Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance

Save this PDF as:

Size: px
Start display at page:

Download "Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance"


1 Immunity, Volume 34 Supplemental Information D4 + D Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather R. onti, Lixin Zheng, lanna. Peterson, Douglas R. Mathern, Nydiaris Hernández-Santos, Mira Edgerton, Sarah L. Gaffen, and Michael J. Lenardo

2 Supplementary figures Fig.S1 Tresp +Tcon Tresp +Treg FS D45.1 Fig. S1. Gating of Tresp cells based on congenic marker D45.1 in co-cultures. D45.1 Tresp and were stimulated alone or in co-cultures with D45.2 Tcon or Treg cells at a ratio 1:1 under Th17 cell conditions for 3 days. Representative flow cytometric dot plots of FS and D45.1 staining in the indicated cultures. Fig.S2 P=.7 P=.1 D3-D28 restimulation Tresp +Tcon Tresp +Treg n.s Tresp Tresp + Tcon Tresp + Treg Tresp Tresp + Tresp + Tresp + 5% D25+T-eff 5% Treg 1% D25+T-eff + 4% Treg IFN-γ Fig. S2. Treg cells enhance Th17 cell cytokines in co-cultures in vitro. ) ells stimulated as in (Fig. 1), were re-stimulated with PM-Ionomycin and were stained for at d6 or d7 and the data from three independent experiments are plotted. ) Flow cytometric contour plots of intracellular and expression of Tresp cells, 96 hours after stimulation under Th17 cell conditions with Tcon cells or Treg cells as indicated (gated on live Thy1.1+ Tresp cells). efore staining, the cells were re-stimulated with D3-D28 antibodies for 4 hours. ) D4+D25-D44- (D45.2) naïve Tresp cells were stimulated for 3 days under Th17 cell conditions without or with congenic D45.1 D4+D25+ pre-activated T effector cells (T-eff) or fresh D45.1+D4+D25+ Treg cell or D45.1+ D4+D25- Tcon cells. T-eff cells were pre-activated separately using D3-D28 and then co-cultured with naïve Tresp cells at 1:1 ratio. In the mixed culture where both Tcon and Treg cells were used, the Tresp:Treg:Tcon ratios were 5:4:1. Thus, Treg cells were mixed 2% D25+ Tcon cells. The analysis for and IFN-γ expression was performed by gating on D45.2 Tresp cells.

3 Fig.S2 ** % positive cells ** Tresp Tresp+Tcon Tresp +Treg P<.5 IL-17F IL-22 IFN-γ Fig. S2. D) Treg cells enhance Th17 cell cytokines in co-cultures at late time points in vitro. ells stimulated as in (S2), were re-stimulated with PM-Ionomycin and were stained for IL-17F, IL-22, or IFN-γ at d6 or d7 (late time points) and the data showing the percentage of respective cytokine positive cells are plotted. Fig.S3 In Th17 co-cultures Gated on D45.2 D45.2 only + IL D45.2 Tcon D45.2 Treg d d3 d4 d6 d Fig. S3. ) and expression in D45.2 population (Tcon or Treg cell) in co-cultures on day 3. D45.2 Tcon or Treg cells were stimulated alone with IL-2 or in co-cultures with D45.1 Tresp at a ratio 1:1 under Th17 cell conditions for 3 days. Tcon or Treg cells were gated using D45.2 co-staining to detect intracellular and. ) fraction of Treg cells lose expression and express transiently in Th17 cell co-cultures. D45.2 gfp+ Treg cells were co-cultured with D45.1D44-D25- Tresp cells under Th17 cell conditions at ratio of 1:1 and expression was measured by staining for in Treg cells. In Th17 cell co-cultures, Treg cells were gated using D45.2 co-staining.

4 Fig.S TGF-β ng/ml.1ng/ml.25ng/ml.5ng/ml Serum free media + Th17 cell milieu (2ng/ml TGF-β) ng/ml 2ng/ml 4ng/ml 8ng/ml Treg E WT Il2rb -/- serum (pg/ml) Treg supe. +Treg +Treg in transwell F ell count D25 d Fig. S4. Th17 cell cultures in saturating concentrations of TGF-β. Naive Tresp cells were stimulated in Th17 cell conditions without or with different concentrations of TGF-β (), or with supernatants (supe.) from Treg cultures or Treg cells in co-cultures or transwells (), in normal media or in serum free media (). and expression were quantified using intracellular staining on day 3. IL-2 suppresses production. (D) Naive Tresp cells were stimulated in Th17 cell conditions without or with Treg cells. IL-2 (1 U/ml) was added at the beginning of cultures. was quantified using ELIS of the supernatants collected from indicated cultures on day 4. (E) ELIS quantification of in the serum of 4 week old WT litter mate or Il2rb -/- mice. (F) Treg cells slightly downmodulate D25 expression in Tresp cells cultured under Th17 cell conditions. Flow cytometry histograms showing D25 expression of Tresp cells that were stimulated in Th17 cell conditions for indicated time-points (d3 or 6) in the absence (top) or the presence of Treg cells (bottom) Mean fluorescence intensities of D25 are indicated in the parentheses Treg D (ng/ml) (94) (76) (193) (144) d6 Tresp +Treg +- +IL-2 +Treg

5 Fig.S4 G WT Tresp Tresp Tresp +Treg Il2 -/- Tresp Tresp Tresp +Treg IFN-γ H IL-17F d6 I d6 WT Tresp Il2 -/- Tresp No exogenous TGF-β in cultures WT Tresp Il2 -/- Tresp Tresp +Treg Tresp+Treg Tresp +Treg+ αtgf-β Tresp +Treg+ αtgf-β ell count ell count Fig. S4. (G) IL-17F and IFN-γ staining of WT (top) or Il2 -/- (bottom) Tresp cells, without (left column) or with Treg cells stimulated for 3 days. Treg cells up-regulates in Il2 -/- Tresp cells on day 6. (H) WT or Il2 -/- Tresp cells were stimulated in Th17 cell conditions with or without Treg cells for 6 days. (I) WT or Il2 -/- Tresp cells were stimulated in Th17 cell conditions as in () without exogenous TGF-β. α-tgf-β antibody (25 µg/ml) added to block TGF-β. Frequencies of + Tresp cells were analyzed by intracellular staining and flow cytometry following re-stimulation with PM-ionomycin for 4 hours. Flow cytometry histograms show expression of Tresp cells.

6 Fig.S5 P =.1 P =.1 andida + Isotype Pa andida + P61 Pa a D andida+ andida+ % + ** P =.1 % IL-2+ E Sham + PS % IL-17F+ Sham + PS andida + Isotype ** P =.5 andida + P61 % IFN-γ+ Sham + PS andida + P61 andida + Isotype Fig.S5. locking D25 render mice more susceptible to. albicans infection. WT-57L/6 mice received.5mg of isotype antibody or P61 antibody by IP injection followed by oral infection with.albicans. Immunosuppressed mice received cortisone injection. () Weight of the mice in each group was monitored on d3 after infection. () Fungal olony Forming Units (FU)/gm of tongue tissue plated in 1 fold serial dilutions and assessed in triplicate (log scale). The black circle indicates PS+Sham group with zero values outside the log scale. Results represent the mean +/- SEM in () and (). () On day 5 after infection, tongues were harvested and stained with PS to detect. albicans (a), stained pinkish red in color. (Pa) denotes papillae of the tongue. Microscopic images of the slides viewed at 2X magnification. (D) Four days after infection, cells were analyzed for the expression of cytokines in LN by flow cytometry (gated on D4 + cells). The frequencies of cytokine expressing cells are plotted. Each data point represents data from each mouse. (E) ells were processed as in (S5D). Flow cytometric analyses of the expression of and in LN (gated on D4 + cells). These data are from 2 independent experiments showing similar results. andida + Isotype andida + P61.7 <

7 Fig.S6 Sham+ andida+ +PS Tresp +Tcon Tresp +Treg +PS Tresp +Tcon Tresp +Treg FS + D45.1 Tcon recipients Treg recipients d2 d3 d5 d cells in the LN (gated on non Tresp) d D PS+ Tresp + cells in the tongue (d7) Treg recipients Tcon recipients 11.1 Tresp 5.6 andida+ Tresp (Treg) Thy1.1 Fig. S6. ) Treg cells downsize Tresp cells only in a delayed manner in. albicans infected mice. () ells from SPLN (upper panel) and LN (lower panel) were isolated 7 days after the infection as in Fig 6. Flow cytometric contour plots show frequency of D45.1 Tresp cells recovered in the recipients from each group. Mice infected with andida show 1-2 fold increase in the frequency of D45.1+ Tresp cells in LN. These results represent data from 2 independent experiments. () Enrichment of expressing cells in mice reconstituted with Treg cells. Flow cytometric analyses show the percentage of expressing cells among cells excluding D45.1+ Tresp cells in LN isolated on indicated days after the are pooled from two independent experiments () Histological immunostaining showing expressing cells (arrows) in the tongue in Treg recipients on day 7 after infection (4X magnification). (D) Thy1.1 cells were stimulated for 96 hours under Th17 cell conditions with Treg cells (Tresp+Treg), as indicated. Thy1.1 Tresps were washed and injected in to Thy scid mice, that were subsequently infected with sham control (PS) or andida. Thy1.1 Tresp cells were separated from Treg cells in co-cultures using magnetic sorting before injection. Flow cytometric contour plots of Thy1.1 and intracellular of the Tresp cells are shown (gated on live Thy1.1+ Tresp cells).

8 Fig.S7 PS Tcon + Tresp Treg + Tresp Th17 ID Th ID 15 *** p < % weight *** *** ****** *** % weight 9 w w1 w2 w3 w4 w5 w6 w7 w8 w9 7 5 (days post ID induction) (weeks post ID induction) Th17 cell ID (d42) PS+PS Th17(Tresp+Tcon) Th17(Tresp+Treg) Fig. S7. Delayed suppression of Th17 cells during Th17-ID by Treg cells in vivo. () Delayed suppression of Th17-ID by Treg cells in vivo. Thy scid mice (n = 1) were reconstituted with cells from Thy1.1 T resp + Thy1.2 Tcon or Thy1.1 Tresp+Treg cell co-cultures in which Tresp and Tcon or Treg cells were cultured at 1:1 ratio in Th17 polarizing conditions for 4 days. Three control mice received PS (PS). Mean body weight of the groups of mice normalized to untreated mice represented as percentage of weight loss. () Early and strong amelioration of Th-ID by D4 + D25 + Treg cells. Thy1.2,.-17 scid mice (n=1) received 8 x 1 5 fresh Thy1.1, D25 D45R high D4 + congenic cells co-transferred with Thy1.2 D4 + D25 D45R high D4 + Tcon (D4+ D45R high + Tcon) or 8 x 1 5 fresh Thy1.2 D4 + D25 D45R high D4 + Treg cells (D4 + D45R high +Treg). ontrol mice received PS in both the injections (PS+PS) (n=5). The weight of the mice was monitored for 9 weeks after ID induction. () Th17 cell-id was induced as in. H&E staining of colon sections prepared on day 42 after Th17 cell ID induction. These results represent two independent experiments showing similar results.

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information


SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information


SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells

Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells Research article Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells Chen Wang, 1 Tai Yi, 1 Lingfeng Qin, 2 Roberto A. Maldonado, 3 Ulrich H. von Andrian, 3

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently Immunity, Volume 47 Supplemental Information Granulocyte-Monocyte Progenitors and Monocyte-endritic ell Progenitors Independently Produce Functionally istinct Monocytes lberto Yáñez, Simon G. oetzee, ndre

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information


SUPPLEMENTARY INFORMATION Supplementary Figure 1 a 0.5-1.5 μm Autophagosome formation b Brain Colon Heart 50μm Liver Skin Salivary Gland Spleen Lymph Node Kidney c GFP-LC3 tg Atg5 +/+ GFP-LC3 tg Atg5 / 10μm Figure S1. Constitutive

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm. SKG-c SKG-A mm 1.4 1.2 1.. Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

Autoimmunity in MFG-E8 deficient mice is associated with altered trafficking and enhanced cross-presentation of apoptotic cell antigens

Autoimmunity in MFG-E8 deficient mice is associated with altered trafficking and enhanced cross-presentation of apoptotic cell antigens Research article Autoimmunity in MFG-E8 deficient mice is associated with altered trafficking and enhanced cross-presentation of apoptotic cell antigens YuFeng Peng 1 and Keith B. Elkon 1,2 1 Division

More information

Simultaneous correlation of cytokine production with Treg and Th17 cell proliferation

Simultaneous correlation of cytokine production with Treg and Th17 cell proliferation Simultaneous correlation of cytokine production with Treg and Th17 cell proliferation Jurg Rohrer, PhD Director, R&D BD Biosciences 23-11773-00 For Research Use Only. Not for use in diagnostic or therapeutic

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information


SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Maia Tato, Santhosh V. Kumar, Yajuan Liu, Shrikant R. Mulay, Solange Moll, Bastian Popper,

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Dendritic cell subsets and CD4 T cell immunity in Melanoma. Ben Wylie 1 st year PhD Candidate

Dendritic cell subsets and CD4 T cell immunity in Melanoma. Ben Wylie 1 st year PhD Candidate Dendritic cell subsets and CD4 T cell immunity in Melanoma Ben Wylie 1 st year PhD Candidate Melanoma Melanoma is the 4 th most common cancer in Australia. Current treatment options are ineffective resulting

More information

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours) A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin

More information

Supplementary Information

Supplementary Information Supplementary Information Memory-type ST2 + CD + T cells participate in the steroid-resistant pathology of eosinophilic pneumonia Naoko Mato 1, 2, Kiyoshi Hirahara 2, Tomomi Ichikawa 2, Jin Kumagai 2,

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for The adhesion molecule PECAM-1 enhances the TGF- mediated inhibition of T cell function Debra K. Newman,* Guoping Fu,

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Androgen receptor antagonists compromise T cell response against prostate cancer leading to early tumor

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Cell-mediated Immunity

Cell-mediated Immunity Cellular & Molecular Immunology Cell-mediated Immunity Nicholas M. Ponzio, Ph.D. Department of Pathology & Laboratory Medicine April 6, 2009 Today s Presentation: Overview Cellular Interactions In Humoral

More information

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures.

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures. TNF-alpha ELISA For the quantitative determination of TNF-alpha in serum, plasma, buffered solution or cell culture medium. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number:

More information

Supporting Information

Supporting Information Supporting Information Shime et al. 1.173/pnas.11139919 SI Methods Reagents. was purchased from GE Healthcare, which was free from LPS contamination. TNF-α and IFN-β ELISA kit was purchased from eioscience

More information

Effector memory T helper cells secrete IFN-γ upon stimulation with cytokines: a role in chronic inflammation

Effector memory T helper cells secrete IFN-γ upon stimulation with cytokines: a role in chronic inflammation Excerpt from MCS&more Vol 13 1/211 Effector memory T helper cells secrete upon stimulation with cytokines: a role in chronic inflammation rne Sattler 1 *, Ulf Wagner 2, Manuela Rossol 2, Joachim Sieper

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information


SUPPORTING INFORMATIONS SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Optimizing Intracellular Flow Cytometry

Optimizing Intracellular Flow Cytometry Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

During inflammation, affected tissues undergo profound

During inflammation, affected tissues undergo profound oxia-inducible factor-1 alpha dependent induction of FoxP3 drives regulatory T-cell abundance and function during inflammatory hypoxia of the mucosa Eric T. Clambey a,1,2, Eóin N. McNamee a,1, Joseph A.

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures FastImmune Intracellular Cytokine Staining Procedures BD has developed protocols for the detection of intracellular cytokines in activated lymphocytes and in activated monocytes. The procedures have been

More information

Figure S1. Gating strategy used in NK cells and γδ T lymphocytes coculture An example of flow cytometry analysis shows the gating of NK cells and γδ

Figure S1. Gating strategy used in NK cells and γδ T lymphocytes coculture An example of flow cytometry analysis shows the gating of NK cells and γδ Figure S1. Gating strategy used in NK cells and γδ T lymphocytes coculture An example of flow cytometry analysis shows the gating of NK cells and γδ T lymphocytes used in all NK activation and cytotoxicity

More information

a b Pml F/F Prrx1-cre f 1.4 n.s.

a b Pml F/F Prrx1-cre f 1.4 n.s. a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane. 1 2 3 4 days in ulture late passages 2 4 6 8 1

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma

Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay

More information

John Langowski, Ph.D. Nektar Therapeutics San Francisco, CA USA

John Langowski, Ph.D. Nektar Therapeutics San Francisco, CA USA NKTR-38: a selective, first-in-class IL-2 pathway agonist which increases number and suppressive function of regulatory T cells for the treatment of immune inflammatory disorders John Langowski, Ph.D.

More information

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,

More information

Supplemental materials

Supplemental materials Supplemental materials 1 Supplemental Fig. 1 Immunogram This immunogram summarizes patient clinical data and immune parameters at corresponding time points for Patient IMF-32. The top panel illustrates

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo. Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

IL-17A secretion by CD8 + T cells supports Th17-mediated autoimmune encephalomyelitis

IL-17A secretion by CD8 + T cells supports Th17-mediated autoimmune encephalomyelitis Research article IL-17A secretion by CD8 + T cells supports Th17-mediated autoimmune encephalomyelitis Magdalena Huber, 1 Sylvia Heink, 2 Axel Pagenstecher, 3 Katharina Reinhard, 1 Josephine Ritter, 1

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

STAT3 Transcription Factor Promotes Instability of ntreg Cells and Limits Generation of itreg Cells during Acute Murine Graft-versus-Host Disease

STAT3 Transcription Factor Promotes Instability of ntreg Cells and Limits Generation of itreg Cells during Acute Murine Graft-versus-Host Disease Article STAT3 Transcription Factor Promotes Instability of ntreg Cells and Limits Generation of itreg Cells during Acute Murine Graft-versus-Host Disease Arian Laurence, 1,5, Shoba Amarnath,,5 Jacopo Mariotti,

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Relevant Disclosures

Relevant Disclosures 6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.

More information

CRISPR/Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of

CRISPR/Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of Supplementary Materials: CRISPR/Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of human chimeric antigen receptor T cells Authors: Levi J. Rupp 1,2,3,4,, Kathrin Schumann 3,5,6, Kole T. Roybal

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

Supporting Information

Supporting Information Supporting Information Soltani et al. 10.1073/pnas.1102715108 SI Experimental Procedures Evaluation of Mice and Drug Administration. IPGTT, insulin tolerance test, and glucagon tolerance test were performed

More information

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes Diabetes Volume 64, April 2015 1341 Subha Karumuthil-Melethil, 1 M. Hanief Sofi, 2 Radhika Gudi, 3 Benjamin M. Johnson, 2 Nicolas Perez, 1 and Chenthamarakshan Vasu 2,3 TLR2- and Dectin 1 Associated Innate

More information

Signaling through Fc RIII is required for optimal T helper type (Th)2 responses and Th2-mediated airway inflammation

Signaling through Fc RIII is required for optimal T helper type (Th)2 responses and Th2-mediated airway inflammation Signaling through Fc RIII is required for optimal T helper type (Th)2 responses and Th2-mediated airway inflammation Hozefa S. Bandukwala, 1 Bryan S. Clay, 1 Jiankun Tong, 2 Purvi D. Mody, 1 Judy L. Cannon,

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

Excerpt from MACS&more Vol 17 1/2016. Kenji Miki¹, Koji Nagaoka¹, Hermann Bohnenkamp², Takayuki Yoshimoto³, Ryuji Maekawa¹*, and Takashi Kamigaki⁴

Excerpt from MACS&more Vol 17 1/2016. Kenji Miki¹, Koji Nagaoka¹, Hermann Bohnenkamp², Takayuki Yoshimoto³, Ryuji Maekawa¹*, and Takashi Kamigaki⁴ Excerpt from MCS&more Vol 17 1/2016 Dendritic cells pulsed with induce both OV-specific CD4 + and CD8 + T cells and cause antitumor effects in a mouse model of lymphoma Kenji Miki¹, Koji Nagaoka¹, Hermann

More information

Supplementary Figure 1 Maschalidi et al.

Supplementary Figure 1 Maschalidi et al. a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1

More information

Cytotoxicity LDH Assay Kit-WST

Cytotoxicity LDH Assay Kit-WST ytotoxicity L ssay Kit-WST Notice to Users This is a supporting manual for antibody-dependent cell-mediated cytotoxicity () assay. or the contents of this kit and the preparation procedure of Working Solution,

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Essential role of the TNF-TNFR2 cognate interaction in mouse dendritic cell natural killer cell crosstalk

Essential role of the TNF-TNFR2 cognate interaction in mouse dendritic cell natural killer cell crosstalk From by guest on April 11, 218. For personal use only. IMMUNOBIOLOGY Essential role of the TNF-TNFR2 cognate interaction in mouse dendritic cell natural killer cell crosstalk Jun Xu,

More information

Supporting Information

Supporting Information Supporting Information Stegbauer et al. 10.1073/pnas.0903602106 SI Methods Analysis of Plasma Renin Activity (PRA) and ACE Activity. PRA and serum ACE activity levels were determined by RIA (RENCTK, DiaSorin;

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E. Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1

More information

Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D.

Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D. Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D. Professor, Departments of Pathology and Medicine Program Leader,

More information

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal

More information

Inflammatory IL-15 is required for optimal memory T cell responses

Inflammatory IL-15 is required for optimal memory T cell responses The Journal of Clinical Investigation Research article Inflammatory IL-15 is required for optimal memory T cell responses Martin J. Richer, 1 Lecia L. Pewe, 1 Lisa S. Hancox, 1 Stacey M. Hartwig, 1 Steven

More information

VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses. Li Wang. Dartmouth Medical School

VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses. Li Wang. Dartmouth Medical School VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses Li Wang Dartmouth Medical School The B7 Immunoglobulin Super-Family immune regulators APC T cell Co-stimulatory:

More information



More information

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation Research article Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation C. Andrew Stewart, 1 Hannah Metheny, 1 Noriho Iida, 1 Loretta Smith, 1 Miranda Hanson, 1 Folkert Steinhagen,

More information

Regulatory functions of CD8 + CD28 T cells in an autoimmune disease model

Regulatory functions of CD8 + CD28 T cells in an autoimmune disease model Regulatory functions of CD8 + CD28 T cells in an autoimmune disease model Nader Najafian, 1,2 Tanuja Chitnis, 2,3 Alan D. Salama, 1,2 Bing Zhu, 3 Christina Benou, 3 Xueli Yuan, 1 Michael R. Clarkson, 1

More information

Tumor-secreted mir-214 induces regulatory T cells: a major link between immune evasion and tumor growth

Tumor-secreted mir-214 induces regulatory T cells: a major link between immune evasion and tumor growth ORIGINAL ARTICLE Cell Research (2014) 24:1164-1180. 2014 IBCB, SIBS, CAS All rights reserved 1001-0602/14 npg Tumor-secreted mir-214 induces regulatory T cells: a major link between immune

More information

Central tolerance. Mechanisms of Immune Tolerance. Regulation of the T cell response

Central tolerance. Mechanisms of Immune Tolerance. Regulation of the T cell response Immunoregulation: A balance between activation and suppression that achieves an efficient immune response without damaging the host. Mechanisms of Immune Tolerance ACTIVATION (immunity) SUPPRESSION (tolerance)

More information

supplemental Figure 1

supplemental Figure 1 supplemental Figure 1 A T cell T1 anti-ny-eso-117-16/hla-a*:1 CDζ CH/CH scfv B T cell T1 anti-ny-eso-117-16/hla-a*:1 CDζ CH/CH scfv C T cell BW1/6 anti-cea CDζ CH/CH scfv supplemental Figure

More information

Gladstone Institutes, University of California (UCSF), San Francisco, USA

Gladstone Institutes, University of California (UCSF), San Francisco, USA Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of

More information

Challenges)facing)An./tumour) Immunotherapy)in)Myeloma)))

Challenges)facing)An./tumour) Immunotherapy)in)Myeloma))) Challenges)facing)An./tumour) Immunotherapy)in)Myeloma))) Immune Dysfunction Prof)Gordon)Cook) Leeds)Ins.tute)of)Cancer)&)Pathology) University)of)Leeds) Impaired)immunity)in)MM) )clinical) % of Infection-related

More information