Supplementary Information
|
|
|
- Katherine Thornton
- 5 years ago
- Views:
Transcription
1 Supplementary Information Supplementary Figure 1. Short-term coreceptor and costimulation blockade induces tolerance to pluripotent human ESCs. (A) Schematic diagram showing experimental approaches and timing of antibody injections. (B) Representative image of hesc-derived teratomas formed 3 months post transplantation under the kidney capsule of CD-1 recipients following treatment with anti-cd4, -CD8 and CD40L mabs (n=5). (i) indicates teratoma tissues; (ii) indicates cysts formed within teratomas; and an asterisk indicates host kidney. (C-E) Representative H&E images showing tissues of the (C) ectoderm, (D) mesoderm and (E) endoderm lineages (n=5). Scale bar = 100 um. 1
2 Supplementary Figure 2. hesc-derived endothelial cells survived for 90 days post transplantation. Frozen sections of hesc-derived ECs transplanted subcutaneously in the form of matrigel plug in CD-1 mice for 90 days following treatment with anti-cd4, - CD8 and -CD40L mabs. (A, B) Representative H&E images showing vascular structures within the grafts. Sections were stained with (C) CD31 (red), (D) CD144 (red), (E) vwf (red) and (F) enos (red) with nuclear staining in Dapi (blue) (n=5). Scale bar = 100 um in (A), 25 um in (B) and 50 um (C-F). 2
3 Supplementary Figure 3. Neural grafts do not express antigens considered unique to hesc-derived CD31+CD144+ endothelial progenitor cells. Immunostaining of neural cell-specific marker, Nestin (green) and endothelial cell-specific markers, CD31, CD144, enos or vwf (red) by neural grafts transplanted 30 days under the kidney capsules. Sections were chosen for immunostaining with alternative slides of the same recipient or of different recipients (n=5). Scale bar = 100 um. 3
4 Supplementary Figure 4. Proportion of splenic CD4 + FoxP3 + cells in tolerized and naïve mice. Splenic CD4 + FoxP3 + cells were isolated from (A) untreated mice and (B) anti-cd4, -CD8 and CD40L mabs-treated recipients following transplantation of hesc-derived neural progenitor cells for 30 days (n=3 in each group). 4
5 Supplementary Figure 5. Tolerized EB grafts express less pro-inflammatory cytokine genes compared to that of rejecting EB grafts. (A-I) Quantitative RT-PCR of hesc-derived teratomas isolated from untreated recipients (rejecting grafts) or anti-cd4, -CD8 and -CD40L mabs-treated recipients (tolerized tissues or cysts) on day 90 of transplantation; expression levels of the pro-inflammatory cytokines were compared to that of undifferentiated hescs (value on y-axis = 1). Data are presented as mean +/- SD. *indicates p<0.05, **p<0.01 and ***p<
6 Supplementary Figure 6. Tolerized EB grafts express more anti-inflammatory cytokine genes compared to that the rejecting EB grafts. (A-D) Quantitative RT-PCR of hesc-derived teratomas isolated from untreated recipients (rejecting grafts) or anti- CD4, -CD8 and -CD40L mabs-treated recipients (tolerized tissues or cysts) on day 90 of transplantation; expression levels of the anti-inflammatory cytokines were compared to that of undifferentiated hescs (value on y-axis = 1). Data are presented as mean +/- SD. **indicates p<0.01 and ***p<
7 Supplementary Table 1. Pathway/gene set enrichment analysis (GSEA) showing upregulated (S1A) and downregulated (S1B) genes in tolerized CD3 + T cells. In the GESA report, a p value of zero (0.0) indicates an actual p value of less than 1/number-of-permutations. We performed 1000 permutations hence a value of 0 is equivalent to p<
8 In the GESA report, a p value of zero (0.0) indicates an actual p value of less than 1/number-of-permutations. We performed 1000 permutations hence a value of 0 is equivalent to p<
9 Supplementary Table 2. Antibodies for immunostaining or flow cytometry used in this study. Antibody Clone Function Company CD3-FITC HIT3a marker for T-cells Biolegend CD4-FITC RM4-5 marker for helper T-cells ebiosciences CD8-Biotin marker for cytotoxic T-cells ebiosciences CD25-PE PC61.5 marker for activated T-cells ebiosciences CD31-Biotin WM59 marker for endothelial cells ebiosciences CD144-APC 16B1 marker for endothelial cells Abcam DiR (DiIC 18 (7)) N/A cell-tracking dye Life technologies enos (unconjugated) N/A marker for endothelial cellspecific nitric oxide synthase Abcam FoxP3-APC FJK-16s marker for regulatory T-cells ebiosciences N-Cadherin (unconjugated) Nestin (unconjugated) Neurofilament (unconjugated) N/A marker for neural cells Abcam 2C1.3A11 marker for neural cells Abcam N/A marker for neural cells Abcam Tra-1-60-PE Tra-1-60 marker for pluripotent cells ebiosciences vwf (unconjugated) N/A marker for endothelial cells Abcam 9
10 Supplementary Table 3. Complementary DNA PCR primer sequences used in this study. Human Genes Forward Reverse Cd31 AACAGTGTTGACATGAAGAGCC TGTAAAACAGCACGTCATCCTT enos TGATGGCGAAGCGAGTGAAG ACTCATCCATACACAGGACCC e-selectin AGAGTGGAGCCTGGTCTTACA CCTTTGCTGACAATAAGCACTGG Gapdh GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG Gfap CTGCGGCTCGATCAACTCA TCCAGCGACTCAATCTTCCTC Icam1 ATGCCCAGACATCTGTGTCC GGGGTCTCTATGCCCAACAA Id1 CTGCTCTACGACATGAACGG GAAGGTCCCTGATGTAGTCGAT Isl1 GCGGAGTGTAATCAGTATTTGGA GCATTTGATCCCGTACAACCT Kdr GGCCCAATAATCAGAGTGGCA CCAGTGTCATTTCCGATCACTTT Mbp GTCCCTGAGCAGATTTAGCTG GAATCCCTTGTGAGCCGATTT NCad TCAGGCGTCTGTAGAGGCTT ATGCACATCCTTCGATAAGACTG Nestin CTGCTACCCTTGAGACACCTG GGGCTCTGATCTCTGCATCTAC NeuN CCAAGCGGCTACACGTCTC CGTCCCATTCAGCTTCTCCC Neurod1 ATGACCAAATCGTACAGCGAG GTTCATGGCTTCGAGGTCGT Olig1 TACTATGCGGTTTCCCAGGC GCTGAGTAGGGCAGGATGA Olig2 CCAGAGCCCGATGACCTTTTT CACTGCCTCCTAGCTTGTCC p-selectin ACTGCCAGAATCGCTACACAG CACCCATGTCCATGTCTTATTGT S100b TGGCCCTCATCGACGTTTTC ATGTTCAAAGAACTCGTGGCA Tie2 TTAGCCAGCTTAGTTCTCTGTGG AGCATCAGATACAAGAGGTAGGG Vcam1 GGGAAGATGGTCGTGATCCTT TCTGGGGTGGTCTCGATTTTA vwf CCGATGCAGCCTTTTCGGA TCCCCAAGATACACGGAGAGG Mouse Genes Forward Reverse Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA Ifnb ATGACCAACAAGTGTCTCCTCC GGAATCCAAGCAAGTTGTAGCTC Ifng ATGAACGCTACACACTGCATC CCATCCTTTTGCCAGTTCCTC Il1b GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT Il2 TGAGCAGGATGGAGAATTACAGG GTCCAAGTTCATCTTCTAGGCAC Il4 GGTCTCAACCCCCAGCTAGT GCCGATGATCTCTCTCAAGTGAT Il6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC 10
11 Il10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG Il12b TGGTTTGCCATCGTTTTGCTG ACAGGTGAGGTTCACTGTTTCT Il17a TTTAACTCCCTTGGCGCAAAA CTTTCCCTCCGCATTGACAC Il23a ATGCTGGATTGCAGAGCAGTA ACGGGGCACATTATTTTTAGTCT Tgfb1 GGCCAGATCCTGTCCAAGC GTGGGTTTCCACCATTAGCAC Tgfb2 CTTCGACGTGACAGACGCT GCAGGGGCAGTGTAAACTTATT Tgfb3 CCTGGCCCTGCTGAACTTG TTGATGTGGCCGAAGTCCAAC Tnfa CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG 11
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).
Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
Supplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
MicroRNA mir-326 regulates T H -17 differentiation and is associated with the pathogenesis of multiple sclerosis
correction notice Nat. Immunol. 10, 1252 1259 (2009) MicroRNA mir-326 regulates T H -17 differentiation and is associated with the pathogenesis of multiple sclerosis Changsheng Du, Chang Liu, Jiuhong Kang,
Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer
Supplementary Information Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer Grit S. Herter-Sprie, Shohei Koyama, Houari Korideck, Josephine Hai, Jiehui Deng, Yvonne Y. Li, Kevin A. Buczkowski,
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary Figure 1 (Mu) SBP (mmhg) 2 18 16 p Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. .. Supplementary Figure 1 % of initial
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad
CHAPTER 3 LABORATORY PROCEDURES
CHAPTER 3 LABORATORY PROCEDURES CHAPTER 3 LABORATORY PROCEDURES 3.1 HLA TYPING Molecular HLA typing will be performed for all donor cord blood units and patients in the three reference laboratories identified
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells Liying Yan,2,5, Mingyu Yang,5, Hongshan Guo, Lu Yang, Jun Wu, Rong Li,2, Ping Liu, Ying Lian, Xiaoying Zheng, Jie
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Figure S1. A Non-lesional Lesional
Figure S1 Non-lesional Lesional GEN1 Non-lesional GEN1 Lesional C Normal Negative control Figure S1. Dermal Populations of + cells are found in human skin. Immunohistochemistry for on fixed, frozen skin
Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
SUPPLEMENTARY INFORMATION
Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart. a, Hematoxylin eosin staining showing structures of left atrium and left atrium appendage (*) of a human fetal heart at 11 weeks of gestation.
D CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)
Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
Supplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
Teratoma Formation Pluripotency Analysis Report
Teratoma Formation Pluripotency Analysis Report Project and Customer Information Service Title: Teratoma formation pluripotency analysis Customer: PepGel LLC PI/Contact: Susan, Email: sun.pepgel@gmail.com
Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Tissue microenvironments in therapeutic tolerance
REPROGRAMMING THE IMMUNE SYSTEM IN AUTOIMMUNITY AND TOLERANCE Tissue microenvironments in therapeutic tolerance Malignant tissues use multiple mechanisms to limit immune damage. The tissue microenvironment
and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
Supplementary Figure 1. Example of gating strategy
Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
Supplementary Table 1. Oligonucleotide primers used in quantitative and qualitative PCRs of this study.
Supplementary Table 1. Oligonucleotide primers used in quantitative and qualitative PCRs of this study. Primer Sequence Qualitative PCR primers Universal 16S rdna forward 5 - GACGCTGAGGCATGAGAGCA-3 Universal
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
Harnessing tolerance mechanisms with monoclonal antibodies Prof. Herman Waldmann
Harnessing tolerance mechanisms Herman Waldmann Sir William Dunn School of Pathology, Oxford University, UK 1 1. Transplantation 2 Lymphocyte depletion strategies to minimise drug immunosuppression in
Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after
Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)
Effector T Cells and
1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
DURACLONE IF BE CERTAIN ABOUT THE RESPONSE. l res. a il n c n. For Research Use Only - Not for use in Diagnostic procedures
DURACLONE IF earch tria l res lc a om ic il n c n nio pa Yo ur BE CERTAIN ABOUT THE RESPONSE For Research Use Only - Not for use in Diagnostic procedures BE CERTAIN ABOUT THE RESPONSE The sensitive and
Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads
Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads Representative example of comparative ex vivo tetramer enrichment performed in three independent experiments with either conventional
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
Supplementary Table e-1. Flow cytometry reagents and staining combinations
Supplementary data Supplementary Table e-1. Flow cytometry reagents and staining combinations Reagents Antibody Fluorochrome Clone Source conjugation CD3 FITC UCHT1 BD Biosciences CD3 PerCP-Cy5.5 SK7 Biolegend
Supplementary Figure 1
Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.
Supplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)
Title Toll-like receptor 3 signal augments radiation-induc Yoshida, Sumito; Shime, Hiroaki; Takeda, Yohei; Nam, Author(s) Hiroki; Kasahara, Masanori; Seya, Tsukasa CitationCancer science, 19(): 956-965
Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
T cell development October 28, Dan Stetson
T cell development October 28, 2016 Dan Stetson stetson@uw.edu 441 Lecture #13 Slide 1 of 29 Three lectures on T cells (Chapters 8, 9) Part 1 (Today): T cell development in the thymus Chapter 8, pages
BCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific
SUPPLEMENTARY FIGURE LEGEND Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific CD4 + T cells correlates with intracellular CTLA-4 levels. (a) Comparative CTLA-4 levels
Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution
Immunity, Volume 9 Supplemental Information Regulatory T Cells Promote Macrophage Efferocytosis during Inflammation Resolution Jonathan D. Proto, Amanda C. Doran, Galina Gusarova, Arif Yurdagul Jr., Erdi
MPB333:Molecular Endocrinology of Obesity and Diabetes
MPB333:Molecular Endocrinology of Obesity and Diabetes The Use of Stem Cells as a Cure for Type 1 Diabetes January 15, 2010 Trish Labosky 9415C MRBIV trish.labosky@vanderbilt.edu In theory. 2. ~Easy and
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated
1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade
Supplementary figures
Supplementary figures Supplementary figure 1: Pathway enrichment for each comparison. The first column shows enrichment with differentially expressed genes between the diet groups at t = 0, the second
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
SUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
Autoimmunity & Transplantation. Dr. Aws Alshamsan Department of Pharmaceu5cs Office: AA87 Tel:
Autoimmunity & Transplantation Dr. Aws Alshamsan Department of Pharmaceu5cs Office: AA87 Tel: 4677363 aalshamsan@ksu.edu.sa Learning Objectives By the end of this lecture you will be able to: 1 Recognize
Supplementary figure 2. VCAM1 protein expression in static HCAECs exposed to CSE over 72 hours, with TNFα or TNFα + CSE positive controls.
Supplementary data Cigarette smoke extract profoundly suppresses TNFα-mediated proinflammatory gene expression through upregulation of ATF3 in human coronary artery endothelial cells Jack E. Teasdale 1,
As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the
3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing
Supplementary Materials for
www.sciencemag.org/content/348/6241/aaa825/suppl/dc1 Supplementary Materials for A mucosal vaccine against Chlamydia trachomatis generates two waves of protective memory T cells Georg Stary,* Andrew Olive,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Cell therapeutics for the Insulin-Dependent Diabetes Mellitus
Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Haekwon Kim Dept. of Biotechnology Seoul Women s University Introduction Type I diabetes is caused by the autoimmune destruction of pancreatic
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21
Categorical analysis of human T cell heterogeneity with One-SENSE
1 2 3 4 Supplementary Information Categorical analysis of human T cell heterogeneity with One-SENSE 5 6 Running title: T cell Analysis by One-SENSE 7 8 9 1 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 26
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature11463 %Sox17(+) 9 8 7 6 5 4 3 2 1 %Sox17(+) #Sox17(+) d2 d4 d6 d8 d1 d12 d14 d18 25 2 15 1 5 Number of Sox17(+) cells X 1 Supplementary Figure 1: Expression of
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm