Figure S1. A Non-lesional Lesional
|
|
|
- Edwina Miller
- 5 years ago
- Views:
Transcription
1 Figure S1 Non-lesional Lesional GEN1 Non-lesional GEN1 Lesional C Normal Negative control Figure S1. Dermal Populations of + cells are found in human skin. Immunohistochemistry for on fixed, frozen skin sections of () non-lesional and lesional classical psoriasis, () non-lesional and lesional skin from patient GEN1, with a confirmed over-active mutation in (Jordan CT et al, m J Hum Genet, 212 May 4;9(5):784; PMID ), and (C) normal human skin. Lower right image is the negative staining control, performed in classical psoriasis lesional skin. rrows point to dermal + cells. Representative images are shown, bar = 1μm.
2 Figure S2 Normal CD3 CD11c CD163 CD31 CD3 and CD11c and CD163 and CD31 and Non-lesional CD3 CD11c CD163 CD31 CD3 and CD11c and CD163 and CD31 and Figure S2. Dermal is expressed in endothelial cells in normal and non-lesional skin. Two color immunofluroscence on frozen skin sections of () normal and () non-lesional skin demonstrates that (red) does not colocalize with various cell markers (green); CD3 (T-cells), CD11c (dendritic cells), and CD163 (macrophages), but does colocalize with CD31 + endothelial cells (green) in both normal and non-lesional skin. Representative images shown; bar = 1μm.
3 Figure S3 Vimentin (Fibroblasts/stromal cells) Normal Non-Lesional Lesional Vimentin Vimentin Vimentin Vimentin and Vimentin and Vimentin and Lesional Vimentin Vimentin and and CD31 CD31 Figure S3. Dermal colocalizes with vimentin + CD31 + cells. () Two-color immunofluroscence demonstrates (red) colocalizes with some vimentin (green) cells in normal, non-lesional, and lesional skin. () Triple-color immunofluroscence staining in lesional skin demonstrates that the dermal + (red) and vimentin + (green), colocalize with the CD31 + endothelial cells (blue). Representative image shown; bar = 1μm.
4 Figure S4 Non-lesional aorta Lesional aorta Negative Control Non-lesional aorta Lesional aorta CD31 CD31 CD31 and CD31 and Figure S4. is also expressed in aortic endothelial cells. () Immunohistochemistry for on fixed, frozen sections of aorta, obtained from cadavers with athelerosclerotic disease, classified as nonlesional (normal apearing) or lesional (atherlosclerotic) based on macroscopic observation. Negative control shown far right. () Two-color immunofluroscence for CD31 (green) and (red) in aorta. Representative images are shown; bar = 1μm.
5 Figure S5 NIH.PS.1 GEN1 WU.PS.1 RU.PS.1 RU.PS.2 Published Psoriasis Gene Sets Enriched in GEN1 ( mutation) LS vs NL Transcriptome Published Psoriasis Gene Sets Enriched in NIH( mutation) LS vs post-rx Transcriptome Figure S5. Transcriptomic profile of patients with muations. () Principle Component nalysis (PC) for the gene expression of normal, LS, and NL or post-treatment biopsies of patients with confirmed mutations (GEN1 and NIH.PS.1) and classical psoriasis (RU and WU samples). () Gene Set Enrichment nalysis (GSE) of published psoriasis upregulated and downregulated transcriptomes (DEGs) compared to gene expression profile of patients with confirmed mutations. cs = connectivity score. dditional information on bioinfomatics is located in the Material and Methods
6 Figure S6. therosclerosis Signaling LPS/IL-1 Mediated Inhibition of RXR Function Pathogenesis of Multiple Sclerosis IL-17 Signalling in Gastric Cells Role of IL-17 in Psoriasis Role of Hypercytokinemia/hyperchemokinemia in the Pathogenesis of Influenza MD3 NIH (LS-POST) GEN1 (LS-NL) Role of Macrophages, Fibroblasts, and Endothelial Cells in Rheumatoid rthritis IL-1 Signalling Interferon Signalling Color Key 1 1 Row Z Score WU.HD.13N N WU.HD.11N N Normal_2 N Normal_1 N WU.PSO.1_PN NL NL_9 GEN1 GEN1_PN NL_51 NIH Pustular_posttreat WU.PSO.1_PP NIH GEN1 NL NL NL POSTLS LS LS LS LS Pustular_pretreat GEN1_PP LS_1 LS_52 ail17effectw2_psoriasis Up MD3 Psoriasis Down RHE IL17 Down KC IL17 nottnf Down KC IL17andTNF Down KC IL17 nottnf Up KC TNF notil17 Up Synergistic IL17andTNFa KC KC TNF notil17 Down KC IL1 Up Synergistic IL17andIL22 KC KC IL17andTNF Up dditive IL17andTNFa KC RHE IL17 Up KC IL1 Down dditive IL17andIL22 KC MD3 Psoriasis Up ail17effectw2_psoriasis Down Figure S6. Transcriptomic profile of patients with mutations. () Ingenuity Pathway nalysis (IP), showing biological pathways significantly upregulated in both classical psoriasis (MD3) as well as patients with confirmed mutations. () Heat map of cyotkine GSV (gene set variation analysis)- derived scores in normal, LS, and NL or post-treatment biopsies of patients with confirmed mutations (GEN1 and NIH.PS.1) and classical psoriasis. dditional information on bioinformatics is located in the Materialsand Methods.
7 Figure S7 IL-8 CXCL1 CXCL fl sh fl p =.13 sh fl sh fl sh CCL fl sh CCL5 Figure S7. Transfection of psoriasis-associated mutations into dermal endothelial cells resulted in increased expression of several chemokines. Quantitative RT-PCR for various chemokines in endothelial cells transfected with wild-type (full-length (fl) and short (sh) )(white), or psoriasis-associated mutation constructs: (gray) and (black). N= 3 per group. Error bars represent the standard error of the mean.
8 Figure S8 E-selectin P-selectin ICM VCM fl sh fl sh fl sh fl sh WT C 1 E-selectin 6 P-selectin 2 ICM 25 VCM MFI MFI 4 2 MFI MFI WT Tx Tx WT Tx Tx WT Tx Tx WT Tx Tx Figure S8. Minimal upregulation of cell adhesion molecule protein expression on transfected HDECs. () qrt-pcr analysis of E-selectin, P-selectin, ICM, and VCM on wild-type (fl and sh) transfected HDECs, or HDECs transfected with psoriasis associated mutations ( and ). Expression is presented as relative to the housekeeping gene, hrp. N = 2-3 per group. Error bars represent the standard error of the mean. () and (C) Expanded HDECs transfected with the wild-type or the psoriasis-associated mutation (N=1) were stimulated with TNF-alpha overnight and then assessed for cell surface protein expression of adhesion molecules by flow cytometry; () histograms and (C) corresponding mean fluroscence intensity (MFI) are shown.
9 Figure S PS IL-8 IL-17 TNFa IFNg IL-17+TNFa IL-17+IFNg PS IL-17 CXCL1 TNFa IFNg IL-17+TNFa IL-17+IFNg CXCL PS IL-17 TNFa IFNg IL-17+TNFa IL-17+IFNg CCL2 CCL PS IL-17 TNFa IFNg IL-17+TNFa IL-17+IFNg PS IL-17 TNFa IFNg IL-17+TNFa IL-17+IFNg Figure S9. Psoriatic cytokines upregulate chemokines in dermal blood endothelial cells. Human dermal blood endothelial cells were cultured with either vehicle control (PS), IL-17 (1ng/ml), TNF-alpha (2ng/ml), IFN-gamma (2ng/ml), or combinatations. RN was isolated after 12 hours of exposure to cytokines, and expression of various chemokines was determined using qrt-pcr (as described in the materials and methods). Error bars represent the standard error of the mean. Significance was determined by comparison of cytokine treatment versus PS, p <.5, p <.1 using a paired t-test. N=3.
10 Figure S1 Figure S1. Single stained flurochrome slide controls for triple-color immunofluroscence studies. Representative images of each single-flurochrome stained sample using the the green, red, or blue laser are shown at 2X.
11 Table S1: ntibodies used for immunohistochemistry/immunofluorescence ntigen Manufacturer Clone a Dilutio n mplification/detection (secondary antibodies) Sigma-ldrish Rabbit polyclonal 1:6 Goat anti-rabbit Ig rhodamine red CD3 D SK7 1:1 Goat anti-mouse IgG1-488 CD11c D -ly6 1:1 Goat anti-mouse IgG1-488 CD163- cris 5C6-FT 1:1 Goat anti-mouse IgG FITC FITC Vimentin Thermo Scientific b2 1:1 Goat anti-mouse IgG1-488 CD31 D WM59 1:1 Goat anti-mouse IgG1-488 or -647 PL-E abcam ab8853 1:5 Goat anti-mouse IgG1-488 LYVE-1 R&D :2 Goat anti-mouse IgG1-488 pnfk Santa Cruz Rabbit 1:1 Zenon conjugated -647 (ser276) polyclonal CXCL1 cris Rabbit polyclonal 1:1 Goat anti-rabbit Ig rhodamine red CCL2 Novus MN1 1:1 Zenon conjugated -568 iologicals CCL5 abcam VL-1 1:2 Goat anti-mouse IgG2b a ll antibodies are murine monoclonal unless otherwise stated.
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).
Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production
Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.
T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8
Nature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
Supporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages
Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,
Supplementary Information
Supplementary Information Supplementary Figure 1. Short-term coreceptor and costimulation blockade induces tolerance to pluripotent human ESCs. (A) Schematic diagram showing experimental approaches and
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease
Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.
List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph
Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature
Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study
Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Antigen Species Clone Source Dilution Insulin Guinea pig - Dako, Carpinteria, 1:200 Glucagon Rabbit - Dako, Carpinteria,
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
Supplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
NOD-like receptor signaling and inflammasome-related pathways are highlighted in psoriatic epidermis
Supplementary Information NOD-like receptor signaling and inflammasome-related pathways are highlighted in psoriatic epidermis Mari H. Tervaniemi, Shintaro Katayama, Tiina Skoog, H. Annika Siitonen, Jyrki
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Hypoxia-Inducible Factor-2a Is an Essential Catabolic Regulator of Inflammatory Rheumatoid Arthritis
Hypoxia-Inducible Factor-2a Is an Essential Catabolic Regulator of Inflammatory Rheumatoid Arthritis Je-Hwang Ryu 1,2., Chang-Suk Chae 1., Ji-Sun Kwak 1, Hwanhee Oh 1, Youngnim Shin 1, Yun Hyun Huh 1,
Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
Supplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer
CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu
Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.
Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan
Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
Supplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
Product Datasheet. HLA ABC Antibody (W6/32) NB Unit Size: 0.25 mg. Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 22
Product Datasheet HLA ABC Antibody (W6/32) NB100-64775 Unit Size: 0.25 mg Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 22 Protocols, Publications, Related Products, Reviews, Research
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve
Expanded View Figures
Gregory T Ellis et al Lung damage by monocyte TRIL allows coinfection EMO reports Expanded View Figures % survival Clinical score Influenza Matrix /HPRT (log ) CFU/L (log ) 3 irway early.7.7 + h Survival
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
Supplementary Figure 1. Flow cytometry panels used for BD Canto (A) and BD Fortessa (B).
Intra Immune nalysis Surface Supplementary Figure 1. Flow cytometry panels used for D Canto () and D Fortessa (). Name Fluorochrome ID F488 PE PerCp-Cy5.5 PC Paclue PE-Cy7 PC-H7 Lympho* 1 CD56 CD8 CD16
As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the
3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans
SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans water-soluble mannoprotein-beta-glucan complex (CAWS) Noriko Nagi-Miura 1,, Daisuke
Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. .. Supplementary Figure 1 % of initial
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
Anti-DC-SIGN/CD209 murine monoclonal antibodies
Anti-DC-SIGN/CD209 murine monoclonal antibodies DC-SIGN (DC Specific, ICAM-3 Grabbing, Nonintegrin) / CD209 and L-SIGN (liver/lymph node-specific ICAM-3-grabbing nonintegrin CD299/ DC-SIGNR (DC-SIGN-related
Complement Antibodies and Proteins
COMPLEMENT ANTIBODIES AND PROTEINS FROM CEDARLANE INTERNATIONAL VERSION www.cedarlanelabs.com For over 50 years, Cedarlane has provided complement related products to the life science research and diagnostic
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor
Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)
Product Datasheet. Endothelin-1 Antibody (TR.ET.48.5) NB Unit Size: 100 ul. Store at -20C. Avoid freeze-thaw cycles.
Product Datasheet Endothelin-1 Antibody (TR.ET.48.5) NB300-526 Unit Size: 100 ul Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 2 Protocols, Publications, Related Products, Reviews,
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
Eosinophils! 40! 30! 20! 10! 0! NS!
A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the
Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Blockade of Prolymphangiogenic VEGF-C suppresses Dry Eye Disease. Sunali Goyal MD
Blockade of Prolymphangiogenic VEGF-C suppresses Dry Eye Disease Sunali Goyal MD Mentor: Reza Dana, MD, MPH, MSc Claes Dohlman Chair in Ophthalmology Director, Cornea & Refractive Surgery Massachusetts
Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
Reviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In the manuscript Rational Combination of CXCL11-Expressing Oncolytic Virus and PD-L1 Blockade Works Synergistically to Enhance Therapeutic Efficacy
Supplementary Information
Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
Product Datasheet. Ly-6G6C Antibody (NIMP-R14) NB Unit Size: 0.05 mg. Store at 4C. Do not freeze. Publications: 23
Product Datasheet Ly-6G6C Antibody (NIMP-R14) NB600-1387 Unit Size: 0.05 mg Store at 4C. Do not freeze. Publications: 23 Protocols, Publications, Related Products, Reviews, Research Tools and Images at:
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
Fisher et al. Supplemental Figure 1
Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
Bead Based Assays for Cytokine Detection
Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)
Identification of an IFN-γ/mast cell axis in a mouse model of chronic asthma
Research article Identification of an IFN-γ/mast cell axis in a mouse model of chronic asthma Mang Yu, 1 Michael R. Eckart, 2 Alexander A. Morgan, 3 Kaori Mukai, 1 Atul J. Butte, 3 Mindy Tsai, 1 and Stephen
The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
ab LDL Uptake Assay Kit (Cell-Based)
ab133127 LDL Uptake Assay Kit (Cell-Based) Instructions for Use For the detection of LDL uptake into cultured cells. This product is for research use only and is not intended for diagnostic use. Version
Supplementary Materials and Methods
Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing