Supplemental Data. Hiruma et al. Plant Cell. (2010) /tpc Col-0. pen2-1
|
|
- Nora Hood
- 5 years ago
- Views:
Transcription
1 A Ch B Col-0 Cg pen2-1 Supplemental Figure 1. Trypan Blue Staining of Leaves Inoculated with Adapted and Nonadapted Colletotrichum Species.(A) Conidial suspensions of C. higginsianum MAFF (Ch) were drop-inoculated on A. thaliana Col-0. (B) Conidial suspensions of C. gloeosporioides S9275 (Cg) were drop-inoculated on A. thaliana pen2-1 mutant. Inoculated plants were incubated for 60 h and stained with lactophenol trypane blue. Bar = 50 μm. 1
2 A B C 0.1% Glucose 0.1% Sorbitol 0.1% Sucrose 0.1% Sucrose 0.1% Sorbitol Supplemental Figure 2. The Effects of Sorbitol and Sucrose on Pathogenicity of Cg to the pen2 Mutant Plants. (A) Sorbitol did not enhance lesion development by Cg on the pen2 mutant. Conidial suspensions of Cg were drop-inoculated on the pen2-1 mutant with 0.1 % glucose, 0.1 % sorbitol, or 0.1 % sucrose. Inoculated plants were incubated for 7 days. (B) Sorbitol did not affect infection-related morphogenesis of Cg. Conidial suspensions of Cg expressing RFP were inoculated on A. thaliana Col-0 with 0.1 % sucrose or 0.1 % sorbitol. Inoculated plants were incubated for 18 h, and infection-related morphogenesis of Cg was investigated by a confocal microscopy. Arrows indicate appressoria. Bars = 50 μm. 2
3 Control 0.1% Glucose Supplemental Figure 3. The Adapted C. higginsianum Develops Melanized Appressoria in the Presence of Glucose. Conidial suspensions of C. higginsianum with 0.1% glucose were inoculated on A. thaliana Col-0, and inoculated plants were incubated for 16 h. As a control, conidial suspensions of C. higginsianum were inoculated without glucose. Bars = 10 μm. 3
4 Carpropamid - + Supplemental Figure 4. Standard Cg Infection on the pen2 Mutant in the Presence of Carpropamid. Conidial suspensions of Cg without the addition of glucose were inoculated on the pen2 mutant with carpropamid. Inoculated plants were incubated for 4 days. Cg developed slight lesions on the pen2 muatnt in the presence of carpropamid the same as Cg without carpropamid. 4
5 Plant surface C Intracellular Ih Intracellular Supplemental Figure 5. Plasmolysis Assay on Arabidopsis Cells Invaded by Cg via HTE. Conidia of Cg expressing RFP were inoculated on the pen2 mutant expressing PEN1-GFP. At 13 hpi, inoculated leaves were treated with 0.85 M NaCl for 10 min. Arrowheads indicate plasma membrane of an epidermal cell invaded by Cg. C, Conidium; Ih, Intracellular hypha. Bars = 10 μm. 5
6 A B Plant surface Intracellular a c ih a c ih Supplemental Figure 6. Cg Develops Intracellular Hyphae underneath Melanized Appressoria on the Host Plant Mulberry. (A) Formation of melanized appressorium by Cg on the host plant mulberry. Conidial suspensions of Cg were inoculated on leaves of mulberry (Morus alba) and inoculated leaves were incubated for 24 hrs. Arrows indicate melanized appressoria of Cg. Bar = 50 μm. (B) Melanized appressoria of Cg invaded the mulberry leaves. Conidial suspensions of Cg were inoculated on mulberry leaves, and inoculated leaves were incubated for 60 hrs. Left photos focused on fungal structures formed on plant surface (Plant surface), whereas right photos focused on intracellular hypha (Intracellular). Bars = 10 μm. a, appressorium; c, conidium; ih, intracellular hypha. 6
7 Supplemental Figure 7. Amino Acid Sequence of C. orbiculare Mtk1. The deduced amino acid sequence of C. orbiculare (Co) Mtk1 was aligned with a putative fungal MAPKKK Mck1 (MGG_00883) of Magnaporthe oryzae (Mo) by using the CLUSTAL W program. Similar residues are shown on gray backgrounds. Gaps introduced for alignment are indicated by dashes. 7
8 A 104-T (WT) SCD1REP1-1 (scd1) DMA5 (maf1) B DMT1 (mtk1) WT maf1 WT mtk1 WT scd1 Supplemental Figure 8. The mtk1 Mutant Exhibits Reduced Pathogenicity. (A) Colony phenotype of the mtk1 mutant. The wild-type strain 104-T of C. orbiculare, the mtk1 mutant DMT1, the maf1 mutant DMA5, the scd1 mutant SCD1REP1-1 were grown on potato dextrose agar medium for 1 week. (B) Inoculation assay of the mtk1 mutant on the host plants. Conidial suspensions of tested fungal strains were drop-inoculated on the right side of cucumber cotyledons. As a control, conidial suspensions of the wild-type strain 104-T were inoculated on the left side. Inoculated plants were incubated for 7 days. The mtk1 mutant shows significant reduction in pathogenicity. 8
9 A 104-T (WT) DMA5 (maf1) DMT1 (mtk1) SCD1REP1-1 (scd1) B 104-T (WT) DMA5 (maf1) DMT1 (mtk1) SCD1REP1-1 (scd1) Supplemental Figure 9. Inoculation Assay of C. orbiculare Pathogenicty Mutants on the Arabidopsis pen2 Mutant. (A) Infection-related morphogenesis of C. orbiculare pathogenicity mutants. Conidial suspension of each strain was incubated on glass for 12 h. The mtk1 mutant DMT1 failed to form appressoria, which is similar to the phenotype of the maf1 mutant DMA5. The scd1 mutant SCD1REP1-1 forms colorless (non-melanized) appressoria. Bars = 20 μm. (B) Inoculation assay on the pen2 mutant. Conidial suspensions of each strain were drop-inoculated on A. thaliana pen2-1 mutant. Inoculated plants were incubated for 4 days. 9
10 Supplemental Table 1. Primers Used for Quantitative RT-PCR Gene Primer name Sequence Actin2 Actin2f ACCTTGCTGGACGTGACCTTACTGAT Actin2 Actin2r GTTGTCTCGTGGATTCCAGCAGCTT PEN2 PEN2f TAACATGCTTCTAGCGCACGCAG PEN2 PEN2r CATCTGGATCACTCGGATCATATG PEN3 PEN3f GGTGTTAAGAACAGTCTCGTCAC PEN3 PEN3r TCTTCTGACCTCCAGATATACC CYP79B2 CYP79B2f AGGCAACCCATTGCTTACCGCC CYP79B2 CYP79B2r CCATTGCTTTACGGAGAATCTC CYP81F2 CYP81F2f ATTGTCCGCATGGTCACAGGGAG CYP81F2 CYP81F2r GTAGCCGTGTCCGAACACTTTAAG 10
Supplemental Data. Beck et al. (2010). Plant Cell /tpc
Supplemental Figure 1. Phenotypic comparison of the rosette leaves of four-week-old mpk4 and Col-0 plants. A mpk4 vs Col-0 plants grown in soil. Note the extreme dwarfism of the mpk4 plants (white arrows)
More informationEarly Stages of Infection of Lily Leaves by Botrytis elliptica and B. cinerea
Plant Pathology Bulletin 12:103-108, 2003 Early Stages of Infection of Lily Leaves by Botrytis elliptica and B. cinerea Ping-Fu Hou 1 and Chao-Ying Chen 1,2 1 Department of Plant Pathology, National Taiwan
More informationSupplemental Data. Wu et al. (2010). Plant Cell /tpc
Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),
More informationSupplemental Information. Spatial Auxin Signaling. Controls Leaf Flattening in Arabidopsis
Current Biology, Volume 27 Supplemental Information Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis Chunmei Guan, Binbin Wu, Ting Yu, Qingqing Wang, Naden T. Krogan, Xigang Liu, and Yuling
More informationSerafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
More informationSupplemental Data. Wang et al. (2013). Plant Cell /tpc
Supplemental Data. Wang et al. (2013). Plant Cell 10.1105/tpc.112.108993 Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on
More informationTropentag 2012, Göttingen, Germany September 19-21, 2012
Tropentag 2012, Göttingen, Germany September 19-21, 2012 Conference on International Research on Food Security, Natural Resource Management and Rural Development organised by: Georg-August Universität
More informationSupplementary Figures
Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis
More information33VASTVNGATSANNHGEPPS51PADARPR58
Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation
More informationSupplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationFigure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded
More informationSupplemental Data. Hao et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Confocal Images and VA-TIRFM Analysis of GFP-RbohD in Arabidopsis Seedlings. (A) RbohD expression in whole Arabidopsis seedlings. RbohD was expressed in the leaves, hypocotyl, and
More informationSupplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
More informationEpidemiology of Gray Leaf Spot of Perennial Ryegrass Philip Harmon and Richard Latin. Objective
Epidemiology of Gray Leaf Spot of Perennial Ryegrass Philip Harmon and Richard Latin Objective Rationale The continuing objective of this research is to investigate the environmental factors that influence
More informationA STUDY ON THE DISEASE RESISTANCE IN HEVEA BRASILIENSIS
. - A STUDY ON THE DISEASE RESISTANCE IN HEVEA BRASILIENSIS TO COLLETOTRICHUM GLOEOSPORIOIDES A thesis submitted to the Faculty of Applied Science, University of Sri Jayawardenapura, Sri Lanka for the
More informationFigure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei.
Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. (B) The standard curve for lysine concentrations versus OD600 values
More informationSupplemental Information. Figures. Figure S1
Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the
More informationSupporting Information
Supporting Information Harries et al. 1.173/pnas.9923916 A Fig. S1. Disruption of microfilaments within epidermal cells after treatment with 5 M Lat. Images of N. benthamiana cells are from plants expressing
More informationColletotrichum gloeosporioides, the causal agent of citrus anthracnose in Guizhou Province
Colletotrichum gloeosporioides, the causal agent of citrus anthracnose in Guizhou Province Jiang YL, Tan P, Zhou XY, Hou XL and Wang Y* Department of Plant Pathology, Guizhou University, Guiyang, Guizhou,
More informationPome Fruit Diseases IOBC/wprs Bull. 29(1), 2006 pp
Pome Fruit Diseases IOBC/wprs Bull. 29(1), 2006 pp. 123-127 Screening of organically based fungicides for apple scab (Venturia inaequalis) control and a histopathological study of the mode of action of
More informationThe N-end rule pathway regulates pathogen responses. in plants
SUPPLEMENTARY INFORMATION The N-end rule pathway regulates pathogen responses in plants Rémi de Marchi 1,2, Maud Sorel 1, Brian Mooney 1, Isabelle Fudal 3, Kevin Goslin 1, Kamila Kwaśniewska 4, Patrick
More informationOpen Flower. Juvenile leaf Flowerbud. Carpel 35 NA NA NA NA 61 NA 95 NA NA 15 NA 41 3 NA
PaxDB Root Juvenile leaf Flowerbud Open Flower Carpel Mature Pollen Silique Seed Sec3a Sec3b Sec5a Sec5b Sec6 Sec8 Sec10a/b Sec15a Sec15b Exo84a Exo84b Exo84c Exo70A1 Exo70A2 Exo70A3 49 47 8 75 104 79
More informationSupplementary Figure 1
S U P P L E M E N TA R Y I N F O R M AT I O N DOI: 10.1038/ncb2896 Supplementary Figure 1 Supplementary Figure 1. Sequence alignment of TERB1 homologs in vertebrates. M. musculus TERB1 was derived from
More informationSupplementary Information
Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding
More informationInfluenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
More informationSUPPLEMENTARY INFORMATION
Supplementary igure 1. The expression level of PP4 (At4g16860) is diminished in the rpp4 mutant (SK017569). The mna was extracted to analyze the expression level of PP4 using quantitative PC (qpc). Gene
More informationEpidemiological Research on Botrytis Diseases of Tulip Plants Caused by B. tulipae and B. cinerea
Epidemiological Research on Botrytis Diseases of Tulip Plants Caused by and B. cinerea Kie Yamada, Takeharu Aoki, Chiharu Ikeda, Yukari Ichiman, Yuji Kanno, Tomohiro Suzuki, Hirotaka Nagashima, Masami
More informationSupplemental data. Uppalapati et al. (2012) Plant Cell /tpc
PAL Control P. emaculata 0 8 24 48 8 24 48 OPR Control P. emaculata 0 8 24 48 8 24 48 CHS PR3 CHR PR5 CHI PR10 IFS IFR Supplemental Figure 1. Expression profiles for selected genes in phenylpropanoid pathway
More informationSupporting Information
Supporting Information Lee et al. 10.1073/pnas.0910950106 Fig. S1. Fe (A), Zn (B), Cu (C), and Mn (D) concentrations in flag leaves from WT, osnas3-1, and OsNAS3-antisense (AN-2) plants. Each measurement
More informationProgress in Biological Sciences Mahdieh S. Hosseini-Moghaddam ; Jalal Soltani ABSTRACT Key Words
Progress in Biological Sciences Vol. 3, Number 2, Summer/Fall 2013/135-143 An investigation on the effects of photoperiod, aging and culture media on vegetative growth and sporulation of rice blast pathogen
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationJ. Cell Sci. 129: doi: /jcs : Supplementary information
Movie 1. AgLDL is contained in small sub-regions of the lysosomal synapse that are acidic. J774 cells were incubated with agldl dual labeled with a ph sensitive and a ph insensitive fluorophore for 1 hr.
More informationMIDHILA PADMAN and JANARDHANA G R*
Inhibitory effect of essential oils on the growth of Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. the causal organism of leaf spot disease of Murraya koenigii L MIDHILA PADMAN and JANARDHANA G
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationSupplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
More informationRole of constitutive and induced defences in the resistance of unripe mangoes to Colletotrichum
Role of constitutive and induced defences in the resistance of unripe mangoes to Colletotrichum gloeosporioides Nimal Adikaram, Ganga Sinniah, Chathurika Karunanayake and Charmalie Abayasekara Department
More informationSupplemental Data. Müller-Xing et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Phenotypes of iclf (clf-28 swn-7 CLF pro :CLF-GR) plants. A, Late rescue of iclf plants by renewed DEX treatment; senescent inflorescence with elongated siliques (arrow; 90 DAG,
More informationHost-Induced Gene Silencing in the Fusarium-Wheat interaction. Wanxin Chen and Patrick Schweizer
Host-Induced Gene Silencing in the Fusarium-Wheat interaction Wanxin Chen and Patrick Schweizer What is Host-Induced Gene Silencing (HIGS)? Fungus Bgh Trujillo et al. (2004) MPMI HIGS: HI reduced GAME
More informationSupplemental Figure S1.
53 kda- WT TPS29.2 (ethanol) TPS29.2 (water) Supplemental Figure S1. Inducible expression of E. coli otsa (TPS) in Arabidopsis. Immunoblot of leaf proteins (20 µg per lane) extracted from: (i) WT Col-0,
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
More informationSUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
More informationEffect of Crude Extract from Bacillus Subtilis LB5 Cultivated Broth on Conidial Germination of Colletotrichum Gloeosporioides
Effect of Crude Extract from Bacillus Subtilis LB5 Cultivated Broth on Conidial Germination of Colletotrichum Gloeosporioides Onuma Ruangwong, and Wen-Jinn Liang Abstract Bacillus subtilis strain LB5 produced
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationNature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
More informationMoTea4-Mediated Polarized Growth Is Essential for Proper Asexual Development and Pathogenesis in Magnaporthe oryzae
EUKARYOTIC CELL, July 2010, p. 1029 1038 Vol. 9, No. 7 1535-9778/10/$12.00 doi:10.1128/ec.00292-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. MoTea4-Mediated Polarized Growth
More informationThe Ras GTPases are membrane-associated binary switches that
Plasma Membrane Localization Is Required for RasA-Mediated Polarized Morphogenesis and Virulence of Aspergillus fumigatus Jarrod R. Fortwendel, f Praveen R. Juvvadi, a Luise E. Rogg, a Yohannes G. Asfaw,
More informationSuppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationInhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors
Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors Ka-Cheuk Liu, Gunter Leuckx, Daisuke Sakano, Philip A. Seymour, Charlotte L. Mattsson, Linn Rautio, Willem Staels, Yannick Verdonck,
More informationJyoti Shah, Vamsi Nalam, Sujon Sarowar, Syeda Alam, Sumita Behera, Hyeonju Lee, Delia Burdan and Harold N. Trick
Targeting Host Defense and Susceptibility Mechanisms for Engineering FHB Resistance Jyoti Shah, Vamsi Nalam, Sujon Sarowar, Syeda Alam, Sumita Behera, Hyeonju Lee, Delia Burdan and Harold N. Trick General
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
More informationSupplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
More informationTable S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
More informationSupplementary Figure 1. Gene expression analysis of GSNOR1 and NIA2 in genotypes with altered NO signalling. Relative expression of GSNOR1 in leaves
Supplementary Figure 1. Gene expression analysis of GSNOR1 and NIA2 in genotypes with altered NO signalling. Relative expression of GSNOR1 in leaves (a) and roots (b) and NIA2 in leaves (c) and roots (d)
More informationNear-infrared fluorescent proteins
nature methods Near-infrared fluorescent proteins Dmitry Shcherbo, Irina I Shemiakina, Anastasiya V Ryabova, Kathryn E Luker, Bradley T Schmidt, Ekaterina A Souslova, Tatiana V Gorodnicheva, Lydia Strukova,
More informationEvaluation of an alternative slide culture technique for the morphological identification of fungal species
Research Article Evaluation of an alternative slide culture technique for the morphological identification of fungal species Abstract M H Wijedasa 1, L V C Liyanapathirana 1. Sri Lanka Journal of Infectious
More informationA NOVEL INOCULATION METHOD FOR EVALUATION OF GREY LEAF SPOT RESISTANCE IN ITALIAN RYEGRASS
Journal of Plant Pathology (2009), 91 (1), 171-176 Edizioni ETS Pisa, 2009 171 A NOVEL INOCULATION METHOD FOR EVALUATION OF GREY LEAF SPOT RESISTANCE IN ITALIAN RYEGRASS W. Takahashi 1, Y. Miura 2 and
More informationFIG S1 Replication rates of S. suis strain 10, 10Δsly, and 10cpsΔEF on mono- and virus pre-infected porcine PCLS.
A strain 10 10cps EF B strain 10 H1N1 + strain 10 10cps EF H1N1 + 10cps EF 10 8 10 sly 10 7 H3N2 + strain 10 H3N2 + 10cps EF CFU/ml media 10 7 10 6 10 5 10 4 CFU/ml media 10 6 10 5 10 4 10 3 0 2 4 8 12
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationSupplements. Figure S1. B Phalloidin Alexa488
Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
More informationDetection of Sensitivity and Resistance Variation of Magnaporthe grisea to Kitazin P, Carbendazim and Tricyclazole
Rice Science, 2004, 11(5-6): 317-323 317 http://www.ricescience.org Detection of Sensitivity and Resistance Variation of Magnaporthe grisea to Kitazin P, Carbendazim and Tricyclazole ZHANG Chuan-qing 1,
More informationCHAPTER II THE EFFECT OF TEMPERATURE AND CULTURE MEDIUM ON THE GROWTH AND SPORULATION OF DRECHSLERA CATENARIA
CHAPTER II THE EFFECT OF TEMPERATURE AND CULTURE MEDIUM ON THE GROWTH AND SPORULATION OF DRECHSLERA CATENARIA 61 \ INTRODUCTION Sporulation and growth of fungi are affected by light, temperature, relative
More informationTumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
More informationExercise 15-B PHYSIOLOGICAL CHARACTERISTICS OF BACTERIA CONTINUED: AMINO ACID DECARBOXYLATION, CITRATE UTILIZATION, COAGULASE & CAMP TESTS
Exercise 15-B PHYSIOLOGICAL CHARACTERISTICS OF BACTERIA CONTINUED: AMINO ACID DECARBOXYLATION, CITRATE UTILIZATION, COAGULASE & CAMP TESTS Decarboxylation of Amino Acids and Amine Production The decarboxylation
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationIn Vivo Imaging of Virological Synapses
In Vivo Imaging of Virological Synapses Xaver Sewald 1, David G. Gonzalez 2, Ann M. Haberman 2, and Walther Mothes 1 * 1 Department of Microbial Pathogenesis, Yale University School of Medicine, New Haven,
More informationBiological control of aquatic weeds by Plectosporium alismatis
Biological control of aquatic weeds by Plectosporium alismatis, a potential mycoherbicide in Australian rice crops: comparison of liquid culture media for their ability to produce high yields of desiccation-tolerant
More informationSupplemental Figure S1. The number of hydathodes is reduced in the as2-1 rev-1
Supplemental Data Supplemental Figure S1. The number of hydathodes is reduced in the as2-1 rev-1 and kan1-11 kan2-5 double mutants. A, The numbers of hydathodes in different leaves of Col-0, as2-1 rev-1,
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationSupplemental Data. Candat et al. Plant Cell (2014) /tpc Cytosol. Nucleus. Mitochondria. Plastid. Peroxisome. Endomembrane system
Cytosol Nucleus 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 PSORT MultiLoc YLoc SubLoc BaCelLo WoLF PSORT
More informationNature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
More informationCloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College
Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation Sarah J. MacDonald Assistant Professor Missouri Valley College Phytoremediation of Organic Compounds Phytodegradation: Plants
More informationSupplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
More informationNature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
More informationTyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis
Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato
More informationSupporting Information
Supporting Information Fig. S1. Overexpression of Rpr causes progenitor cell death. (A) TUNEL assay of control intestines. No progenitor cell death could be observed, except that some ECs are undergoing
More informationRegulation of Pathogenic Spore Germination by CgRac1 in the Fungal Plant Pathogen Colletotrichum gloeosporioides
EUKARYOTIC CELL, Aug. 2011, p. 1122 1130 Vol. 10, No. 8 1535-9778/11/$12.00 doi:10.1128/ec.00321-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Regulation of Pathogenic Spore
More informationPrimer DNA sequence (5 to 3 )
Supplemental Table 1 Oligonucleotide primers used in the study Primer DNA sequence (5 to 3 ) Plasmodium falciparum 18s forward Plasmodium falciparum 18s reverse Plasmodium falciparum MSP1 forward Plasmodium
More informationThe Pennsylvania State University. The Graduate School. College of Agricultural Sciences FACTORS INFLUENCING THE DEVELOPMENT OF GRAY LEAF SPOT OF
The Pennsylvania State University The Graduate School College of Agricultural Sciences FACTORS INFLUENCING THE DEVELOPMENT OF GRAY LEAF SPOT OF PERENNIAL RYEGRASS TURF AND SEASONAL AVAILABILITY OF THE
More informationMANAGEMENT OF POWDERY MILDEW DISEASE OF RAMBUTAN (Nephelium lappaceum L.) IN SRI LANKA ABSTRACT
September 2006 MANAGEMENT OF POWDERY MILDEW DISEASE OF RAMBUTAN (Nephelium lappaceum L.) IN SRI LANKA R. G. A. S. Rajapakse 1, E. R. S. P. Edirimanna 1 and J. Kahawatta 1 ABSTRACT Powdery mildew disease
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationGFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin
Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationSupplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
More informationSupplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature
Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,
More informationA putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus
Supplementary figures for: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis Daisuke Tsugama, Kohei Matsuyama, Mayui Ide, Masato Hayashi, Kaien Fujino, and
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG
More informationSupporting Information
Supporting Information Dauvillée et al. 10.1073/pnas.0907424106 Fig. S1. Iodine screening of the C. cohnii mutant bank. Each single colony was grown on rich-medium agar plates then vaporized with iodine.
More informationA -GLS Arabidopsis Cuscuta gronovii
-GLS Arabidopsis Cuscuta gronovii internal standard 4MS Wildtype Arabidopsis Cuscuta gronovii base Cuscuta gronovii apex 3MSP internal standard MSP 4MT 8MSO 4MO 1MO Figure S1. Representative HPLC-DAD chromatograms
More informationSupplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24
Current Biology, Volume 24 Supplemental Information Autophagy in Oncogenic K-Ras Promotes Basal Extrusion of Epithelial Cells by Degrading S1P Gloria Slattum, Yapeng Gu, Roger Sabbadini, and Jody Rosenblatt
More informationFloral Organ Mutants and the Study of Organ Morphogenesis
Floral Organ Mutants and the Study of Organ Morphogenesis Objectives: 1. How does one use mutants to understand floral organ morphogenesis? 2. What are the phenotypes of some floral organ mutants? 3. What
More informationSupplemental Data. Deinlein et al. Plant Cell. (2012) /tpc
µm Zn 2+ 15 µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant
More information