of the above the ability to impart long term memory adaptive immunity all of the above bone marrow none of the above

all of the above the ability to impart long term memory adaptive immunity all of the above bone marrow none of the above 1. (3 points) Immediately after a pathogen enters the body, it faces the cells and soluble proteins of the innate immune system. Which of the following are characteristics of innate immunity? a. inflammation

More information

Innate immunity (rapid response) Dendritic cell. Macrophage. Natural killer cell. Complement protein. Neutrophil

Innate immunity (rapid response) Dendritic cell. Macrophage. Natural killer cell. Complement protein. Neutrophil 1 The immune system The immune response The immune system comprises two arms functioning cooperatively to provide a comprehensive protective response: the innate and the adaptive immune system. The innate

More information

Antigen Presentation and T Lymphocyte Activation. Shiv Pillai MD, PhD Massachusetts General Hospital Harvard Medical School. FOCiS

Antigen Presentation and T Lymphocyte Activation. Shiv Pillai MD, PhD Massachusetts General Hospital Harvard Medical School. FOCiS 1 Antigen Presentation and T Lymphocyte Activation Shiv Pillai MD, PhD Massachusetts General Hospital Harvard Medical School FOCiS 2 Lecture outline Overview of T cell activation and the rules of adaptive

More information

Adaptive Immunity: Humoral Immune Responses

Adaptive Immunity: Humoral Immune Responses MICR2209 Adaptive Immunity: Humoral Immune Responses Dr Allison Imrie 1 Synopsis: In this lecture we will review the different mechanisms which constitute the humoral immune response, and examine the antibody

More information

Pre-B and pre-t-cell receptors: conservation of strategies in regulating early lymphocyte development

Pre-B and pre-t-cell receptors: conservation of strategies in regulating early lymphocyte development Stefan A. Muljo Mark S. Schlissel Pre-B and pre-t-cell receptors: conservation of strategies in regulating early lymphocyte development Authors addresses Stefan A. Muljo 1, Mark S. Schlissel 2, 1Graduate

More information

Microbiology 204. Background Slides on T Cell Development For Preparation for Flipped Classroom setting. Art Weiss.

Microbiology 204. Background Slides on T Cell Development For Preparation for Flipped Classroom setting. Art Weiss. Microbiology 204 Background Slides on T Cell Development For Preparation for Flipped Classroom setting Art Weiss October 23, 2015 Thymic Lobule Structure From: Immunobiology, Janeway, et al., 5th edition

More information

Principles of Adaptive Immunity

Principles of Adaptive Immunity Principles of Adaptive Immunity Chapter 3 Parham Hans de Haard 17 th of May 2010 Agenda Recognition molecules of adaptive immune system Features adaptive immune system Immunoglobulins and T-cell receptors

More information

PRECURSOR LYMHPOID NEOPLASMS. B lymphoblastic leukaemia/lymphoma T lymphoblastic leukaemia/lymphoma

PRECURSOR LYMHPOID NEOPLASMS. B lymphoblastic leukaemia/lymphoma T lymphoblastic leukaemia/lymphoma PRECURSOR LYMHPOID NEOPLASMS B lymphoblastic leukaemia/lymphoma T lymphoblastic leukaemia/lymphoma B lymphoblastic leukaemia/lymphoma Definition: B lymphoblastic leukaemia/lymphoma is a neoplasm of precursor

More information

Lectins: selected topics 3/2/17

Lectins: selected topics 3/2/17 Lectins: selected topics 3/2/17 Selected topics Regulation of T-cell receptor signaling Thymic selection of self vs. non-self T-cells Essentials of Glycobiology Second Edition Signaling pathways associated

More information

Antigen-Independent B-Cell Development Bone Marrow

Antigen-Independent B-Cell Development Bone Marrow Antigen-Independent B-Cell Development Bone Marrow 1. DNA rearrangements establish the primary repertoire, creating diversity 2. Allelic exclusion ensures that each clone expresses a single antibody on

More information

T Cell Receptor & T Cell Development

T Cell Receptor & T Cell Development T Cell Receptor & T Cell Development Questions for the next 2 lectures: How do you generate a diverse T cell population with functional TCR rearrangements? How do you generate a T cell population that

More information

T cell and Cell-mediated immunity

T cell and Cell-mediated immunity T cell and Cell-mediated immunity Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, it School of Medicine i Medical Research Building B815-819 Email: Lu.Linrong@gmail.com

More information

κ λ Antigen-Independent B-Cell Development Bone Marrow Ordered Rearrangement of Ig Genes During B-Cell Development in the Bone Marrow

κ λ Antigen-Independent B-Cell Development Bone Marrow Ordered Rearrangement of Ig Genes During B-Cell Development in the Bone Marrow Antigen-Independent B-Cell Development Bone Marrow 1. DNA rearrangements establish the primary repertoire, creating diversity 2. Allelic exclusion ensures that each clone expresses a single antibody on

More information

Recommended reading: Abbas et al. 5th edition, chapters 7 and 10; Janeway and Travers, 5th edition, chapter 7.

Recommended reading: Abbas et al. 5th edition, chapters 7 and 10; Janeway and Travers, 5th edition, chapter 7. Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai 10/05/05; 11 AM Shiv Pillai T Lymphocyte Development Recommended reading:

More information

Generation of antibody diversity October 18, Ram Savan

Generation of antibody diversity October 18, Ram Savan Generation of antibody diversity October 18, 2016 Ram Savan savanram@uw.edu 441 Lecture #10 Slide 1 of 30 Three lectures on antigen receptors Part 1 : Structural features of the BCR and TCR Janeway Chapter

More information

Adaptive Immune System

Adaptive Immune System Short Course on Immunology Adaptive Immune System Bhargavi Duvvuri Ph.D IIIrd Year (Immunology) bhargavi@yorku.ca Supervisor Dr.Gillian E Wu Professor, School of Kinesiology and Health Sciences York University,

More information

Helminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii. Ringworm fungus HIV Influenza

Helminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii. Ringworm fungus HIV Influenza Helminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii Ringworm fungus HIV Influenza Candida Staph aureus Mycobacterium tuberculosis Listeria Salmonella Streptococcus Levels

More information

SINGLE CHOICE. 5. The gamma invariant chain binds to this molecule during its intracytoplasmic transport. A TCR B BCR C MHC II D MHC I E FcγR

SINGLE CHOICE. 5. The gamma invariant chain binds to this molecule during its intracytoplasmic transport. A TCR B BCR C MHC II D MHC I E FcγR A Name: Group: SINGLE CHOICE 1. Which is the most important ligand of TLR5? A endospore B flagellin C polysaccharide capsule D DNA E pilus 2. The antibody-binding site is formed primarily by... A the constant

More information

B cell activation and antibody production. Abul K. Abbas UCSF

B cell activation and antibody production. Abul K. Abbas UCSF 1 B cell activation and antibody production Abul K. Abbas UCSF 2 Lecture outline B cell activation; the role of helper T cells in antibody production Therapeutic targeting of B cells 3 Principles of humoral

More information

T Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009

T Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009 T Cell Activation Patricia Fitzgerald-Bocarsly March 18, 2009 Phases of Adaptive Immune Responses Phases of T cell responses IL-2 acts as an autocrine growth factor Fig. 11-11 Clonal Expansion of T cells

More information

T cell maturation. T-cell Maturation. What allows T cell maturation?

T cell maturation. T-cell Maturation. What allows T cell maturation? T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

More information

T Cell Effector Mechanisms I: B cell Help & DTH

T Cell Effector Mechanisms I: B cell Help & DTH T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide

More information

Immunobiology 7. The Humoral Immune Response

Immunobiology 7. The Humoral Immune Response Janeway Murphy Travers Walport Immunobiology 7 Chapter 9 The Humoral Immune Response Copyright Garland Science 2008 Tim Worbs Institute of Immunology Hannover Medical School 1 The course of a typical antibody

More information

Defensive mechanisms include :

Defensive mechanisms include : Acquired Immunity Defensive mechanisms include : 1) Innate immunity (Natural or Non specific) 2) Acquired immunity (Adaptive or Specific) Cell-mediated immunity Humoral immunity Two mechanisms 1) Humoral

More information

Major Histocompatibility Complex (MHC) and T Cell Receptors

Major Histocompatibility Complex (MHC) and T Cell Receptors Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC

More information

Immunology Lesson plan for international medical students

Immunology Lesson plan for international medical students Immunology Lesson plan for international medical students Kermanshah University of medical sciences (KUMS) international affairs School of medicine Department of Immunology Lecturers: Dr. Ali Gorgin Karaji

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

Generation of The Immune Response

Generation of The Immune Response Generation of The Immune Response Introduction The adaptive immune system recognizes antigens using randomly generated T cell and B cell surface receptors Antigen-specific clonal expansion takes place

More information

TEMA 5. ANTICUERPOS Y SUS RECEPTORES

TEMA 5. ANTICUERPOS Y SUS RECEPTORES TEMA 5. ANTICUERPOS Y SUS RECEPTORES The B-cell antigen receptor (left) consists of two identical heavy (H) chains and two identical light (L) chains. In addition, secondary components (Ig-α and Ig-β)

More information

Structure and Function of Antigen Recognition Molecules

Structure and Function of Antigen Recognition Molecules MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and

More information

T cell and Cell-mediated immunity

T cell and Cell-mediated immunity T cell and Cell-mediated immunity ( 第十章 第十二章第十二章 ) Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, School of Medicine Medical Research Building B815-819

More information

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the

More information

A second type of TCR TCR: An αβ heterodimer

A second type of TCR TCR: An αβ heterodimer How s recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about function was known, but the receptor genes had not been identified Recall

More information

How T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do? Monoclonal antibody approach

How T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do? Monoclonal antibody approach How T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about T cell function was known, but the receptor genes had not been identified

More information

5/1/13. The proportion of thymus that produces T cells decreases with age. The cellular organization of the thymus

5/1/13. The proportion of thymus that produces T cells decreases with age. The cellular organization of the thymus T cell precursors migrate from the bone marrow via the blood to the thymus to mature 1 2 The cellular organization of the thymus The proportion of thymus that produces T cells decreases with age 3 4 1

More information

The development of T cells in the thymus

The development of T cells in the thymus T cells rearrange their receptors in the thymus whereas B cells do so in the bone marrow. The development of T cells in the thymus The lobular/cellular organization of the thymus Immature cells are called

More information

The development of clonality testing for lymphomas in the Bristol Genetics Laboratory. Dr Paula Waits Bristol Genetics Laboratory

The development of clonality testing for lymphomas in the Bristol Genetics Laboratory. Dr Paula Waits Bristol Genetics Laboratory The development of clonality testing for lymphomas in the Bristol Genetics Laboratory Dr Paula Waits Bristol Genetics Laboratory Introduction The majority of lymphoid malignancies belong to the B cell

More information

Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells

Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard

More information

GENETIC MARKERS IN LYMPHOMA a practical overview. P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute

GENETIC MARKERS IN LYMPHOMA a practical overview. P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute GENETIC MARKERS IN LYMPHOMA a practical overview P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute B and T cell monoclonalities Rearrangement of immunoglobin and TCR genes may help

More information

COURSE: Medical Microbiology, MBIM 650/720 - Fall TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12

COURSE: Medical Microbiology, MBIM 650/720 - Fall TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12 COURSE: Medical Microbiology, MBIM 650/720 - Fall 2008 TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12 FACULTY: Dr. Mayer Office: Bldg. #1, Rm B32 Phone: 733-3281 Email: MAYER@MED.SC.EDU

More information

Attribution: University of Michigan Medical School, Department of Microbiology and Immunology

Attribution: University of Michigan Medical School, Department of Microbiology and Immunology Attribution: University of Michigan Medical School, Department of Microbiology and Immunology License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution

More information

HST 176 Problem Set. 1. This is a schematic view of a rearranged µ chain.

HST 176 Problem Set. 1. This is a schematic view of a rearranged µ chain. Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai HST 176 Problem Set 1. This is a schematic view of a rearranged µ chain.??

More information

Immunology for the Rheumatologist

Immunology for the Rheumatologist Immunology for the Rheumatologist Rheumatologists frequently deal with the immune system gone awry, rarely studying normal immunology. This program is an overview and discussion of the function of the

More information

Generation of the Immune Response

Generation of the Immune Response Generation of the Immune Response Sheet 18 immunity I only added extra notes that were explained in the lecture, refer back to the slides. SLIDE 3: In the generation of Immune response whether by B or

More information

Overview of immunology

Overview of immunology Introduction Overview of immunology Masayuki Miyasaka, MD, PhD Interdisciplinary Program for Biomedical Sciences WPI Immunology Frontier Research Center (IFReC) Osaka University Inside our body, we have

More information

Signaling Through Immune System Receptors (Ch. 7)

Signaling Through Immune System Receptors (Ch. 7) Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling

More information

Lecture 7: Signaling Through Lymphocyte Receptors

Lecture 7: Signaling Through Lymphocyte Receptors Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural

More information

Immunodermatology. Danielle Tartar, MD, PhD Assistant Clinical Professor Co-Director of Inpatient Dermatology University of California - Davis

Immunodermatology. Danielle Tartar, MD, PhD Assistant Clinical Professor Co-Director of Inpatient Dermatology University of California - Davis Immunodermatology Danielle Tartar, MD, PhD Assistant Clinical Professor Co-Director of Inpatient Dermatology University of California - Davis Outline Adaptive Immunity: T and B cell development, activation,

More information

The T cell receptor for MHC-associated peptide antigens

The T cell receptor for MHC-associated peptide antigens 1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide

More information

b. In which box will the first amino acid of the mature protein be located? Second box from the left (after cleavage of the signal peptide)

b. In which box will the first amino acid of the mature protein be located? Second box from the left (after cleavage of the signal peptide) Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai HST 176 Problem Set 1. This is a schematic view of a rearranged µ chain.??

More information

Overview B cell development T cell development

Overview B cell development T cell development Topics Overview B cell development T cell development Lymphocyte development overview (Cont) Receptor diversity is produced by gene rearrangement and is random Includes specificities that will bind to

More information

Immune Regulation and Tolerance

Immune Regulation and Tolerance Immune Regulation and Tolerance Immunoregulation: A balance between activation and suppression of effector cells to achieve an efficient immune response without damaging the host. Activation (immunity)

More information

CHAPTER 9 BIOLOGY OF THE T LYMPHOCYTE

CHAPTER 9 BIOLOGY OF THE T LYMPHOCYTE CHAPTER 9 BIOLOGY OF THE T LYMPHOCYTE Coico, R., Sunshine, G., (2009) Immunology : a short course, 6 th Ed., Wiley-Blackwell 1 CHAPTER 9 : Biology of The T Lymphocytes 1. 2. 3. 4. 5. 6. 7. Introduction

More information

HOST DEFENSE SMALL GROUP PROBLEM SOLVING SESSION CLINICAL IMMUNOLOGIC ASSAYS-II

HOST DEFENSE SMALL GROUP PROBLEM SOLVING SESSION CLINICAL IMMUNOLOGIC ASSAYS-II Host Defense 2011 Small Group Problem Solving Session Clinical Immunologic Assays II HOST DEFENSE SMALL GROUP PROBLEM SOLVING SESSION CLINICAL IMMUNOLOGIC ASSAYS-II Small Group Classrooms LEARNING GOAL

More information

CELL BIOLOGY - CLUTCH CH THE IMMUNE SYSTEM.

CELL BIOLOGY - CLUTCH CH THE IMMUNE SYSTEM. !! www.clutchprep.com CONCEPT: OVERVIEW OF HOST DEFENSES The human body contains three lines of against infectious agents (pathogens) 1. Mechanical and chemical boundaries (part of the innate immune system)

More information

RICONOSCIMENTO DELL Ag DA PARTE DELL IMMUNITA ADATTATIVA

RICONOSCIMENTO DELL Ag DA PARTE DELL IMMUNITA ADATTATIVA RICONOSCIMENTO DELL Ag DA PARTE DELL IMMUNITA ADATTATIVA T B TCR BCR IMMUNOGLOBULINE QuickTime e un decompressore TIFF (Non compresso) sono necessari per visualizzare quest'immagine. Struttura delle Immunoglobuline

More information

Chapter 5. Generation of lymphocyte antigen receptors

Chapter 5. Generation of lymphocyte antigen receptors Chapter 5 Generation of lymphocyte antigen receptors Structural variation in Ig constant regions Isotype: different class of Ig Heavy-chain C regions are encoded in separate genes Initially, only two of

More information

Chapter 10 (pages ): Differentiation and Functions of CD4+ Effector T Cells Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group

Chapter 10 (pages ): Differentiation and Functions of CD4+ Effector T Cells Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group FIT Board Review Corner September 2015 Welcome to the FIT Board Review Corner, prepared by Andrew Nickels, MD, and Sarah Spriet, DO, senior and junior representatives of ACAAI's Fellows-In-Training (FITs)

More information

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10495 WWW.NATURE.COM/NATURE 1 2 WWW.NATURE.COM/NATURE WWW.NATURE.COM/NATURE 3 4 WWW.NATURE.COM/NATURE WWW.NATURE.COM/NATURE 5 6 WWW.NATURE.COM/NATURE WWW.NATURE.COM/NATURE 7 8 WWW.NATURE.COM/NATURE

More information

THE EFFECTOR FUNCTIONS OF ANTIBODIES. Catherine Fridman BMC

THE EFFECTOR FUNCTIONS OF ANTIBODIES. Catherine Fridman BMC THE EFFECTOR FUNCTIONS OF ANTIBODIES Catherine Fridman BMC423 2009 HUMORAL IMMUNITYAND CELLULAR IMMUNITY HUMORAL IMMUNITY (ANTIBODIES AND COMPLEMENT) IS USED TO FIGHT AGAINST EXTRACELLULAR BACTERIA CELLULAR

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

Molecular Diagnosis. Nucleic acid based testing in Oncology

Molecular Diagnosis. Nucleic acid based testing in Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,

More information

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214, Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development

More information

Introduction to Immunology Part 2 September 30, Dan Stetson

Introduction to Immunology Part 2 September 30, Dan Stetson Introduction to Immunology Part 2 September 30, 2016 Dan Stetson stetson@uw.edu 441 Lecture #2 Slide 1 of 26 CLASS ANNOUNCEMENT PLEASE NO TREE NUTS IN CLASS!!! (Peanuts, walnuts, almonds, cashews, etc)

More information

Nucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis

Nucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor

More information

Adaptive Immunity: Specific Defenses of the Host

Adaptive Immunity: Specific Defenses of the Host 17 Adaptive Immunity: Specific Defenses of the Host SLOs Differentiate between innate and adaptive immunity, and humoral and cellular immunity. Define antigen, epitope, and hapten. Explain the function

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Primer on Tumor Immunology. International Society for Biological Therapy of Cancer. C. H. June, M.D. November 10, 2005

Primer on Tumor Immunology. International Society for Biological Therapy of Cancer. C. H. June, M.D. November 10, 2005 Primer on Tumor Immunology International Society for Biological Therapy of Cancer C. H. June, M.D. November 10, 2005 Outline: Primer on Tumor Immunology T Cell Receptors T Cell Biology Tumor immunology

More information

Prepared by: Dr.Mansour Al-Yazji

Prepared by: Dr.Mansour Al-Yazji C L L CLL Prepared by: Abd El-Hakeem Abd El-Rahman Abu Naser Ahmed Khamis Abu Warda Ahmed Mohammed Abu Ghaben Bassel Ziad Abu Warda Nedal Mostafa El-Nahhal Dr.Mansour Al-Yazji LEUKEMIA Leukemia is a form

More information

T Cell Differentiation

T Cell Differentiation T Cell Differentiation Ned Braunstein, MD MHC control of Immune Responsiveness: Concept Whether or not an individual makes an immune response to a particular antigen depends on what MHC alleles an individual

More information

Summary for mid material immunology. THIS APPLIES FOR ALL SECTIONS Heyam Awad

Summary for mid material immunology. THIS APPLIES FOR ALL SECTIONS Heyam Awad Summary for mid material immunology THIS APPLIES FOR ALL SECTIONS Heyam Awad Innate immune system Innate immunity is composed of: 1. Epithelial barriers: skin, respiratory and gastrointestinal epithelium..

More information

IMMUNOBIOLOGY, BIOL 537 Exam # 2 Spring 1997

IMMUNOBIOLOGY, BIOL 537 Exam # 2 Spring 1997 Name I. TRUE-FALSE (1 point each) IMMUNOBIOLOGY, BIOL 537 Exam # 2 Spring 1997 Which of the following is TRUE or FALSE relating to immunogenicity of an antigen and T and B cell responsiveness to antigen?

More information

B Cell Activation and the Humoral Immune Response. Micro 204. Molecular and Cellular Immunology 2013 Lecturer: Jason Cyster

B Cell Activation and the Humoral Immune Response. Micro 204. Molecular and Cellular Immunology 2013 Lecturer: Jason Cyster B Cell Activation and the Humoral Immune Response Micro 204. Molecular and Cellular Immunology 2013 Lecturer: Jason Cyster Vaccine Quest Vaccines are needed that induce broadly neutralizing antibodies

More information