Supplementary Appendix
|
|
|
- Darcy Griffith
- 6 years ago
- Views:
Transcription
1 Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11 mutations, meiotic arrest, and azoospermia in infertile men. N Engl J Med 2015;372: DOI: /NEJMoa
2 Supplementary Materials Table of Contents Methods..3 Immunohistochemistry 3 Figure S1 4 Figure S2 5 Figure S3 6 Figure S4 7 Figure S5 8 Figure S6 9 Figure S7 10 Table S1.11,12 Table S2..13 Table S Table S4..25 Table S
3 Methods Immunohistochemistry The normal mouse and monkey tissue were obtained from the biobank of CeRA. All tissue sections became available from previous experimental studies on animals approved by LANUV NRW. Mouse, primate, and human testicular tissue sections were stained with primary antibody against TEX11 (goat polyclonal anti-tex11, ab99461, dilution of 1:100; Abcam, Cambridge, MA) and visualized using 3, 3 diaminobenzidine (D4168, Sigma-Aldrich, St. Louis, MO) and hematoxylin as counterstain. Paraffin wax was removed from testicular tissue sections using ProTaqs Clear solvent (Quartett Immunodiagnostika and Biotechnologie, Berlin, Germany), and sections were subsequently rehydrated in a series of decreasing concentrations of ethanol. After rinsing with distilled water and Tris-buffered saline (TBS), sections were placed into citrate buffer (ph 6) and heated by microwave for 12 min for antigen retrieval. After cooling to room temperature (RT), sections were washed in TBS, and non-specific peroxidases were blocked with 3% H 2 O 2 for 15 min at RT. To block non-specific binding sites, sections were incubated with 10% chicken serum in TBS containing 5% bovine serum albumin for 20 min at RT. Primary antibodies against TEX11 (goat polyclonal anti-tex11, ab99461, dilution of 1:100; Abcam) were applied, and sections were incubated overnight in a humid chamber at 4 C. After three washes in TBS, primary antibody was detected using the secondary antibody (chicken-anti-goat-hrp, sc-2984, dilution 1:250; Santa Cruz Biotechnology, Dallas, TX). Staining was visualized using 3, 3 -diaminobenzidine (D4168, Sigma-Aldrich) and hematoxylin as counterstain. 3
4 1 3 Figure S1. qpcr analysis of exons of TEX11. Samples fold-change calculated by delta Ct with beta-actin serving as an internal control. Patients 1 and 3 showed no amplification of TEX11 exons products. Normal samples 1, 2, and 3 served as controls and display a foldchange of /- 0.12, consistent with one copy of TEX11. 4
5 Figure S2. Reported structural variations in a general population from the Database of Genomic Variants (DGV) around exons of TEX11. The asterisked 99 Kb deletion (red line) represents the CNV found in Patients 1 and 3. The duplications (blue lines) and complex CNVs (brown line) are reported structural variations in the DGV. Dashed rectangles indicate that the area around breakpoints of the deletion found in Patients 1 and 3. Note that breakpoints of CNVs are clustered around the Patients 1 and 3 deletion breakpoints, indicating DNA intervals prone to breakage. 5
6 Figure S3. Breakpoint analysis for the deletion of exons in patients 1 and 3. A. Reference DNA depicting LINE (brown arrows) and Alu (blue arrows) repeats flanking four breakpoint regions (orange vertical lines) around exons (black outlined open rectangles). B. Magnified view of significant LINE and Alu repeats around breakpoints. C. Genomic structure of L1MA9 and L1PA4 repeats with shared microhomology around breakpoints BP1-4. Colored arrows correspond to identical microhomology regions in opposing LINE repeat. Blue line and numbers indicate position of microhomology region in LINE repeat. D. TEX11 (black solid line) deletion of 115 bp (dotted lines), a short inversion of 268 bp in intron 9 (striped arrow), and a 98,970 pb deletion of exons (dotted lines). E. A magnified view of breakpoint regions inside of LINE repeats. 6
7 Figure S4. Multiple protein alignment of 2 missense mutations in the TEX11 amino acid sequence. The methionine amino acid at position 171 was changed to valine, and is conserved, but it is adjacent to a conserved region. The protein sequence is highly conserved from amino acid position 189 through the entire SPO22 domain. The conserved alanine-698, was mutated to threonine and falls into aher conserved region. 7
8 Figure S5. Tertiary TEX11 protein structure prediction. Diagram of the top tertiary structure model from Phyre2 15. The N-terminal two-thirds of TEX11, modeled with template 2XPI, is shown in blue and gold: the SPO22 domain shown in blue; the segment of SPO22 that is deleted in p.218del79aa in white; TPR1 and TPR2 in gold. The C-terminal region of TEX11, modeled with template structure 4I2W, is shown in green. Predicted locations of amino acid changes in the genetic study are shown as red dots. Each inset shows the amino acid of interest as sticks on the cartoon representation of the backbone in an orientation that best shows their modeled positions. The N-terminal unmodeled region and the linker between the two structural models are shown as dotted lines. The orientation of the two domains relative to one aher has been modeled, as indicated by a question mark. 8
9 Figure S6. Three dimensional structural protein modeling of TEX11 reveals many potential arrangements of its helical motifs. A. Linear diagram of the secondary structure prediction of TEX11. Each orange region represents a predicted α-helix. Locations of the missense mutations and deletion analyzed in this study are shown. Red bars represent elements detected by Pfam 18. Blue bars represent TPRs predicted by TPRPred 19, with p-values < 10-4 represented by dark blue bars, and p-value = 10-4 in light blue bars. The green bar represents the TPRs predicted by ABRA. B. Diagrams of the two most probable models of the Spo22 domain of TEX11 modeled by I-Tasser 17,20. C. Diagrams of the two highest ranked tertiary structure models from I-Tasser of TEX11 17,20. D. Diagrams of the five top ranked tertiary structure models from Phyre2 of the N- terminal two-thirds of TEX
10 Figure S7. Immunohistochemical detection of TEX11 in normal testicular tissue sections of mouse (A-B), macaque (Macaca fascilaris) (C-D), and human (E-F). Higher magnifications of dashed subframes of Fig. E are shown in E1 and E2. Positive signal for TEX11 is visible as brown precipitate. Hematoxylin was used as counterstain. Exchange of the TEX11 antibody with a corresponding IgG antibody was used as a control for method specificity (B, D, F). In the mouse testis the positive signal is most prominent in spermatocytes (A). In primates (C) and humans (E, E1, E2), the positive staining was detected at later stages of germ cell development in comparison to the mouse. TEX11 is absent in early spermatocytes, designated by arrow (E1), and expression becomes visible in late spermatocytes, designated by arrow (E2). The staining is also present in round (designated by arrowhead) and elongating spermatids (designated by asterisk). Scale bars represent the indicated distances. 10
11 Table S1. Genomic DNA primers for 30 coding exons of TEX11 isoform 1 (NM_ )* and 2 (NM_ ). Primers name Forward Reverse Length (bp) Ex 2, isoform 2 CCCTTTCATGGGCTTTTAACTTTAC CCACCGCGCCCAGCAATATTTAG 274 Ex 3, isoform 1 TGTTCATGTCATATCTTTGGTGCTT GACAAGAGTTGGCTTGGCACAGT 527 Ex 3, isoform 1 seq TCTTTCTTTCTTTCCTTAG - - Ex 4 TCCTTCATGCTGTATTCATTTGG CGAGCACATATGTTCCCATTGGT 422 Ex 5 TGGGTAAGTTTTTGCGGGGAGAGG TGAGGGAGGCCATTTGCTTGAGA 411 Ex 6 CAACAAAACTGGCTTCCTTCAATT GGAACACTGAAAAGGAACACCAT 319 Ex 7+8 TGCTAACTGTTGCTTTTTGTTTTCTG TCACCCTTAGCCACCCCATAGA 632 Ex 9 ACTCTGTGTCACCAAAGATTACCACTT GCTTTTTCAAATGCCCTTTCTGG 460 Ex 10 TCTCCTAGGCTGGAGTGATGTGG AAGTCAGAGAAGGTTTAAACTGCCAAA 301 Ex 11 TTGTAGTGCAAAACAGAAAAGTTGGA GATGTTAAATGTTGTGCCCAATAGC 323 Ex 12 GACTGTGGTCGCTTAAGGAAATGC AACATAGGAATTTGCGGGGACAC 431 Ex 13 TGGGAAATATCCTCAGGGATAGAACA TGGGTGACAATATTTTCCCTTTCC 406 Ex 14 TGACACTCTCCAGCACTGGATGTTA ATATTGCCAAGGTTGGTCTCAAGC 401 Ex 15 TCTGGCTTATTTTGCTCACACTG GGAAGAAATCCATTGACTTGAGG 351 Ex 16 AGGAGAATCAGGCAGCAGTACC CTTGCACAATGCTCATTAACACTC 415 Ex 17 TTGACCAAGACTGATAATAAAATGCA TTCTCTCTTTCTTTGGGAAGTTTCA 502 Ex 18 TTGCATTAGCATTCTAGAAGAGCAC ATAACCTTCCACGGTTTCTTTTTGC 442 Ex 19 TGGTGTTCAAATCCTCCTTGAAA GGCATGAAAATATGAGGCAAAAC 423 Ex 20 GGGGCTAATGCAAATGTGTCCTG CACCCTCCTCTGCTTCGCTATTT 408 Ex 21 CTTCTCCCTCCCAGAGTAATCAA AAGACTGGCCCCAAAACCTGTAT 288 Ex 22 TGAGGGCACTGGGAATGAGTAAC TCTCTGCTTGTGAATGAAGAAACCA 412 Ex 23 ACTTTTGGTATGCACCCCTACAC CCACAGCTACAAATGAAAGATCCA 328 Ex 24 AAGATTGGAATTGACGAGGGTCTC GCCCCACATTCTTATGTTATACCC 455 Ex 25 GTGCTTTTCCAGCTGAATTTTCTCAT GAAGAGGCCACACCAAAAGTAACC
12 Ex 26 AAGGAAATGTGCAAATAGAGGCTAA AAGCTCCTTTCAAACTGTGTTACC 301 Ex 27 TCTGTCTACAGCAGTGAAGATGAC TGGCATTAGAGAAGGAGAAACAAAG 439 Ex 28 CACCATGCTACTCTGCCCAGAAA TTCACAAGAATGCCCCCAGATCAT 438 Ex 29 GGCCAGATAAAACCGAGGGAAG TTCAGAAACCCAGGAAAATTCTGTA 420 Ex 30 GTGCTCTCCTCCTGCACTCTCC CAAGGAGGATGGGGTTGAGTCCT 416 Ex 31 GGGGATTCCTTTTCCTCAAGAGA TTCAGCATGCTTTTATTTTAGAAAGTT 410 *Exons are labeled according to isoform 1. All forward and reverse primers were used for both PCR and Sanger Sequencing, excluding exon 3 isoform 1. For this exon, forward and reverse primers were used for PCR, the reverse primer was used for sequencing in the reverse direction, and the exon 3 isoform 1 seq primer was used for sequencing in the forward direction. 12
13 Table S2. Genomic DNA primers for quantitative PCR of TEX11 exons isoform 1 (NM_ ). Primer name Forward Reverse Length (bp) Ex 10 ACTTCAAGTCTTCATCATCTCTGT ATTCCCGAGTTTACATTCAGTTTT 123 Ex 11 AGCTATGATATTGGGAAGATGGA ATGGGGAGTACGCTATTATAATTTT 137 Ex 12 ACAGGCTAAAGTTCTACGGCTA AGCCCCATACCTTGTTTGCTAG 110 ACTB CGTACCACTGGCATCGTGAT GCTCGGTGAGGATCTTCATGA
14 Table S3. Total copy number variation (CNV) report for 15 azoospermic men analyzed by array comparative genomic hybridization (acgh). CNV is Copy number variant, Chr dees chromosome, kb is kilo bases or thousand bases, cytoband is chromosome band, DGV is the database of genomic variants. CNV Chr Start End Size, kb Genome coordinates Cytoband #Probes Copy number Number of genes Number of patients DGV ,846,934 12,870,823 23,889 chr1: p loss 0 2 present ,986, ,064,610 78,244 chr1: q loss 1 2 present ,041, ,230, ,765 chr1: q loss 1 8 present ,333, ,405,013 71,889 chr1: q gain 3 1 present 5 1 1,521,481 1,540,027 18,546 chr1: p loss 0 2 present ,553, ,581,944 28,689 chr1: q gain 1 13 present 7 1 1,651,368 1,664,221 12,853 chr1: p loss 1 1 present ,227, ,230,491 3,347 chr1: q loss 1 4 present ,927,124 17,253, ,314 chr1: p gain 2 1 present ,091,225 17,253, ,213 chr1: p gain 0 1 present ,826, ,864,379 37,754 chr1: q loss 0 1 present ,742, ,756,290 13,555 chr1: q loss 1 4 present ,318, ,331,282 12,446 chr1: q loss 1 1 present ,339, ,672, ,328 chr1: q44 49 gain 0 10 present 14
15 ,997,718 60,052,475 54,757 chr1: p loss 1 3 present ,841,584 64,848,598 7,014 chr1: p loss 0 1 present ,768,855 72,795,480 26,625 chr1: p loss 0 9 present ,996, ,050,268 53,569 chr2: q loss 0 1 present ,078, ,197, ,650 chr2: q gain 0 3 present ,069, ,070,733 1,128 chr2: q gain 0 7 present ,189,720 18,251,750 62,030 chr2: p loss 0 1 present ,043, ,094,608 50,844 chr2: q loss 0 1 present ,410, ,420,696 10,406 chr2: q loss 0 1 present ,753, ,762,406 8,895 chr2: q gain 1 4 present ,856, ,038, ,743 chr2: q loss 0 1 present ,697,718 34,730,142 32,424 chr2: p loss 0 7 present ,702,930 34,730,142 27,212 chr2: p loss 0 2 present ,958,541 38,002,391 43,850 chr2: p loss 0 3 present ,601,864 90,265, ,255 chr2: p loss 0 2 present ,514, ,611,115 96,581 chr3: q loss 0 12 present ,354, ,454, ,389 chr3: q29 12 gain 2 4 present 15
16 ,419, ,444,214 25,046 chr3: q29 10 loss 2 2 present ,980,926 37,986,165 5,239 chr3: p loss 1 3 present ,796,031 46,848,728 52,697 chr3: p loss 0 2 present ,608,466 56,619,604 11,138 chr3: p loss 0 1 present ,767,533 75,793,273 25,740 chr3: p gain 0 1 present ,394,229 89,416,802 22,573 chr3: p loss 1 2 present ,949, ,352, ,280 chr4: q gain 0 1 present ,401, ,419,493 18,424 chr4: q loss 0 1 present ,678, ,721,966 43,317 chr4: q gain 0 1 present ,787,128 34,814,779 27,651 chr4: p loss 0 1 present ,963,379 40,088, ,598 chr4: p14 26 gain 2 1 present ,418,993 65,486,011 67,018 chr4: q gain 0 1 present ,387,056 69,483,277 96,221 chr4: q loss 1 13 present ,115,834 78,211,152 95,318 chr4: q loss 0 1 present ,274, ,292,080 17,854 chr5: q loss 0 2 present ,223, ,236,399 13,143 chr5: q loss 11 2 present ,204, ,221,011 16,014 chr5: q loss 0 4 present 16
17 ,471, ,488,272 16,788 chr5: q gain 1 1 present ,662,300 17,697,930 35,630 chr5: p loss 0 1 present ,410, ,429,788 19,534 chr5: q gain 1 3 present ,427,452 21,524,011 96,559 chr5: p loss 0 1 present ,107,383 32,167,638 60,255 chr5: p gain 2 2 present , ,095 80,839 chr5: p gain 1 2 present , ,264 98,095 chr5: p gain 0 2 present ,446, ,546,279 99,664 chr6: q21 19 loss 0 1 present ,223, ,414, ,017 chr6: q21 37 gain 2 1 present ,436, ,468,315 31,798 chr6: q gain 1 4 present ,725, ,737,665 12,118 chr6: q27 3 gain 0 1 present , ,594 31,713 chr6: p gain 0 5 present ,520,009 29,615,842 1,095,833 chr6: p gain 7 1 present ,854,870 29,896,710 41,840 chr6: p loss 0 2 present , ,956 79,593 chr6: p loss 0 2 present ,349,905 31,450, ,254 chr6: p loss 2 2 present ,785,578 31,794,898 9,320 chr6: p loss 3 1 present 17
18 ,427,088 32,546, ,794 chr6: p loss 2 15 present ,601,344 32,654,142 52,798 chr6: p loss 2 8 present ,917,608 56,953,602 35,994 chr6: p loss 0 1 present ,979,172 79,023,328 44,156 chr6: q gain 0 8 present ,443, ,453,033 9,933 chr7: q loss 0 1 present ,577, ,629,793 52,600 chr7: q loss 0 1 present ,788, ,797,387 8,473 chr7: q33 3 gain 0 7 present ,750, ,792,094 41,664 chr7: q34 9 loss 1 2 present ,951, ,953,472 1,541 chr7: q35 3 loss 0 8 present ,456, ,459,393 2,760 chr7: q gain 0 1 present ,662,985 20,758,193 95,208 chr7: p gain 1 1 present ,461,023 53,583, ,161 chr7: p loss 0 1 present ,691,376 65,308, ,343 chr7: q gain 1 1 present ,433,522 76,527,501 93,979 chr7: q gain 0 1 present ,162,484 85,198,014 35,530 chr7: q loss 0 1 present ,693, ,850, ,949 chr8: q loss 0 2 present ,990, ,021,210 31,050 chr8: q gain 2 5 present 18
19 ,421,661 15,433,690 12,029 chr8: p22 4 loss 1 1 present ,234,992 39,386, ,166 chr8: p loss 0 12 present ,329,470 4,357,521 28,051 chr8: p loss 1 2 present ,169,490 7,786, ,218 chr8: p gain 10 2 present ,239,491 7,786, ,217 chr8: p loss 10 1 present ,533, ,562,311 29,195 chr9: q loss 1 1 present ,407, ,419,558 12,388 chr9: q gain 1 1 present ,505,843 43,836, ,585 chr9: p12 6 gain 0 2 present ,507, ,514,326 6,971 chr10: q loss 1 1 present ,360, ,370,482 10,000 chr10: q gain 0 5 present ,236, ,378, ,754 chr10: q gain 3 1 present ,968,072 47,695, ,817 chr10: q gain 3 1 present ,007,565 47,148, ,981 chr10: q gain 1 1 present ,448,627 56,468,820 20,193 chr10: q gain 1 1 present ,850,715 59,878,505 27,790 chr10: q gain 0 1 present ,949,929 18,960,666 10,737 chr11: p loss 1 1 present ,610,678 25,622,569 11,891 chr11: p loss 0 2 present 19
20 ,361,638 55,450,788 89,150 chr11: q11 17 loss 0 13 present ,372,753 55,430,765 58,012 chr11: q11 11 loss 0 2 present ,785,900 5,805,665 19,765 chr11: p loss 0 6 present ,815,017 7,826,975 11,958 chr11: p loss 0 2 present ,579,158 10,593,748 14,590 chr12: p loss 1 1 present ,221,333 11,249,210 27,877 chr12: p loss 1 13 present ,960,021 34,756, ,188 chr12: p gain 1 1 present ,637,323 9,698,517 61,194 chr12: p gain 0 15 present ,858,137 19,892,981 34,844 chr13: q gain 0 1 present ,760,478 57,783,723 23,245 chr13: q loss 0 1 present ,410,535 63,441,072 30,537 chr13: q loss 0 1 present ,240,911 69,263,772 22,861 chr13: q loss 0 2 present ,115,188 84,152,921 37,733 chr13: q loss 0 2 present ,531, ,559,103 27,546 chr14: q loss 1 4 present ,535, ,653, ,768 chr14: q gain 1 1 present ,785, ,810,907 24,980 chr14: q gain 1 3 present ,873, ,927,426 53,465 chr14: q loss 1 2 present 20
21 ,875, ,931,193 55,245 chr14: q loss 1 1 present ,148, ,180,095 31,356 chr14: q gain 1 3 present ,376,762 20,420,849 1,044,087 chr14: q loss 1 10 present ,189,654 45,222,609 32,955 chr14: q loss 0 1 present ,001,651 74,012,568 10,917 chr14: q loss 1 5 present ,106,284 80,113,460 7,176 chr14: q loss 1 2 present ,103,155 95,177,742 74,587 chr14: q gain 0 1 present ,394, ,480,888 86,237 chr15: q loss 0 3 present ,190,548 22,332,237 2,141,689 chr15: q loss 1 14 present ,849,110 22,173,977 1,324,867 chr15: q gain 1 1 present ,168,276 22,578, ,354 chr15: q gain 0 1 present ,406,896 24,587, ,184 chr15: q loss 1 1 present ,727,647 34,795,913 68,266 chr15: q14 12 loss 0 5 present ,048,676 15,120,666 71,990 chr16: p loss 1 1 present ,475,039 21,593, ,592 chr16: p loss 0 2 present ,471,625 33,651,765 1,180,140 chr16: p gain 0 10 present ,472,017 34,744, ,855 chr16: p gain 0 3 present 21
22 ,799,203 55,822,392 23,189 chr16: q loss 0 4 present ,842,389 55,848,225 5,836 chr16: q gain 1 2 present ,155,006 70,193,942 38,936 chr16: q loss 0 2 present ,095,998 72,107,365 11,367 chr16: q gain 1 1 present ,394,080 74,407,341 13,261 chr16: q loss 0 2 present ,538,398 75,572,540 34,142 chr16: q gain 2 1 present ,372,097 78,381,281 9,184 chr16: q loss 1 4 present ,200,264 83,207,885 7,621 chr16: q loss 1 1 present ,747,384 88,763,519 16,135 chr16: q loss 1 1 present ,410,275 10,434,595 24,320 chr17: p gain 2 1 present ,437,475 34,475,514 38,039 chr17: q12 7 gain 0 1 present ,165,726 44,210,822 45,096 chr17: q loss 1 10 present ,093,616 78,109,158 15,542 chr17: q gain 2 1 present ,607,860 20,701,620 93,760 chr19: p12 8 loss 0 2 present ,830,072 20,996, ,845 chr19: p12 31 gain 0 1 present ,847,189 35,861,544 14,355 chr19: q loss 1 2 present ,426,600 50,472,122 45,522 chr19: q gain 4 1 present 22
23 ,136,261 52,148,589 12,328 chr19: q loss 0 2 present ,522,243 53,550,020 27,777 chr19: q gain 0 1 present ,927,854 54,005,410 77,556 chr19: q gain 0 1 present ,730,830 54,742,404 11,574 chr19: q loss 0 2 present ,377,061 6,386,806 9,745 chr19: p gain 1 1 present ,551,034 1,580,958 29,924 chr20: p13 7 gain 1 14 present ,924,636 60,935,883 11,247 chr20: q gain 1 2 present ,861,051 11,056, ,754 chr21: p gain 1 1 present ,133,474 17,340,318 1,206,844 chr22: q loss 3 1 present ,390,255 24,395,353 5,098 chr22: q loss 0 11 present ,664,618 25,919, ,924 chr22: q gain 0 1 present ,332,258 30,360,514 28,256 chr22: q loss 1 1 present ,829,283 35,860,068 30,785 chr22: q gain 0 5 present ,359,112 39,385,485 26,373 chr22: q loss 2 2 present ,896,699 42,949,585 52,886 chr22: q gain 1 4 present 166 X 103,258, ,303,380 44,701 chrx: q gain 1 2 present 167 X 119,037, ,055,778 18,287 chrx: q24 5 gain 1 1 present 23
24 168 X 154, ,113 14,325 chrx: p gain 0 1 present 169 X 154,946, ,226, ,695 chrx: q28 39 gain 2 1 present 170 X 159, ,099 56,669 chrx: p gain 0 2 present 171 X 184, ,823 3,295 chrx: p gain 0 1 present 172 X 52,858,608 52,905,175 46,567 chrx: p gain 1 1 present 173 X 56,093,719 56,098,999 5,280 chrx: p loss 0 1 present 174 X 61, , ,056 chrx: p gain 0 3 present 175 X 62,405,221 62,501,768 96,547 chrx: q gain 0 1 present 176 X 69,956,055 70,045,530 89,475 chrx: q loss 1 1 present 177 X 70, ,113 98,716 chrx: p gain 0 13 present 178 Y 11,091 11, chry: p gain 0 3 present 179 Y 11, , ,618 chry: p gain 0 1 present 180 Y 20, , ,024 chry: p gain 0 6 present 181 Y 9,641,061 9,650,194 9,133 chry: p loss 0 1 present 24
25 Table S4. qpcr analysis of exons of TEX11 isoform 1 (NM_ )
26 Table S5. Polymorphic variants found in AZ patients and controls. DNA change Exon RNA/Protein Patients (%) Controls (%) dbsnp ESP6500 Minor Allele frequency (EU ethnic /AA/Overall) (%) c.389a>g ex5 p.k130r 4.50% 3.1% rs / / c.1351g>a ex15 p.e451k 4.50% 3.1% rs / / c.2541t>c ex27 p.d847d 5.60% 5.20% rs / /6.466 c t>c ex28 intron % 6.77% rs / / c a>t ex28 intron % 6.77% rs / /
Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
Genomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
Nature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
Supplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-
Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary
Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
SUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.5 % SDS-PAGE gel under reducing and non-reducing conditions.
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Global variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
SALSA MLPA KIT P050-B2 CAH
SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Histogram showing hybridization signals for chicken (left) and quail (right) genomic DNA analyzed by Chicken GeneChip (n=3). www.nature.com/nature 1 Supplementary Figure 2. Independent
BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
SALSA MLPA probemix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four probes have been adjusted.
mix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four s have been adjusted. The sex-determining region on chromosome Y (SRY) is the most important
Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation
Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation Hang Yu, 1, 2, a) Wei Han, 1, 3, b) Wen Ma, 1, 2 1, 2, 3, c) and Klaus Schulten 1) Beckman
Structural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
MRC-Holland MLPA. Description version 14; 28 September 2016
SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Supplementary Information. Supplementary Figures
Supplementary Information Supplementary Figures.8 57 essential gene density 2 1.5 LTR insert frequency diversity DEL.5 DUP.5 INV.5 TRA 1 2 3 4 5 1 2 3 4 1 2 Supplementary Figure 1. Locations and minor
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy
SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
MRC-Holland MLPA. Description version 12; 13 January 2017
SALSA MLPA probemix P219-B3 PAX6 Lot B3-0915: Compared to version B2 (lot B2-1111) two reference probes have been replaced and one additional reference probe has been added. In addition, one flanking probe
MRC-Holland MLPA. Description version 07; 26 November 2015
SALSA MLPA probemix P266-B1 CLCNKB Lot B1-0415, B1-0911. As compared to version A1 (lot A1-0908), one target probe for CLCNKB (exon 11) has been replaced. In addition, one reference probe has been replaced
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
MRC-Holland MLPA. Description version 08; 30 March 2015
SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.
MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009
Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009 1 Abstract A stretch of chimpanzee DNA was annotated using tools including BLAST, BLAT, and Genscan. Analysis of Genscan predicted genes revealed
MRC-Holland MLPA. Description version 18; 09 September 2015
SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the
SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.
mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised
gliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
Most severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment).
SALSA MLPA probemix P343-C3 Autism-1 Lot C3-1016. As compared to version C2 (lot C2-0312) five reference probes have been replaced, one reference probe added and several lengths have been adjusted. Warning:
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ),
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
MRC-Holland MLPA. Description version 06; 23 December 2016
SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated
Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
MRC-Holland MLPA. Description version 29; 31 July 2015
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082
RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
MRC-Holland MLPA. Description version 08; 07 May 2015
mix P185-C1 Intersex Lot C1-0611: As compared to the previous version B2 (lot B2-0311), s for CYP21A2 have been removed and s for the CXorf21 gene as well as additional s for NR0B1, NR5A1 and the Y chromosome
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Figure 1
S U P P L E M E N TA R Y I N F O R M AT I O N DOI: 10.1038/ncb2896 Supplementary Figure 1 Supplementary Figure 1. Sequence alignment of TERB1 homologs in vertebrates. M. musculus TERB1 was derived from
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
SUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes
Mouse Clec9a ORF sequence
Mouse Clec9a gene LOCUS NC_72 13843 bp DNA linear CON 1-JUL-27 DEFINITION Mus musculus chromosome 6, reference assembly (C57BL/6J). ACCESSION NC_72 REGION: 129358881-129372723 Mouse Clec9a ORF sequence
Role of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
Anti-Lamin B1/LMNB1 Picoband Antibody
Anti-Lamin B1/LMNB1 Picoband Antibody Catalog Number:PB9611 About LMNB1 Lamin-B1 is a protein that in humans is encoded by the LMNB1 gene. The nuclear lamina consists of a two-dimensional matrix of proteins
Effec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers
Effec
Determination of Genomic Imbalances by Genome-wide Screening Approaches
Overview Determination of Genomic Imbalances by Genome-wide Screening Approaches Károly Szuhai Introduction/Methodologies Applications/Results Conclusion Approaches Introduction/Methodologies Chromosome
So where were we? But what does the order mean? OK, so what's a protein? 4/1/11
So where were we? We know that DNA is responsible for heredity Chromosomes are long pieces of DNA DNA turned out to be the transforming principle We know that DNA is shaped like a long double helix, with
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.
SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:
MRC-Holland MLPA. Description version 30; 06 June 2017
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0517, C1-0114. As compared to the previous B2 version (lot B2-0813, B2-0912), 11 target probes are replaced or added, and 10 new reference probes are
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the
Activities for the α-helix / β-sheet Construction Kit
Activities for the α-helix / β-sheet Construction Kit The primary sequence of a protein, composed of amino acids, determines the organization of the sequence into the secondary structure. There are two
SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A
SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity
Supplementary Figure 1 Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity (a, b) Fluorescent-based determination of the binding capacity of DNA-barcoded MHC multimers (+barcode)
Pepsin Solution ready-to-use
SIE HABEN DIE VISION, WIR HABEN DIE SUBSTANZ. Pepsin Solution Single component Pepsin Solution: only one component refrigerator stable Pepsin is a commonly used digestive enzyme for immunohistochemical
Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
Name Animal source Vendor Cat # Dilutions
Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)
X-Linked TEX11 Mutations, Meiotic Arrest, and Azoospermia in Infertile Men
Original Article X-Linked TEX11 Mutations, Meiotic Arrest, and Azoospermia in Infertile Men Alexander N. Yatsenko, M.D., Ph.D., Andrew P. Georgiadis, B.A., Albrecht Röpke, Ph.D., Andrea J. Berman, Ph.D.,
Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
HRP cytochemistry. Division of Radiooncology, Deutsches Krebsforschungszentrum, Heidelberg, Germany
HRP cytochemistry WOLF D. KUHLMANN, M.D. Division of Radiooncology, Deutsches Krebsforschungszentrum, 69120 Heidelberg, Germany A range of substrates is available for the cytochemical staining of peroxidase
a Control IgG Intestine c Testis b Thymus 1 3 2 S S 2 1 3 4 4 Figure S1 The wild-type mouse (C57BL/6J) organs (intestine, thymus and testis) were frozen in liquid nitrogen and sectioned at 5 µm on a cryostat.
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
Supplementary Materials and Methods
Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
P323-B1 CDK4-HMGA2-MDM2
SALSA MLPA probemix P323-B1 CDK4-HMGA2-MDM2 Lot B1-0714, B1-0711. As compared to previous test version (lot A1-0508), this probemix has been completely redesigned. Probes for HMGA2 and several other genes
Supplementary Figures
Supplementary Figures Supplementary Figure 1. nrg1 bns101/bns101 embryos develop a functional heart and survive to adulthood (a-b) Cartoon of Talen-induced nrg1 mutation with a 14-base-pair deletion in
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Absence of Kaposi s Sarcoma-Associated Herpesvirus in Patients with Pulmonary
Online Data Supplement Absence of Kaposi s Sarcoma-Associated Herpesvirus in Patients with Pulmonary Arterial Hypertension Cornelia Henke-Gendo, Michael Mengel, Marius M. Hoeper, Khaled Alkharsah, Thomas
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022
96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo
Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
FONS Nové sekvenační technologie vklinickédiagnostice?
FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
Int J Clin Exp Pathol 2017;10(3): /ISSN: /IJCEP
Int J Clin Exp Pathol 2017;10(3):3671-3676 www.ijcep.com /ISSN:1936-2625/IJCEP0046381 Original Article Comparison of immunofluorescence and immunohistochemical staining with anti-insulin antibodies on
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/3/eaaq0762/dc1 Supplementary Materials for Structures of monomeric and oligomeric forms of the Toxoplasma gondii perforin-like protein 1 Tao Ni, Sophie I. Williams,