Muscle Paralysis Induces Bone Marrow Inflammation and Predisposition to Formation of

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Muscle Paralysis Induces Bone Marrow Inflammation and Predisposition to Formation of"

Transcription

1 Articles in PresS. Am J Physiol Cell Physiol (August 30, 2017). doi: /ajpcell Muscle Paralysis Induces Bone Marrow Inflammation and Predisposition to Formation of Giant Osteoclasts Brandon J. Ausk 1, Leah E. Worton 1, Kate S. Smigiel 2, Ronald Y. Kwon 1, Steven D. Bain 1, Sundar Srinivasan 1, Edith M. Gardiner 1, Ted S. Gross Department of Orthopaedics and Sports Medicine, University of Washington, Seattle, WA, USA 2 Department of Immunology, University of Washington, Seattle, WA, USA Running Title: Muscle Paralysis Induces Inflammation and Giant Osteoclasts Corresponding Author: Brandon J. Ausk Department of Orthopaedics and Sports Medicine University of Washington 325 Ninth Ave HMC, Box Seattle, WA (206) , fax (206) Copyright 2017 by the American Physiological Society.

2 Abstract Transient muscle paralysis engendered by a single injection of botulinum toxin A (BTxA) rapidly induces profound focal bone resorption within the medullary cavity of adjacent bones. While initially conceived as a model of mechanical disuse, osteoclastic resorption in this model is disproportionately severe compared to the modest gait defect that is created. Preliminary studies of bone marrow following muscle paralysis suggested acute upregulation of inflammatory cytokines, including TNF and IL-1. We therefore hypothesized that BTxA-induced muscle paralysis would rapidly alter the inflammatory microenvironment and the osteoclastic potential of bone marrow. We tested this hypothesis by defining the time course of inflammatory cell infiltration, osteoinflammatory cytokine expression, and alteration in osteoclastogenic potential in the tibia bone marrow following transient muscle paralysis of the calf muscles. Our findings identified inflammatory cell infiltration within 24 hours of muscle paralysis. By 72 hours, osteoclast fusion and pro-osteoclastic inflammatory gene expression were upregulated in tibia bone marrow. These alterations coincided with bone marrow becoming permissive to the formation of osteoclasts of greater size and greater nuclei numbers. Taken together, our data are consistent with the thesis that transient calf muscle paralysis induces acute inflammation within the marrow of the adjacent tibia and that these alterations are temporally consistent with a role in mediating muscle paralysis-induced bone resorption. 42

3 Introduction Transient muscle paralysis induced by a single injection of botulinum toxin A (BTxA) rapidly induces focal and profound bone resorption within the medullary cavity of adjacent bones. While initially conceived as a model of bone loss due to reduced gait-induced loading, osteoclastic resorption in this model is disproportionately severe compared to the modest gait defect that is created (19, 32, 49). Instead, the severe bone loss following BTxA-induced muscle paralysis is comparable in rapidity and magnitude to that induced by sciatic neurectomy and spinal cord injury (31, 34). Subsequent studies demonstrated that acute trabecular bone loss following muscle paralysis arises via profound RANKL mediated osteoclastogenesis, but the initial signaling cascade responsible for the rapid activation of this bone catabolic pathway is not known (2). Preliminary studies to identify candidate signaling pathways responsible for activating RANKLmediated osteoclastogenesis indicated that the inflammatory cytokines TNFα and IL-1 were upregulated prior to the onset of bone resorption and to altered bone marrow gene expression previously observed at 7 and 14 d post-paralysis (33, 53). As these cytokines have been shown to regulate osteoclast activity (1, 12, 27, 56), we speculated that inflammatory alterations within the marrow in response to muscle paralysis create a focal microenvironment that is permissive to osteoclastogenesis. The linkage between inflammation, immune function, and bone catabolism is strongly supported by the literature. Predisposition to bone loss and osteoporotic fracture is observed in a number of chronic inflammatory diseases with immune components such as rheumatoid arthritis, inflammatory bowel disease, chronic obstructive pulmonary disease, and multiple sclerosis (8, 15, 17, 41). Inflammatory pathways have also been implicated in post-menopausal bone loss (40). When focal inflammatory disorders occur adjacent to bone surfaces (e.g., periodontitis or adjuvant arthritis), bone resorption is especially destructive (3, 29). One mechanism for this resorption is that RANKL can be highly expressed on activated CD4+ T cells and other inflammatory regulating cells (24, 25, 48), leading to enhanced osteoclast formation/recruitment and bone destruction. As well, inflammatory cytokines such as TNFα, IL-1 and IL-6 have been found to promote osteoclastogenesis (3, 20) and are implicated in post-menopausal bone loss (40). Lastly, both genetic and

4 pharmacologic inhibition of the immune response through T cell depletion and/or anti-inflammatory treatment reduces bone loss in models of ovariectomy and adjuvant arthritis (9, 40, 42). In addition to clear evidence of immune system involvement in chronic inflammatory bone loss, the rapidity and magnitude of bone resorption induced by muscle paralysis implies that immune-inflammatory pathways may play a critical role in paralysis-induced bone loss. In this context, an advantage of exploring this phenomenon in the BTxA bone loss model is the brief, contained period of de novo osteoclast activity (6 to 13 days; (5)) induced by muscle paralysis. We therefore hypothesized that BTxA-induced muscle paralysis would rapidly alter the inflammatory microenvironment and the osteoclastic potential of bone marrow. We tested this hypothesis by defining the time course of inflammatory cell infiltration, osteoinflammatory cytokine expression, and alteration in osteoclastogenic potential in the tibia bone marrow following transient muscle paralysis of the adjacent calf muscle group Methods This study was comprised of three complementary experiments. All mice were 16-wk-old female C57Bl/6 obtained from Jackson Laboratories. Each experiment utilized a single injection of botulinum toxin A (BTxA; 2U/100 g body weight; Allergan, Irvine, CA, USA) into the right calf muscle group to induce transient muscle paralysis on day 0 (39). Mice receiving BTxA treatment were allowed free cage activity for the remainder of each experiment. Calf paralysis was confirmed 24 hours post-injection by visual examination of reduced toe extension and ankle plantarflexion in the affected limb. We chose to use age matched naïve mice as controls in our studies for two primary reasons. First, while we have observed minimal alterations in RANKL protein levels, osteoclast numbers and bone volume alterations in control limbs following BTxA induced muscle paralysis (2, 50), we had no data confirming the absence of inflammatory gene expression alterations in contralateral limbs. Second, we had previously used naïve control mice to define the onset of osteoclastic resorption following transient muscle paralysis (4, 5). All experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee, University of Washington. 93

5 Flow Cytometric Analysis of T cells Mice were euthanized 24 or 48 hours following BTxA injection (n=4 per group). Marrow within the proximal metaphysis of the right tibia (approximately 5 mm section distal to the growth plate) was flushed with RPMI and pelleted by centrifugation. Red blood cells in the cell pellet were lysed by incubation in ACK lysing buffer (BioWhittaker) for 2 minutes. Cells were resuspended in RPMI and aliquoted into FACS tubes (5 x 10 6 cells per sample). FACS samples were centrifuged and resuspended in surface antibody dilution (1:200 ratio of surface antibody to FACS buffer consisting of HBSS with 2% FBS) for 20 minutes at 4 C. Finally, samples were washed twice and resuspended in FACS buffer for flow cytometry analysis. Marrow from naïve mice (n=5) was identically collected and processed as the baseline control. Marrow cell populations were stained for T cell surface markers (TCRβ, CD4 and CD8 antibodies: Biolegend). Individual sample data were acquired on an LSRII flow cytometer (BD Biosciences) and analyzed using FlowJo software (Treestar). Prior to analysis, one mouse from the BTxA group was removed due to a failed physical examination for muscle paralysis Quantitative RT-PCR of Osteoinflammatory and Osteoclast Fusion Genes Mice in this study were sacrificed on day 1, 3 or 7 post BTxA injection (n=6/grp). Whole marrow was flushed from the right tibia with RPMI. For quantitative RT-PCR, total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer s protocol and cdna was synthesized using Super Script III reverse transcriptase (Invitrogen/Life Technologies). Control marrow from naïve mice was prepared identically (n=6). We identified a candidate panel of inflammatory and osteoclastogenic genes from the literature and based on our preliminary data (TNF, CD9, CD44, CD47, CD81, IL1a, IL1b, IL4, IL11, DC-STAMP, OC- STAMP). We analyzed gene expression with quantitative real-time PCR using SYBR green and the Applied Biosystems 7900 HT sequence detection system. Gene expression levels were quantified using the 2-(2AACT) method relative to the inflammatory specific housekeeping gene HPRT (45). Primers used for this analysis are shown in Table Primary Osteoclast Culture

6 Tissue culture medium and supplements were purchased from Invitrogen (Life Technologies). Media were supplemented with heat-inactivated FBS (HyClone, Thermo Scientific). Marrow was collected from mouse tibiae at 1, 3 and 7 days post BTxA injection (n=2/gp). Marrow was flushed in culture medium (α-mem with 10% FBS) and red blood cells were lysed as previously described above. Cells were seeded in duplicate at 1.5 x 10 4 /cm 2 in chamber well slides (Thermo Scientific Inc.), supplemented with 50 ng/ml M-CSF (Peprotech) and 10 ng/ml RANKL (Biolegend) and incubated at 37 C and 5% CO 2. Cell media were refreshed on day 3 of culture and cells were fixed and stained for tartrate resistant acid phosphatase (TRAP) on day 8 of culture using the Leukocyte (TRAP) kit and protocol (Sigma-Aldrich). The experiment was replicated (total combined group size of n=4/grp), with data normalized within each experiment to identically treated marrow from treatmentnaïve mice (n=2/exp). For each group, normal osteoclasts (i.e., TRAP-positive cells w/ 3+ nuclei) and giant osteoclasts (i.e., a subset of normal osteoclasts w/ 20+ nuclei) were quantified on a per well basis using bright field microscopy (Olympus BH2 microscope, 10X and 40X magnification). The cutoff for a giant osteoclast (20+ nuclei) was based on previous studies (22, 51) in order to distinguish an increase in cell size between experimental groups. Once this difference was identified, a secondary analysis was performed to quantify the cell size distribution within these identified samples to confirm that our original analysis was robust to our choice of what was considered a giant osteoclast. For this, we assessed osteoclast area in naïve and 3 days post- BTxA cultures via automated calculation of osteoclast TRAP+ cell area in two 10 mm 2 subsamples of the culture area (composite of eighty 20x light microscopy images, Ziess) using custom ImageJ software (FIJI). Specifically, the software identified individual cell perimeters through image thresholding, binarized the images and filled in the cell area for individual cell area calculations. The average size of a 3-nuclei osteoclast was quantified by imaging a series of 3-nuclei TRAP+ cells (n=20 cells across all groups) Statistical Analysis Due to non-homogeneity of variance, flow cytometry data were analyzed using Kruskal-Wallis rank sum tests with Dunn s post-hoc analysis for pair-wise comparisons. Differential gene regulation in the quantitative RT-PCR study was determined using planned comparison one-way MANOVAs (i.e., gene expression on all

7 days compared to naïve mice) with Dunnett s two-way post-hoc for multiple comparisons to controls (i.e., naïve). Multiple one-way ANOVAs with Tukey post-hoc analysis were used to determine significant differences in the primary osteoclast culture. To compare osteoclast size in cultures, a Kolmogorov-Smirnov (KS) test was first used to compare the distribution in cell areas. Next, normalized population distributions (i.e., percent of cell population at a given area) were determined and fit with separate power law curves using maximum likelihood estimation (MLE) and likelihood ratio testing (LRT) as described previously (46). Finally, we assessed whether the data sets could be fit by a single power law model via MLE and LRT. Statistical significance was determined to be p< Results CD4+ T Cells Are Acutely Upregulated Following Muscle Paralysis Flow cytometry revealed rapid transient alterations in tibia marrow cell populations in the proximal tibia metaphysis following muscle paralysis (Fig. 1). The percentage of CD4+ T cells (mean ± s.e.) within the bone marrow was elevated 25% within 24 hours of BTxA injection (1.47 ± 0.07%) vs naïve (1.14 ± 0.10%, p<0.04; Fig. 1B), but returned to baseline levels with 48 hours after BTxA injection (1.14 ± 0.07%, p=0.75 vs naive; Fig. 1B). CD8+ populations were not significantly altered at any timepoint (2.36 ± 0.21% vs 2.32 ± 0.20% vs 2.52 ± 0.35 in day 1, day 2, and naïve, respectively, p>0.9; Fig. 1C). Thus, the ratio of CD4+/CD8+ T cells within the marrow was increased 34% on day 1 (0.63 ± 0.04) vs naïve (0.47 ± 0.04,, p<0.03; Fig. 1D), but not on day 2 (0.49 ± 0.01, p=0.82 vs naive; Fig. 1C). The overall T cell population size in naïve marrow (40.17 ± 1.78%) was not significantly altered at 24 hours (42.40 ± 2.91%, p=0.36 vs naive; Fig. 1E) or 48 hours (33.20 ± 2.24%, p=0.10 vs naive; Fig. 1E) Osteoinflammatory Genes Are Rapidly Altered Following Muscle Paralysis Temporal gene expression patterns within the tibia marrow following muscle paralysis were consistent with transient inflammatory signaling. While none of the panel of nine genes was significantly altered at 1 day following muscle paralysis (vs naïve controls), three genes showed statistically significant regulation by day 3.

8 Two genes were upregulated (TNF: 299%, IL-4: 243%; each p<0.02, Table 2), while one was downregulated (CD47: -88%; p<0.03, Table 2). Only IL-4 was significantly upregulated on day 7 (250%, p<0.02, Table 2). Additionally, three other genes (CD9, IL-1a and IL-1b; Table 2) were detectable in naïve and day 1 samples, but were undetectable on days 3 and 7. IL-6 gene expression was also assayed but the levels were undetectable in most samples and thus not reported The Osteoclastic Potential of Bone Marrow Is Altered by Muscle Paralysis The culture conditions were permissive to the formation of osteoclasts with a small subset of giant osteoclasts (> 20 nuclei; Fig 2). Marrow from naïve mice generated 96.8 ± 26.7 (mean ± s.e.) normal osteoclasts/well, including 2.5 ± 1.0 giant osteoclasts/well. Transient muscle paralysis did not significantly alter the number of normal osteoclasts formed in marrow culture at any time point (Fig. 3A). However, the capacity to form giant osteoclasts was acutely upregulated 3 days following muscle paralysis, and was not significantly different from naïve mice by day 7. Marrow harvested 3 days after BTxA injection produced 268% more giant osteoclasts than naïve control marrow (p=0.008) and 352% more giant osteoclasts than day 1 marrow (p=0.003; Fig. 3B). Secondary analyses indicated that this observation was robust to the number of nuclei chosen to represent a giant osteoclast. A KS Test indicated that the distribution of osteoclast size arising from day 3 BTxA marrow was significantly different than that of naïve bone marrow (p<0.001). Additionally, we observed that two separate power law models (a*x b ) were required to describe the in vivo data (p=0.87, formulas in Fig 4). Given that the overall osteoclast numbers were not different in naïve and day 3 BTxA cultures (see above), this analysis indicates that the percentage of cells (and thus total cell number) in the day 3 BTxA culture were higher than in the naïve cultures regardless of the threshold chosen to classify a giant osteoclast Osteoclast Fusion Genes Are Upregulated 3 Days Following Muscle Paralysis The elevated osteoclast size and number of nuclei generated by marrow following muscle paralysis might be explained by enhanced cell fusion. We therefore reassessed cdna from the gene expression experiment and quantified alterations in the osteoclast fusion genes (DC-STAMP and OC-STAMP). Both DC-

9 STAMP (243% increase) and OC-STAMP (218% increase) were significantly upregulated in bone marrow removed 3 days post-paralysis as compared to naïve bone marrow (both p< 0.02, Fig 5). Consistent with the in vitro experiments, osteoclast fusion gene expression was not significantly altered on day 1 or day 7 following muscle paralysis compared to naïve samples Discussion We used flow cytometry, quantitative RT-PCR, and primary osteoclast culture to explore the presence of inflammatory signaling within bone marrow following calf paralysis. We observed inflammatory cell infiltration within 24 hours and pro-inflammatory gene expression within 72 hours of muscle paralysis. Surprisingly, alterations in the osteoclastic potential of bone marrow extracted following muscle paralysis were not associated with increased numbers of osteoclasts, but instead manifested as an increase in osteoclast size and number of nuclei per osteoclast. The observation of enhanced numbers of giant osteoclasts was supported by simultaneous upregulation of the osteoclast fusion genes DC- and OC-STAMP. In combination, these data are consistent with muscle paralysis acutely precipitating a localized inflammatory response within bone marrow that is permissive to generating osteoclasts of greater size and nuclei number. These observations must be considered in the context of the limitations of our approach. The impetus for this study was to assess our thesis that inflammatory signaling within bone marrow precedes or is coincident with the onset of bone resorption induced by muscle paralysis. To that end, we quantified inflammatory cell influx (FACS) and altered osteoinflammatory signaling (RT-PCR) within bone marrow. While recognizing that these outcomes are indirect and do not define a causal relationship between bone marrow inflammation and subsequent bone resorption, we believe this limitation is mitigated, in part, by the cadence of events underlying bone resorption following muscle paralysis. Specifically, we observed alterations in inflammatory cell populations (day 1) upstream of alterations in osteoinflammatory gene expression (day 3). The timing in which marrow became permissive to formation of giant osteoclasts (day 3), coupled with the time needed to form functioning osteoclasts from precursor populations ( 3-5 days (13, 47)) is congruent with the onset of

10 diaphyseal endocortical resorption following paralysis (which almost entirely occurs between days 6 and 13 post-paralysis) (5). To further support our gene expression data, we performed a follow-on ELISA-based study to quantify protein level alterations in TNF and IL4 (as both genes showed significant upregulation following muscle paralysis). Utilizing the same time points as the gene expression experiment, we did not observe elevated expression in either protein following muscle paralysis. There are many potential explanations for the lack of direct correlation between mrna and protein levels, and the inflammatory literature illustrates this challenge even in a simple cell culture environment (e.g., (44)). One clear challenge in our system is that the temporal dynamics of protein expression and stability (e.g., half-life on the scale of minutes in an experiment of many days) is likely to be exceedingly non-linear. Though we believe the cumulated data across our studies suggest otherwise, it is possible that the inflammatory genes upregulation does not manifest in alteration in protein level expression. Regardless, these data support the need to further clarify the role of inflammatory mediation and suggest that either transgenic (6, 40) or pharmaceutical (9, 42) strategies would most effectively explore a mechanistic relation between inflammation and muscle paralysis-induced bone loss. Using a primary culture system to explore whether bone marrow had altered osteoclastic potential following transient muscle paralysis, we observed greater numbers of giant osteoclasts (>20 nuclei). This finding ostensibly contradict our previous in vivo observation of increased osteoclast numbers in the proximal tibia following BTxA-induced paralysis of the calf (2). However, as histologic quantification of osteoclast numbers in adjacent cross-sections relies upon an assumption of equivalent cell size, a significant increase in osteoclast size (as observed in vitro) would likely manifest as an increased osteoclast number in stereological assessments. Additionally, we did not determine the resorptive potential of the giant osteoclasts observed in cell culture. The literature suggests that osteoclast size does not always correlate with increased bone resorption. For example, giant osteoclasts observed following long-term bisphosphonate therapy are generally not thought to resorb bone at all, but rather are an artifact caused by prolonged apoptosis (22, 51). In contrast, however, giant osteoclasts associated with inflammatory pathologies such as Paget s are generally thought to be capable of resorbing large volumes of bone mineral (16, 21, 29, 38). If so, it is reasonable to speculate that a

11 relatively few giant osteoclasts could account for a sizeable proportion of bone resorption observed following muscle paralysis. As confirmation of the in vivo presence of giant osteoclasts via histology may prove technically challenging, given our observations of enhanced cell fusion, it is possible that pharmaceutical strategies to transiently inhibit cell fusion could be implemented to explore this question in vivo (18). Despite these limitations, our results are consistent with the upregulation of inflammatory cells and inflammatory genes prior to the initiation of bone resorption, and our in vivo RT-PCR data are also consistent with this altered marrow environment facilitating the formation of giant osteoclasts observed in vitro. Following muscle paralysis, several genes implicated in osteoclast fusion and giant osteoclast formation were upregulated, including the essential protein for osteoclast fusion, DC-STAMP (35, 43, 54), and a second osteoclast fusion related protein, OC-STAMP (36). Inhibition studies have indicated that these genes are essential for normal osteoclast activity, while overexpression studies having resulted in elevated osteoclast formation/bone resorption (11, 28, 52, 55). IL-4 has been shown to promote the formation of multinucleated giant cells from macrophage precursors through the overexpression of E-cadherin (37). Other recent reports identified that upregulation of TNF in the absence of CD44 results in the generation of highly resorbing giant osteoclast (21). While we did not detect a statistical decrease in CD44 gene expression on day 3 (p=0.10), the 87% decrease in comparison to naïve bone marrow and elevated TNF in our data are also consistent with this thesis. Ultimately, understanding how muscle paralysis of the calf induces inflammatory alterations in tibia bone marrow may reveal unexpected targets to mitigate the catabolic effects of neuromuscular dysfunction, regardless of initiating pathology. One possible explanation is that muscle paralysis induces neurogenic inflammation, which is characterized by the local release of inflammatory mediators in response to trauma or noxious stimuli (10, 23, 30). Classically, antidromic depolarization causes sensory neurons to rapidly release neuropeptides (primarily SP and CGRP; (10, 14)) that act on a variety of cell populations to rapidly orchestrate a focal inflammatory response (7). While direct evidence of neuropeptide release following muscle paralysis has not yet been reported, even brief periods of weightlessness have been associated with afferent sensory nerve depolarization (26).

12 Taken together, our data suggest that transient calf muscle paralysis induces acute inflammation within the marrow of the adjacent tibia that is temporally consistent with an active role in mediating bone resorption induced by this neuromuscular dysfunction. Our data additionally suggest that the inflammatory cascade swiftly triggered by transient muscle paralysis predisposes bone marrow to the formation of giant osteoclasts, which may account for the rapid and severe destruction of trabecular bone observed in this model. The identification of an acute inflammatory cascade in bone marrow leading to the formation of giant osteoclasts has potential to reveal novel therapeutic strategies for mitigating paralysis-induced bone loss following neuromuscular trauma. 83

13 Figure Legends Figure 1: Acute CD4+ T cell upregulation in bone marrow following muscle paralysis. Bone marrow was extracted from the proximal metaphysis of the right tibia of naïve mice and mice that had received an IM injection of BTxA the previous day (2U/100g body weight in right calf muscle group). Samples were lysed of red blood cells and stained with TCR, CD4 and CD8 antibodies, and FACS analysis performed. Prior to determination of T cell populations within bone marrow, cellular debris was excluded from analysis using traditional forward side-scatter gating (A). Percentages of CD4+ (B) and CD8+ (C) T-cells are shown, and the ratio of CD4+:CD8+ cells determined (D). Additionally, total percentages of T-cells in the marrow are graphed (E). Values represent mean + SE (n=4-5 per group), *p<0.05 vs naïve and day 2, #p<0.05 vs day Figure 2: Marrow culture conditions were permissive to formation of osteoclasts. Whole bone marrow was collected from the right tibia of experimental mice. Samples were lysed of red blood cells, seeded in culture medium supplemented with M-CSF (50 ng/ml) and RANKL (10ng/ml), incubated at 37 C, and stained for TRAP on day 8 of culture. Representative image of bone marrow harvested 3 days after transient muscle paralysis. Giant osteoclasts (blue arrows) and smaller osteoclasts (green arrows) can be seen Figure 3: Transient muscle paralysis augmented osteoclastic potential of tibia marrow through enhanced osteoclast fusion, but not increased osteoclast number. Whole bone marrow was collected from the right tibia of naïve mice and from mice that had received an IM injection of BTxA injection in the right calf 1, 3 and 7 days previously. Cells were cultured for 8 days, and stained for TRAP. Normal osteoclast (TRAP + w/3+ nuclei) and giant osteoclast (a subset of normal osteoclasts w/20+ nuclei) were quantified in each group on a per well basis using bright field microscopy (10 to 40x magnification). Fold changes of osteoclasts (A) and giant osteoclasts (B) are shown at day 1, 3 and 7 post injection normalized to the naïve controls. Values represent mean + SE (n=4 per group), **p<0.01 vs naïve and day 1. 08

14 Figure 4: Size of osteoclasts generated from marrow harvested 3 days after muscle paralysis was consistently larger than that of Naïve marrow cultures. An automated quantification of osteoclast area was performed on two subsamples of the naïve and day 3 cultures (10 mm 2 per subsample using a composite of eighty light microscopy 20x images) using custom software as described in the Materials and Methods. A Kolmogorov-Smirnov (KS) analysis indicated the area distributions from naïve and day three BTxA marrow were significantly different (p<0.001). The figure represents the distribution of cell areas in each culture with separate power law models (dashed and dotted lines) fit to simulate the in vitro data. Values represent mean + SE Figure 5: Osteoclast Fusion Gene Expression Following Muscle Paralysis. Whole bone marrow was flushed from the right tibia of naïve mice and mice that had received an IM injection of BTxA in the right calf 1, 3 and 7 days previously. After preparation of total RNA and synthesis of CDNA, quantitative RT-PCR was performed using DC-STAMP and OC-STAMP gene specific primers. Gene expression levels were quantified relative to the housekeeping gene HPRT. Values represent mean + SE (n=6 per group), *p<0.05 vs naïve

15 Bibliography 1. Adamopoulos IE, and Bowman EP. Immune regulation of bone loss by Th17 cells. Arthritis Res Ther 10: 225, Aliprantis AO, Stolina M, Kostenuik PJ, Poliachik SL, Warner SE, Bain SD, and Gross TS. Transient muscle paralysis degrades bone via rapid osteoclastogenesis. FASEB J 26: , Assuma R, Oates T, Cochran D, Amar S, and Graves DT. IL-1 and TNF antagonists inhibit the inflammatory response and bone loss in experimental periodontitis. J Immunol 160: , Ausk BJ, Huber P, Poliachik SL, Bain SD, Srinivasan S, and Gross TS. Cortical bone resorption following muscle paralysis is spatially heterogeneous. Bone 50: 14-22, Ausk BJ, Huber P, Srinivasan S, Bain SD, Kwon RY, McNamara EA, Poliachik SL, Sybrowsky CL, and Gross TS. Metaphyseal and diaphyseal bone loss in the tibia following transient muscle paralysis are spatiotemporally distinct resorption events. Bone 57: , Baker PJ, Howe L, Garneau J, and Roopenian DC. T cell knockout mice have diminished alveolar bone loss after oral infection with Porphyromonas gingivalis. FEMS Immunol Med Microbiol 34: 45-50, Biosse-Duplan M, Baroukh B, Dy M, de Vernejoul MC, and Saffar JL. Histamine promotes osteoclastogenesis through the differential expression of histamine receptors on osteoclasts and osteoblasts. Am J Pathol 174: , Buckland-Wright JC, and Walker SR. Incidence and size of erosions in the wrist and hand of rheumatoid patients: a quantitative microfocal radiographic study. Ann Rheum Dis 46: , Charatcharoenwitthaya N, Khosla S, Atkinson EJ, McCready LK, and Riggs BL. Effect of blockade of TNF-alpha and interleukin-1 action on bone resorption in early postmenopausal women. J Bone Miner Res 22: , Chiu IM, von Hehn CA, and Woolf CJ. Neurogenic inflammation and the peripheral nervous system in host defense and immunopathology. Nat Neurosci 15: , Chiu YH, Mensah KA, Schwarz EM, Ju Y, Takahata M, Feng C, McMahon LA, Hicks DG, Panepento B, Keng PC, and Ritchlin CT. Regulation of human osteoclast development by dendritic cellspecific transmembrane protein (DC-STAMP). J Bone Miner Res 27: 79-92, Colburn NT, Zaal KJ, Wang F, and Tuan RS. A role for gamma/delta T cells in a mouse model of fracture healing. Arthritis Rheum 60: , Collin-Osdoby P, Yu X, Zheng H, and Osdoby P. RANKL-mediated osteoclast formation from murine RAW cells. Methods in molecular medicine 80: , Corrigan F, Vink R, and Turner RJ. Inflammation in acute CNS injury: a focus on the role of substance P. Br J Pharmacol 173: , Cosman F, Nieves J, Komar L, Ferrer G, Herbert J, Formica C, Shen V, and Lindsay R. Fracture history and bone loss in patients with MS. Neurology 51: , da Costa CE, Annels NE, Faaij CM, Forsyth RG, Hogendoorn PC, and Egeler RM. Presence of osteoclast-like multinucleated giant cells in the bone and nonostotic lesions of Langerhans cell histiocytosis. J Exp Med 201: , Dimai HP, Domej W, Leb G, and Lau KH. Bone loss in patients with untreated chronic obstructive pulmonary disease is mediated by an increase in bone resorption associated with hypercapnia. J Bone Miner Res 16: , Fan X, Biskobing DM, Bain S, and Rubin J. Ketoconazole and phorbol myristate acetate regulate osteoclast precursor fusion in primary murine marrow culture. J Bone Miner Res 11: , Gross TS, Poliachik SL, Prasad J, and Bain SD. The effect of muscle dysfunction on bone mass and morphology. J Musculoskelet Neuronal Interact 10: 25-34, Hashizume M, Hayakawa N, and Mihara M. IL-6 trans-signalling directly induces RANKL on fibroblast-like synovial cells and is involved in RANKL induction by TNF-alpha and IL-17. Rheumatology (Oxford) 47: , Hayer S, Steiner G, Gortz B, Reiter E, Tohidast-Akrad M, Amling M, Hoffmann O, Redlich K, Zwerina J, Skriner K, Hilberg F, Wagner EF, Smolen JS, and Schett G. CD44 is a determinant of inflammatory bone loss. J Exp Med 201: , 2005.

16 Jain N, and Weinstein RS. Giant osteoclasts after long-term bisphosphonate therapy: diagnostic challenges. Nat Rev Rheumatol 5: , Jancso N, Jancso-Gabor A, and Szolcsanyi J. Direct evidence for neurogenic inflammation and its prevention by denervation and by pretreatment with capsaicin. Br J Pharmacol Chemother 31: , Josien R, Wong BR, Li HL, Steinman RM, and Choi Y. TRANCE, a TNF family member, is differentially expressed on T cell subsets and induces cytokine production in dendritic cells. J Immunol 162: , Kawai T, Matsuyama T, Hosokawa Y, Makihira S, Seki M, Karimbux NY, Goncalves RB, Valverde P, Dibart S, Li YP, Miranda LA, Ernst CW, Izumi Y, and Taubman MA. B and T lymphocytes are the primary sources of RANKL in the bone resorptive lesion of periodontal disease. Am J Pathol 169: , Kawano F, Nomura T, Ishihara A, Nonaka I, and Ohira Y. Afferent input-associated reduction of muscle activity in microgravity environment. Neuroscience 114: , Kong YY, Feige U, Sarosi I, Bolon B, Tafuri A, Morony S, Capparelli C, Li J, Elliott R, McCabe S, Wong T, Campagnuolo G, Moran E, Bogoch ER, Van G, Nguyen LT, Ohashi PS, Lacey DL, Fish E, Boyle WJ, and Penninger JM. Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand. Nature 402: , Kukita T, Wada N, Kukita A, Kakimoto T, Sandra F, Toh K, Nagata K, Iijima T, Horiuchi M, Matsusaki H, Hieshima K, Yoshie O, and Nomiyama H. RANKL-induced DC-STAMP is essential for osteoclastogenesis. J Exp Med 200: , Kuratani T, Nagata K, Kukita T, Hotokebuchi T, Nakasima A, and Iijima T. Induction of abundant osteoclast-like multinucleated giant cells in adjuvant arthritic rats with accompanying disordered high bone turnover. Histology and histopathology 13: , Levine JD, Dardick SJ, Basbaum AI, and Scipio E. Reflex neurogenic inflammation. I. Contribution of the peripheral nervous system to spatially remote inflammatory responses that follow injury. J Neurosci 5: , Liu D, Zhao CQ, Li H, Jiang SD, Jiang LS, and Dai LY. Effects of spinal cord injury and hindlimb immobilization on sublesional and supralesional bones in young growing rats. Bone 43: , Manske SL, Boyd SK, and Zernicke RF. Vertical ground reaction forces diminish in mice after botulinum toxin injection. J Biomech 44: , Marchand-Libouban H, Le Drevo MA, and Chappard D. Disuse induced by Botulinum toxin affects the bone marrow expression profile of bone genes leading to a rapid bone loss. J Musculoskelet Neuronal Interact 13: 27-36, Marenzana M, De Souza RL, and Chenu C. Blockade of beta-adrenergic signaling does not influence the bone mechano-adaptive response in mice. Bone 41: , Mensah KA, Ritchlin CT, and Schwarz EM. RANKL induces heterogeneous DC-STAMP(lo) and DC-STAMP(hi) osteoclast precursors of which the DC-STAMP(lo) precursors are the master fusogens. J Cell Physiol 223: 76-83, Miyamoto H, Suzuki T, Miyauchi Y, Iwasaki R, Kobayashi T, Sato Y, Miyamoto K, Hoshi H, Hashimoto K, Yoshida S, Hao W, Mori T, Kanagawa H, Katsuyama E, Fujie A, Morioka H, Matsumoto M, Chiba K, Takeya M, Toyama Y, and Miyamoto T. Osteoclast stimulatory transmembrane protein and dendritic cell-specific transmembrane protein cooperatively modulate cell-cell fusion to form osteoclasts and foreign body giant cells. J Bone Miner Res 27: , Moreno JL, Mikhailenko I, Tondravi MM, and Keegan AD. IL-4 promotes the formation of multinucleated giant cells from macrophage precursors by a STAT6-dependent, homotypic mechanism: contribution of E-cadherin. J Leukoc Biol 82: , Muzylak M, Price JS, and Horton MA. Hypoxia induces giant osteoclast formation and extensive bone resorption in the cat. Calcif Tissue Int 79: , Poliachik SL, Bain SD, Threet D, Huber P, and Gross TS. Transient muscle paralysis disrupts bone homeostasis by rapid degradation of bone morphology. Bone 46: 18-23, 2010.

17 Roggia C, Gao Y, Cenci S, Weitzmann MN, Toraldo G, Isaia G, and Pacifici R. Up-regulation of TNF-producing T cells in the bone marrow: a key mechanism by which estrogen deficiency induces bone loss in vivo. Proc Natl Acad Sci U S A 98: , Roux C, Abitbol V, Chaussade S, Kolta S, Guillemant S, Dougados M, Amor B, and Couturier D. Bone loss in patients with inflammatory bowel disease: a prospective study. Osteoporos Int 5: , Saidenberg-Kermanac'h N, Corrado A, Lemeiter D, devernejoul MC, Boissier MC, and Cohen- Solal ME. TNF-alpha antibodies and osteoprotegerin decrease systemic bone loss associated with inflammation through distinct mechanisms in collagen-induced arthritis. Bone 35: , Sanecka A, Ansems M, Prosser AC, Danielski K, Warner K, den Brok MH, Jansen BJ, Eleveld- Trancikova D, and Adema GJ. DC-STAMP knock-down deregulates cytokine production and T-cell stimulatory capacity of LPS-matured dendritic cells. BMC immunology 12: 57, Shebl FM, Pinto LA, Garcia-Pineres A, Lempicki R, Williams M, Harro C, and Hildesheim A. Comparison of mrna and protein measures of cytokines following vaccination with human papillomavirus-16 L1 virus-like particles. Cancer Epidemiol Biomarkers Prev 19: , Silver N, Cotroneo E, Proctor G, Osailan S, Paterson KL, and Carpenter GH. Selection of housekeeping genes for gene expression studies in the adult rat submandibular gland under normal, inflamed, atrophic and regenerative states. BMC molecular biology 9: 64, Srinivasan S, Threet D, Worton LE, Ausk BJ, Bain SD, Gardiner EM, Kwon RY, and Gross TS. Distinct cyclosporin a doses are required to enhance bone formation induced by cyclic and rest-inserted loading in the senescent skeleton. PLoS One 9: e84868, Tinkler SM, Williams DM, and Johnson NW. Osteoclast formation in response to intraperitoneal injection of 1 alpha-hydroxycholecalciferol in mice. J Anat 133: 91-97, Tunyogi-Csapo M, Kis-Toth K, Radacs M, Farkas B, Jacobs JJ, Finnegan A, Mikecz K, and Glant TT. Cytokine-controlled RANKL and osteoprotegerin expression by human and mouse synovial fibroblasts: fibroblast-mediated pathologic bone resorption. Arthritis Rheum 58: , Warden SJ, Galley MR, Richard JS, George LA, Dirks RC, Guildenbecher EA, Judd AM, Robling AG, and Fuchs RK. Reduced gravitational loading does not account for the skeletal effect of botulinum toxin-induced muscle inhibition suggesting a direct effect of muscle on bone. Bone 54: , Warner SE, Sanford DA, Becker BA, Bain SD, Srinivasan S, and Gross TS. Botox induced muscle paralysis rapidly degrades bone. Bone 38: , Weinstein RS, Roberson PK, and Manolagas SC. Giant osteoclast formation and long-term oral bisphosphonate therapy. The New England journal of medicine 360: 53-62, Wisitrasameewong W, Kajiya M, Movila A, Rittling S, Ishii T, Suzuki M, Matsuda S, Mazda Y, Torruella MR, Azuma MM, Egashira K, Freire MO, Sasaki H, Wang CY, Han X, Taubman MA, and Kawai T. DC-STAMP Is an Osteoclast Fusogen Engaged in Periodontal Bone Resorption. J Dent Res 96: , Worton LE, Gardiner EM, Bain SD, and Gross TS. Transient muscle paralysis increases the osteoclastogenic differentiation potential of marrow. In: Orthopaedic Research Society. Long Beach, CA: Yagi M, Miyamoto T, Sawatani Y, Iwamoto K, Hosogane N, Fujita N, Morita K, Ninomiya K, Suzuki T, Miyamoto K, Oike Y, Takeya M, Toyama Y, and Suda T. DC-STAMP is essential for cell-cell fusion in osteoclasts and foreign body giant cells. J Exp Med 202: , Yang M, Birnbaum MJ, MacKay CA, Mason-Savas A, Thompson B, and Odgren PR. Osteoclast stimulatory transmembrane protein (OC-STAMP), a novel protein induced by RANKL that promotes osteoclast differentiation. J Cell Physiol 215: , Yoshitake F, Itoh S, Narita H, Ishihara K, and Ebisu S. Interleukin-6 directly inhibits osteoclast differentiation by suppressing receptor activator of NF-kappaB signaling pathways. J Biol Chem 283: , 2008.

18

19

20

21

22

23

24

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Immunological Aspect of Ozone in Rheumatic Diseases

Immunological Aspect of Ozone in Rheumatic Diseases Immunological Aspect of Ozone in Rheumatic Diseases Prof. Dr. med. Z. Fahmy Chief Consulting Rheumatologist Augusta Clinic for Rheumatic Diseases And Rehabilitation Bad Kreuznach Germany Rheumatoid arthritis

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Osteoclast Activity Assay Substrate

Osteoclast Activity Assay Substrate Osteoclast Activity Assay Substrate For Research Use Only OSCOTECT INC. #3201 Trade Tower Samsung-dong 159, Kangnam-ku Seoul 135-729, Korea Tel: +82-2-6000-7666 / Fax: +82-2-6000-7667 customer@oscotec.com

More information

Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans

Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans Emilie Viennois 1*, Yuan Zhao 1, 2, Moon Kwon Han 1, Bo Xiao 1, 3, Mingzhen Zhang 1,

More information

Effects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris

Effects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris Effects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris William Michael Mihalko, MD PhD, Lev Djenderedjian, Paramjeet S. Cheema, Richard A. Smith, PhD. University of Tennessee,

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

HTRF MEASUREMENT OF CYTOKINE RELEASE FROM FRESH BLOOD SAMPLES

HTRF MEASUREMENT OF CYTOKINE RELEASE FROM FRESH BLOOD SAMPLES HTRF MEASUREMENT OF CYTOKINE RELEASE FROM FRESH BLOOD SAMPLES APPLICATION NOTE ABSTRACT Cisbio offers a comprehensive line of HTRF cytokine assays to investigate the functional response of immune cells.

More information

Identification of mirna differentially expressed in macrophages exposed to Porphyromonas gingivalis infection

Identification of mirna differentially expressed in macrophages exposed to Porphyromonas gingivalis infection Boston University OpenBU http://open.bu.edu Graduate Research Symposium Graduate Research Symposium 216 216-4-1 Identification of mirna differentially expressed in macrophages exposed to Porphyromonas

More information

Regulation of Osteoclast Differentiation

Regulation of Osteoclast Differentiation Regulation of Osteoclast Differentiation G. DAVID ROODMAN University of Pittsburgh, School of Medicine/Hematology-Oncology, and VA Pittsburgh Healthcare System, Medicine/Hematology-Oncology, Pittsburgh,

More information

NBQX, An AMPA/Kainate Glutamate Receptor Antagonist, Alleviates Joint Disease In Models Of Inflammatory- And Osteo- Arthritis.

NBQX, An AMPA/Kainate Glutamate Receptor Antagonist, Alleviates Joint Disease In Models Of Inflammatory- And Osteo- Arthritis. NBQX, An AMPA/Kainate Glutamate Receptor Antagonist, Alleviates Joint Disease In Models Of Inflammatory- And Osteo- Arthritis. Cleo S. Bonnet, PhD 1, Anwen S. Williams, PhD 1, Sophie J. Gilbert, PhD 1,

More information

A Novel Murine Model Of Adynamic Bone Disease (ABD)

A Novel Murine Model Of Adynamic Bone Disease (ABD) A Novel Murine Model Of Adynamic Bone Disease (ABD) Adeline H. Ng 1,2, Thomas L. Willett, PhD 2,1, Benjamin A. Alman 3,1, Marc D. Grynpas 1,2. 1 University of Toronto, Toronto, ON, Canada, 2 Samuel Lunenfeld

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Bacteria Induce Osteoclastogenesis via an Osteoblast-Independent Pathway

Bacteria Induce Osteoclastogenesis via an Osteoblast-Independent Pathway INFECTION AND IMMUNITY, June 2002, p. 3143 3148 Vol. 70, No. 6 0019-9567/02/$04.00 0 DOI: 10.1128/IAI.70.6.3143 3148.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Bacteria

More information

Bone and Cancer. Peter Croucher

Bone and Cancer. Peter Croucher Bone and Cancer Peter Croucher Academic Unit of Bone Biology, Section of Musculoskeletal Science, University of Sheffield Medical School, Sheffield, UK Learning Objectives To Develop Understanding of:

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

The Pathogenesis of Chlamydia pneumoniae in Multiple Sclerosis: Current Thoughts and Future Directions

The Pathogenesis of Chlamydia pneumoniae in Multiple Sclerosis: Current Thoughts and Future Directions The Pathogenesis of Chlamydia pneumoniae in Multiple Sclerosis: Current Thoughts and Future Directions Seminars in Pathology March 9, 2010 Charles W. Stratton, M.D. Features of C. pneumoniae Infection

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens

Autoimmunity. Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmunity Autoimmunity arises because of defects in central or peripheral tolerance of lymphocytes to selfantigens Autoimmune disease can be caused to primary defects in B cells, T cells and possibly

More information

Inhibition of andrographolide in RAW murine macrophage osteoclastogenesis by downregulating the nuclear factor-kappab signaling pathway

Inhibition of andrographolide in RAW murine macrophage osteoclastogenesis by downregulating the nuclear factor-kappab signaling pathway Inhibition of andrographolide in RAW 264.7 murine macrophage osteoclastogenesis by downregulating the nuclear factor-kappab signaling pathway Y.Q. Ren 1 and Y.B. Zhou 2 1 Department of Orthopedics 1, Yuyao

More information

Osteoclasts- What Do They Do and How Do They Do It? Prof. Steven L. Teitelbaum

Osteoclasts- What Do They Do and How Do They Do It? Prof. Steven L. Teitelbaum Osteoclasts; What Do They Do 1 Steven L. Teitelbaum, M.D. Wilma and Roswell Messing Professor Department of Pathology and Immunology Washington University School of Medicine OSTEOCLASTS OSTEOBLASTS 2 Osteoclasts

More information

From Fragile to Firm. Monika Starosta MD. Advocate Medical Group

From Fragile to Firm. Monika Starosta MD. Advocate Medical Group From Fragile to Firm Monika Starosta MD Advocate Medical Group Bone Remodeling 10% remodeled each year Calcium homoeostasis Maintain Mechanical strength Replace Osteocytes Release Growth Factors Bone remodeling

More information

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures FastImmune Intracellular Cytokine Staining Procedures BD has developed protocols for the detection of intracellular cytokines in activated lymphocytes and in activated monocytes. The procedures have been

More information

CONTRACTING ORGANIZATION: Mount Sinai School of Medicine

CONTRACTING ORGANIZATION: Mount Sinai School of Medicine AD Award Number: W81XWH-12-1-0038 TITLE: Prostatic Acid Phosphatase Plays a Causal Role in Prostate Cancer Bone Metastases PRINCIPAL INVESTIGATOR: Alice C. Levine, M.D. CONTRACTING ORGANIZATION: Mount

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Role of BAFF in B cell Biology and Autoimmunity

Role of BAFF in B cell Biology and Autoimmunity Role of BAFF in B cell Biology and Autoimmunity B cell development in health and disease: B-lymphocytes or B cells, and the antibodies they produce, are crucial mediators of humoral immunity, providing

More information

Bone Health in the Cancer Patient. Stavroula Otis, M.D. Primary Care and Oncology: Practical Lessons Conference Brea Community Center May 10, 2018

Bone Health in the Cancer Patient. Stavroula Otis, M.D. Primary Care and Oncology: Practical Lessons Conference Brea Community Center May 10, 2018 Bone Health in the Cancer Patient Stavroula Otis, M.D. Primary Care and Oncology: Practical Lessons Conference Brea Community Center May 10, 2018 Overview Healthy bone is in a constant state of remodelling

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Bone Cell Biology. David W. Dempster, PhD. Professor of Clinical Pathology Columbia University. Bone Remodeling

Bone Cell Biology. David W. Dempster, PhD. Professor of Clinical Pathology Columbia University. Bone Remodeling Bone Cell Biology David W. Dempster, PhD Professor of Clinical Pathology Columbia University Bone Remodeling The skeleton, out of site and often out of mind, is a formidable mass of tissue occupying about

More information

Bone Cell Biology. The Remodeling Cycle. Bone Remodeling. Remodeling Maintains Mechanical Strength. David W. Dempster, PhD

Bone Cell Biology. The Remodeling Cycle. Bone Remodeling. Remodeling Maintains Mechanical Strength. David W. Dempster, PhD Bone Remodeling Bone Cell Biology David W. Dempster, PhD Professor of Clinical Pathology Columbia University The skeleton, out of site and often out of mind, is a formidable mass of tissue occupying about

More information

The Need for a PARP in vivo Pharmacodynamic Assay

The Need for a PARP in vivo Pharmacodynamic Assay The Need for a PARP in vivo Pharmacodynamic Assay Jay George, Ph.D. Chief Scientific Officer Trevigen, Inc. Gaithersburg, MD Poly(ADP-ribose) polymerases are promising therapeutic targets. In response

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

SUPPORTING INFORMATIONS

SUPPORTING INFORMATIONS SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor

More information

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit]

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit] MANUAL IL-1alpha (mouse) ELISA Kit [Interleukin-1 alpha (mouse) ELISA Kit] For research use only. Not for diagnostic use Version 1 (March-5-2013) Cat. No. AG-45B-0003-KI01 www.adipogen.com Table of Contents

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Oncolytic Immunotherapy: A Local and Systemic Antitumor Approach

Oncolytic Immunotherapy: A Local and Systemic Antitumor Approach Oncolytic Immunotherapy: A Local and Systemic Antitumor Approach Oncolytic immunotherapy Oncolytic immunotherapy the use of a genetically modified virus to attack tumors and induce a systemic immune response

More information

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Maia Tato, Santhosh V. Kumar, Yajuan Liu, Shrikant R. Mulay, Solange Moll, Bastian Popper,

More information

Exploring the PD-L1 Pathway

Exploring the PD-L1 Pathway Active Within the tumor microenvironment Steps 1-3: Initiating and propagating anticancer immunity 1 may inhibit T-cell activity in the tumor microenvironment Dendritic cells capture cancer and then prime

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

MagniSort Mouse CD4 Naive T cell Enrichment Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

MagniSort Mouse CD4 Naive T cell Enrichment Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 2 MagniSort Mouse CD4 Naive T cell Enrichment Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse splenocytes were unsorted (left) or sorted with the MagniSort Mouse CD4

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Bihong Zhao, M.D, Ph.D Department of Pathology

Bihong Zhao, M.D, Ph.D Department of Pathology Bihong Zhao, M.D, Ph.D Department of Pathology 04-28-2009 Is tumor self or non-self? How are tumor antigens generated? What are they? How does immune system respond? Introduction Tumor Antigens/Categories

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather

More information

The Regulation of Bone Formation by the Met-5-enkephalin-Opioid Growth Factor Receptor Signaling Axis

The Regulation of Bone Formation by the Met-5-enkephalin-Opioid Growth Factor Receptor Signaling Axis The Regulation of Bone Formation by the Met-5-enkephalin-Opioid Growth Factor Receptor Signaling Axis Nikhil Thakur, MD, Sean D. DeBoyace, BS, Bryan S. Margulies, PhD. SUNY Upstate Medical University,

More information

Immunological response to metallic implants

Immunological response to metallic implants Immunological response to metallic implants Doc. dr. Peter Korošec Head of Laboratory for Clinical Immunology & Molecular Genetics Head of Research & Development Department University Clinic of Respiratory

More information

Opg/Rankl mrna dynamic expression in the bone tissue of ovariectomized rats with osteoporosis

Opg/Rankl mrna dynamic expression in the bone tissue of ovariectomized rats with osteoporosis Opg/Rankl mrna dynamic expression in the bone tissue of ovariectomized rats with osteoporosis C.W. Li 1 *, B. Liang 2 *, X.L. Shi 3 and H. Wang 3 * 1 Zhejiang Chinese Medical University, Hangzhou, China

More information

Based on review of available data, the Company may consider the use of denosumab (Prolia) for the

Based on review of available data, the Company may consider the use of denosumab (Prolia) for the Applies to all products administered or underwritten by Blue Cross and Blue Shield of Louisiana and its subsidiary, HMO Louisiana, Inc.(collectively referred to as the Company ), unless otherwise provided

More information

denosumab (Prolia ) Policy # Original Effective Date: 07/21/2011 Current Effective Date: 04/19/2017

denosumab (Prolia ) Policy # Original Effective Date: 07/21/2011 Current Effective Date: 04/19/2017 Applies to all products administered or underwritten by Blue Cross and Blue Shield of Louisiana and its subsidiary, HMO Louisiana, Inc.(collectively referred to as the Company ), unless otherwise provided

More information

VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer

VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer VIRAL TITER COUNTS The best methods of measuring infectious lentiviral titer FLUORESCENCE CYCLES qpcr of Viral RNA SUMMARY Viral vectors are now routinely used for gene transduction in a wide variety of

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver

More information

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

TRACP & ALP double-stain Kit

TRACP & ALP double-stain Kit Table of Content I. Description... 2 II. Introduction... 2 III. Principles... 2 IV. Kit components... 3 V. Storage... 3 VI. Preparation of reagents... 3 VII. Methods... 4-7 Cell fixation... 4 Activity

More information

IL-23 promotes osteoclastogenesis in osteoblast-osteoclast co-culture system

IL-23 promotes osteoclastogenesis in osteoblast-osteoclast co-culture system IL-23 promotes osteoclastogenesis in osteoblast-osteoclast co-culture system Y.K. Kang 1 and M.C. Zhang 2 1 Department of Clinical Laboratory, People s Hospital of Zhengzhou, Zhengzhou, Henan Province,

More information

TITLE: Hyaluronic acid is overexpressed in fibrotic lung tissue and promotes collagen expression

TITLE: Hyaluronic acid is overexpressed in fibrotic lung tissue and promotes collagen expression AD Award Number: W81XWH-07-1-0253 TITLE: Hyaluronic acid is overexpressed in fibrotic lung tissue and promotes collagen expression PRINCIPAL INVESTIGATOR: Pal Gooz, M.D. CONTRACTING ORGANIZATION: Medical

More information

Physiological and pathophysiological bone turnover - role of the immune system

Physiological and pathophysiological bone turnover - role of the immune system Physiological and pathophysiological bone turnover - role of the immune system M. Neale Weitzmann, Emory University Ighovwerha Ofotokun, Emory University Journal Title: Nature Reviews Endocrinology Volume:

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

BIOLOGY and BIOMECHANICS OF NORMAL & OSTEOPOROTIC BONE

BIOLOGY and BIOMECHANICS OF NORMAL & OSTEOPOROTIC BONE BIOLOGY and BIOMECHANICS OF NORMAL & OSTEOPOROTIC BONE Andreas Panagopoulos, MD, PhD Assistant Professor in Orthopaedics University Hospital of Patras, Orthopaedic Clinic Objectives Bone structure and

More information

EFFECT OF FLUORIDE ON OSTEOCLAST FORMATION AT VARIOUS LEVELS OF RECEPTOR ACTIVATOR OF NUCLEAR FACTOR KAPPA-B LIGAND (RANKL)

EFFECT OF FLUORIDE ON OSTEOCLAST FORMATION AT VARIOUS LEVELS OF RECEPTOR ACTIVATOR OF NUCLEAR FACTOR KAPPA-B LIGAND (RANKL) 86 86 EFFECT OF FLUORIDE ON OSTEOCLAST FORMATION AT VARIOUS LEVELS OF RECEPTOR ACTIVATOR OF NUCLEAR FACTOR KAPPA-B LIGAND (RANKL) Junrui Pei, Yanhui Gao, Bingyun Li, Lingwang Zhou, Zhiyi Zhang, Dianjun

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

SKELETAL SYSTEM I NOTE: LAB ASSIGNMENTS for this topic will run over 3 Weeks. A SEPARATE WORKSHEET WILL BE PROVIDED.

SKELETAL SYSTEM I NOTE: LAB ASSIGNMENTS for this topic will run over 3 Weeks. A SEPARATE WORKSHEET WILL BE PROVIDED. BIO 211; Anatomy and Physiology I REFERENCE: CHAPTER 07 1 Dr. Lawrence Altman Naugatuck Valley Community College LECTURE TOPICS OUTLINE SKELETAL SYSTEM I NOTE: LAB ASSIGNMENTS for this topic will run over

More information

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

The Immune System: The Mind Body Connection. Presented by Margaret Kemeny, Ph.D. Department of Psychiatry, University of California, San Francisco

The Immune System: The Mind Body Connection. Presented by Margaret Kemeny, Ph.D. Department of Psychiatry, University of California, San Francisco The Immune System: The Mind Body Connection Presented by Margaret Kemeny, Ph.D. Department of Psychiatry, University of California, San Francisco Psychoneuroimmunology Investigation of the bidirectional

More information

The Skinny of the Immune System

The Skinny of the Immune System The Skinny of the Immune System Robert Hostoffer, DO, FACOP, FAAP Associate Professor of Pediatrics Case Western Reserve University, Cleveland, Ohio Overview 1. Immune system of the skin 2. Immune Players

More information

Generation of monocytederived Dendritic Cells (modcs)

Generation of monocytederived Dendritic Cells (modcs) monocytederived Dendritic (modcs) Application Note Background Dendritic (DCs) are so called because of their characteristic cell surface projections that resemble the dendrites of neurons (see Fig 1 and

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Focus Application. Compound-Induced Cytotoxicity

Focus Application. Compound-Induced Cytotoxicity xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity For life science research only. Not for use in diagnostic procedures. Featured Study: Using the Time Resolving

More information

TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer

TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer AD Award Number: W81XWH-07-1-0155 TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer PRINCIPAL INVESTIGATOR: Srinivas Nandana CONTRACTING ORGANIZATION: Vanderbilt

More information

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder

More information

Supporting Information

Supporting Information Supporting Information Stegbauer et al. 10.1073/pnas.0903602106 SI Methods Analysis of Plasma Renin Activity (PRA) and ACE Activity. PRA and serum ACE activity levels were determined by RIA (RENCTK, DiaSorin;

More information

The Adaptive Immune Responses

The Adaptive Immune Responses The Adaptive Immune Responses The two arms of the immune responses are; 1) the cell mediated, and 2) the humoral responses. In this chapter we will discuss the two responses in detail and we will start

More information

Amino acid sequences in the β chain HLA- DRB*0401 molecules dictate susceptibility to RA Amino Acids in the Shared Epitope

Amino acid sequences in the β chain HLA- DRB*0401 molecules dictate susceptibility to RA Amino Acids in the Shared Epitope MHC/self-peptide MHC/Vβ TCR Vβx + Vβx T cell Induction of + TH1 mediated autoimmunity: A paradigm for the pathogenesis of rheumatoid arthritis, multiple sclerosis and APC type I diabetes TCR Vβx Activated

More information

Can HPV, cervical neoplasia or. HIV transmission?

Can HPV, cervical neoplasia or. HIV transmission? Interactions between HPV and HIV: STIs and HIV shedding, regulation of HPV by HIV, and HPV VLP influence upon HIV Jennifer S. Smith Department of Epidemiology pd University of North Carolina Can HPV, cervical

More information

Bad to the Bone: A Case of Camurati-Engelmann Disease

Bad to the Bone: A Case of Camurati-Engelmann Disease Bad to the Bone: A Case of Camurati-Engelmann Disease Jose Aliling MD, Tetyana Gorbachova MD, Lawrence H Brent MD Division of Rheumatology Einstein Medical Center Philadelphia, PA Case Presentation A 56

More information

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD) Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

More information

Biomechanics of Pain: Dynamics of the Neuromatrix

Biomechanics of Pain: Dynamics of the Neuromatrix Biomechanics of Pain: Dynamics of the Neuromatrix Partap S. Khalsa, D.C., Ph.D. Department of Biomedical Engineering The Neuromatrix From: Melzack R (1999) Pain Suppl 6:S121-6. NIOSH STAR Symposium May

More information

Nervous System. Master controlling and communicating system of the body. Secrete chemicals called neurotransmitters

Nervous System. Master controlling and communicating system of the body. Secrete chemicals called neurotransmitters Nervous System Master controlling and communicating system of the body Interacts with the endocrine system to control and coordinate the body s responses to changes in its environment, as well as growth,

More information

Mouse Models for the Evaluation of Osteocyte Functions

Mouse Models for the Evaluation of Osteocyte Functions J Bone Metab 2014;21:55-60 http://dx.doi.org/10.11005/jbm.2014.21.1.55 pissn 2287-6375 eissn 2287-7029 Review Article Mouse Models for the Evaluation of Osteocyte Functions Toshihisa Komori Department

More information

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements with constitutive

More information

Factors Which Predispose to the Onset of Autoimmune Disease. A Senior Honors Thesis

Factors Which Predispose to the Onset of Autoimmune Disease. A Senior Honors Thesis Factors Which Predispose to the Onset of Autoimmune Disease A Senior Honors Thesis Presented in Partial Fulfillment of the Requirements for graduation with distinction in Biology in the College of Biological

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Heat-killed Lactobacillus casei

Heat-killed Lactobacillus casei Heat-killed Lactobacillus casei confers broad protection against influenza A virus primary infection and develops heterosubtypic immunity against future secondary infection Yu-Jin Jung, Young-Tae Lee,

More information

Uncovering the mechanisms of wound healing and fibrosis

Uncovering the mechanisms of wound healing and fibrosis Any Questions??? Ask now or contact support support@sabiosciences.com 1-888-503-3187 International customers: SABio@Qiagen.com Uncovering the mechanisms of wound healing and fibrosis Webinar related questions:

More information

Fragile Bones and how to recognise them. Rod Hughes Consultant physician and rheumatologist St Peter s hospital Chertsey

Fragile Bones and how to recognise them. Rod Hughes Consultant physician and rheumatologist St Peter s hospital Chertsey Fragile Bones and how to recognise them Rod Hughes Consultant physician and rheumatologist St Peter s hospital Chertsey Osteoporosis Osteoporosis is a skeletal disorder characterised by compromised bone

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements with constitutive

More information

Supplemental figures

Supplemental figures Supplemental figures Supplemental Figure 1. Impact of immunogenic-llc tumors (LLC-OVA) on peripheral OVA-specific CD8 T cells. Tetramer analysis showing percent OVA-specific CD8 T cells in peripheral blood

More information

Title:Intermittent whole-body vibration attenuates a reduction in the number of the capillaries in unloaded rat skeletal muscle

Title:Intermittent whole-body vibration attenuates a reduction in the number of the capillaries in unloaded rat skeletal muscle Author's response to reviews Title:Intermittent whole-body vibration attenuates a reduction in the number of the capillaries in unloaded rat skeletal muscle Authors: Akinori Kaneguchi (sg12202@ym.hirokoku-u.ac.jp)

More information

Using the Ch6diak-Higashi Marker

Using the Ch6diak-Higashi Marker A Study of the Origin of Pulmonary Macrophages Using the Ch6diak-Higashi Marker Kent J. Johnson, MD, Peter A. Ward, MD, Gary Striker, MD, and Robin Kunkel, MS Using bone marrow reconstitution techniques

More information