SUPPLEMENTARY INFORMATION
|
|
- Vivien Anderson
- 5 years ago
- Views:
Transcription
1 DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5 Krt19 Krt14 Krt17 Tlr2 Myd88 Reltive expression 8 n.s. n.s. 6 totl nr olonies 4 2 WT P CD14+ Tlr2-/- P CD14+ WT P CD14- Tlr2-/- P CD14- WT P1 CD14+ Tlr2-/- P1 CD14+ Supplementry Figure 1 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. () Representtive FACS dot plot nd histogrm of CD24, CD49f nd CD61. Dt re representtive of 6 mie. () Quntittive rt-pcr on MEC popultions s indited in. Bsl mrkers: Krt5, Krt14, Krt17; Luminl mrker: Krt19; N=3 mie;, P<.5;, P<.1;, P<.5;, P<.1. Error rs represent S.E.M. One-til unpired t-test nlysis ws used. () M-CFCs were sorted sed on expression of CD24 high CD49f low/neg luminl phenotype in omintion with CD14. 2 ells luminl ells sorted for CD14 pos or CD14 neg were plted out on mtrigel in triplites. After 7-12 dys olonies were ounted nd pssged s single ell suspension gin (N= 4 mie). 4 independent experiments were performed nd the verge is shown, P=.7,.9 (NS: non-signifint). Vlues represent men ± s.d. Student s unpired t-test for independent smples ws used. 1
2 Supplementry Figure 2 Phenotypi hrteriztion of mmmry epithelil ells. () Flow ytometri nlysis of mmmry epithelil ells from 6 weeks old mie of wild-type, Tlr2 / nd Cd14 / mie. Cells were gted on life nd linege negtive ells. () Immunohistohemistry on mmmry glnds from 6 weeks old mie of wild-type, Tlr2 / nd Cd14 / mie. Myoepithelil ells (Cytokertin-14 (KRT14)) nd luminl ells (E-CADHERIN) re present nd properly orgnized in oth wild-type s well s the knok out mmmry glnds. Sle r is 5 μm () Crmine Alum stining on whole mount of lttion of wild-type, Tlr2 / nd Cd14 / mie. Sle r is 1 mm. (d) Flow ytomety nlysis of mmmry epithelil ells from 6-8 weeks old mie. Cells were gted on live nd linege negtive nd stined for CD24, CD49f nd CD14, TLR4, IL- 1R1 or IL-18R1. In red is the isotype ontrol for eh speifi su-popultion, in lue is the CD14, TLR4, IL-1R1 or IL-18R1 stining. (e) Flow ytometry nlysis of Myd88 / mmmry epithelil ells, from 6 weeks old mie of Krt14-Cre neg Myd88 f/f nd Krt14-Cre pos Myd88 f/f mie. Cells were gted on life nd linege negtive ells. (f) Immunohistohemistry on mmmry glnds from 6 weeks old mie of Krt14-Cre neg Myd88 f/f nd Krt14-Cre pos Myd88 f/f mie. Myoepithelil ells (Cytokertin-14 (KRT14)) nd luminl ells (E-CADHERIN) re present nd properly orgnized in the MyD88 knokout mmmry glnd. Sle r is 5 μm. All nlyses were done with t lest 3 mie. 2
3 Limiting dilutions o f mmmmry epithelil ells. # of Lin Tlr2 Cd14 WT Neg ells KO KO 25K 15/2 4/9 1/6 1K 15/18 1/1 /1 5K 9/14 3/2 3/1 2.5K 6/11 2/2 2/ K /12 /16 /8 # of ells WT Tlr4 KO 1K 5/8 4/1 5K 4/6 3/1 2.5K 6/11 1/1 log frtion nonresponding d # of ells WT Il-1r1 Il-18r1 KO KO 25K 15/2 12/12 5/6 1K 15/18 11/16 3/8 5K 9/14 1/16 5/9 2.5K 6/11 11/16 3/9 1.25K /12 3/14 /7 Group Tlr4 Group WT dose (numer of ells) Genotype MRU frequeny WT 1/5741 Tlr4 KO 1/185 ±SE p-vlue.85 e # of Lin Neg ells WT Tlr2 KO Ink4A- Arf KO Tlr2 KO Ink4A- Arf KO 25K 3/4 4/9 7/7 6/6 1K 5/8 1/1 12/2 5/1 5K 4/6 3/2 9/19 4/13 2.5K 6/11 2/2 3/14 2/ K /12 /16 2/6 1/4 f log frtion nonresponding Group Ink4 Arf KO Group TLR2 KO Group TLR2 KO/Ink4 Arf KO Group WT dose (numer of ells) Genotype MRU frequeny WT 1/8322 Tlr2 KO 1/42476 Ink4-Arf KO 1/8691 Tlr2 KO Ink4-Arf KO 1/11515 ±SE p-vlue <.1 N.S. N.S. Supplementry Figure 3 Limiting dilutions of mmmry epithelil ells. In order to determine the MRU frequeny of eh donor genotype we injeted sorted ells, s indited from donor mie of 1 to 14 weeks old mie in lered mmmry ft pds of three weeks old reipients. Reipient mie were syngenei C57BL/6J mie. Numers of suessful out growths nd numers of totl injetions re shown for eh dilution nd genotype. MRU frequeny nd onfidene ws determined y ELDA grph nd nlysis. ) Rw numers for limiting dilutions of Tlr2 / nd Cd14 / lin neg MECs for figure 4. -) Rw numers for limiting dilutions of Tlr4 / lin neg MECs, inluding ELDA nlysis. Dt for WT (N=25 smples), Tlr4 -/- (N=3 smples) pooled from 3 independent experiments. P=.85. d) Rw numers for limiting dilutions of Il-1r1 / (N=74 smples) nd Il-18r1 / lin neg (N=39 smples) MECs. e-f) Limiting dilutions of Ink4-Arf +/+ Tlr2 +/+ (WT), Ink4-Arf +/+ Tlr2 / (Tlr2 KO), Ink4-Arf / Tlr2 +/+ (Ink4-Arf KO) nd Ink4-Arf / Tlr2 / (Ink4-Arf KO Tlr2 KO) lin neg MECs, inluding ELDA grph nd nlysis. Dt for WT (N=41 smples), Tlr2 -/- KO (N=75 smples), P<.1, Ink4-Arf KO (N=66 smples), P=N.S. nd Ink4-Arf KO Tlr2 KO (N=45 smples), P=N.S. re pooled from 4 independent experiments. 3
4 Single ell gene expression of MRU: wildtype versus Tlr2-/- MRU ells Trp Lgr5--89 Gt Krt Krt Supplementry Figure 4 Single ell gene expression of MRU. Single ell expression showing expression of wild-type (lk) nd Tlr2 / (red) MRUs for figure 3e. Cells were doule sorted nd sujeted to multiplexed single ell rt-pcr. Normlized Ct vlues s visulized y ompring the distriution of Ct vlues in histogrms. () Gene tht ws signifintly up-regulted in Tlr2 / ells s ompred to wild-type ells. () Genes tht were signifintly down-regulted in Tlr2 / s ompred to wild-type ells. Eh nlysis ws done on 2 different mie. 4
5 Antiody nd/or shrna medited lokde of TLR2, CD14, MYD88 nd IRAK1 1.2 ontrol TLR-2 Rel. Tlr2 exp..8.4 CD14 d. shcontrol shtlr2-1 shtlr Myd88 Irk1 MDA-MB-468 MDA-MB-231 Reltive expression fold redution 1 5 e 1 shcontrol shtlr2-1 MCF7 shtlr2-2 f shmyd88 #4 shmyd88 #7 15 shirk1 #1 shirk1 #4 Il-1 nr. of herry pos olonies Reltive expression fold redution 1 5 shmyd88 #4 shmyd88 #7 shirk1 #1 shirk1 #4 Control shmyd88 #4 shmyd88 #7 shirk1 #1 shirk1 #4 Supplementry Figure 5 Antiody nd/or shrna medited lokde of TLR2, CD14, MYD88 nd IRAK1. () Representtive exmples olony formtion on mtrigel of primry ER neg rest ner ells (N=4). Sle r is 2 μm. Cells were treted with ontrol ntiody or with neutrlizing TLR2 nd CD14 ntiodies. (-) Two rest ell lines were trnsdued with the lentivirus to knokdown TLR2 nd fter puromyin seletion ells were plted out nd stined with rystl violet lue fter 9 dys in ulture. Dt re representtive of 2 experiments. Sle r is 1 m. (d) MDA-MD-231 ells were trnsdued with ontrol or indited shrna nd knok-down effiieny ws determined y qpcr. All shrna medited knok-down onstruts resulted in 4 to 12x redution of its trget mrna. Dt re representtive of 2 experiments. (e) Knok-down of MYD88 nd IRAK1 in the rest ell line MCF7. After trnsdution ells were sorted for Cherry nd plted out on mtrigel in triplite to determine olony forming pity. The numer of olonies on mtrigel is shown nd representtive photo of the olonies is shown. N=6 smples pooled from 2 independent experiments., p<.1. Sle r is 2 μm. Vlues represent men ± s.d. Student s unpired t-test for independent smples ws used. (f) MYD88 nd IRAK1 knok down resulted in deresed expression of the NF-KB trget gene IL-1B inditing tht the knok down resulted in deresed NF-KB tivity. Dt re representtive of 2 experiments. 5
6 TLR2 Immonohistohemistry on norml nd tumor olon tissue Norml Colon Colon Tumors Supplementry Figure 6 TLR2 immunohistohemistry on norml nd tumor olon tissue. () 1X mgnifition of immunohistohemistry for TLR2. Boxed is norml olon tissue, the rest re olon tumors. Sle r is 2 μm () 4X mgnifition of immunohistohemistry for TLR2 of olon tumors. Sle r is 5 μm. 6
7 Genome editing the Tlr2 lous using CAS9 humn TLR2 lous, Chromosome 4 Exon 2 Exon sgrna Trgeting vetor E283 homologous reoomintion -638 Pp Pp1 Pp Pp2 E283 M49 Genomi juntion of HR with genomi DNA Primer set 1 juntions: TLR2 outside HR TTTTGGGTAAATCTGAGAGCTGCGATAAAGTCCTAGGTTCCCATATTTAA CMV-Cherry-pA TGGAATATGCAGCCTCCGGATTGTTCGCGTTAAGATACATTGATGAGTTT Primer set 2 juntions: CMV-Cherry-pA AAACTCATCAATGTATCTTAACGCGAACAATCCGGAGGCTGCATATTC TLR2 outside HR onstrut TTTGGGTAAATCTGAGAGCTGCGATAAAGTCCTAGGTTCCCATATTTAA Supplementry Figure 7 Genome editing the Tlr2 lous using CAS9. () Shemti of the trgeted region of humn TLR2 lous nd trgeting strtegy. sgrna uts round The homologues reomintion (HR) ssette hs left rm (inluding the E283 muttion) nd right rm. In etween there is CMV Cherry pa ssette (yellow ox) in the nti sense orienttion. Primer pirs (Pp1 & Pp2) re shown to detet homologues reomintion. () Region of the sgrna omplementry to the protosper. ) Sequened region show orret integrtion of HR onstrut s determined y sequening the genomi juntions. 7
Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1138 Supplementl Figure 1 Inflmmtory Monoytes Host ells CCR2 CCL2 Disseminting Tumor Cells Metstsis Assoite Mrophges VEGF Extrvstion & Metstti Seeing Supplementl Figure 1 The t from this
More informationSUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
More informationRESEARCH ARTICLE. Supplemental Figure 5
11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationLesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationa b Pml F/F Prrx1-cre f 1.4 n.s.
a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane.8.6.4.2.8.6.4.2 1 2 3 4 days in ulture late passages 2 4 6 8 1
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationSUPPLEMENTARY INFORMATION
DOI:./n BJ RAS:ER Herrnz et l Supplementry Figure HFFF RAS:ER.. mrna Expression..... ILα ILβ IL IL CCL INH VEGF mrna Expression..... ILα ILβ IL IL CCL INH VEGF + OHT Torin NVP-BEZ + OHT shmtor. shmtor.
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationSupplementary Information
Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry
More informationTbp. Per Relative mrna levels Circadian Time. Liver weight/ body weight (%) n.s. Pernull
Liver weight/ ody weight (%) Dy Body weight (g) Reltive mrna levels Reltive mrna levels Reltive mrna levels Reltive mrna levels Dy Per1 Per2 Per3 Tp 8 2 8 2. 6 2 8 12162 Cirdin Time 3 2 1 2 1 1 8 12162
More informationSUPPLEMENTARY INFORMATION
DOI:.3/n95 Thymus Kiney (kd) TA T7 T TA T7 T Hert TA T7 T: +Dox Cylin B (kd) Thymus Kiney Hert TA T5 T TA T5 T TA T5 T: +Dox Cylin B Poneu S Poneu S CnB T7 CnB T Thymus (kd) + Liver Colon + + (kd) Thymus
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture277 d 25 25 2 Time from sound onset (ms) 25 25 2 Time from sound onset (ms) Firing rte (spikes/s) Firing rte (spikes/s).8.6..2 e f g h.8.6..2 Frtion of neurons Frtion of neurons N = 53 2 2
More informationSupplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
More informationSupplemental Figures and Legends
Supplementl Figures n Legens Epigeneti trgeting of Hegehog trnsriptionl output through BET romoomin inhiition Yujie Tng 1,2, Shrreh Gholmin 2, Simone Shuert 1,2, Mine I. Willrson 3, Alex Lee 4, Prtiti
More informationRNAi Targeting CXCR4 Inhibits Tumor Growth Through Inducing Cell Cycle Arrest and Apoptosis
originl rtile RNAi Trgeting CXCR4 Inhiits Tumor Growth Through Induing Cell Cyle Arrest nd Apoptosis To Yu 1,2, Yingying Wu 2, Yi Hung 1,2, Chorn Yn 1, Ying Liu 1, Zongsheng Wng 3, Xioyi Wng 1, Yuming
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationSupplementary Figure S1_Cottini
Supplementry Figure S1_Cottini γ-h2a.x Krp OCIMy5 KMS11 Krps62 RPMI8226 INA6-1 µm Cleve C3 γ-h2a.x DAPI Merge OCIMy5 H929 JJN3 UTMC2 KMS11 KMS12PE KMS18 KMS2 RPMI8226 INA6 U266 KMS34 Krps62 1 2 3 4 5 6
More informationnestin ironetin p75 s1 CNS SKPs Dermo-1 +ve SKPs CNS H2O SCGs Skin Di. SKPs TH SHOX2 GAPDH NCAM D H Figure S1, Immunoytohemil nlysis o SKP spheres ulture rom neontl mouse (nestin, ironetin, S-1) or rt
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.18/nture129 ontrol-dna -DNA CD49 Blood Lung e.98 +/-.9.71 +/-.2.29+/-.1 2.9 +/-.6 Bsophils (x1 )/ml 4 Bsophils ( x1 ) d f 45. 22.5 15 75 ontrol-dna ontrol-dna -DNA -DNA
More informationARTICLES. Mediators of vascular remodelling co-opted for sequential steps in lung metastasis
Vol 1 April 7 doi:1.13/nture57 ARTICLES Meditors of vsulr remodelling o-opted for sequentil steps in lung metstsis Gorv P. Gupt 1, Don X. Nguyen 1, Anne C. Ching 1,, Pul D. Bos 1, Juliet Y. Kim 1, Cristin
More informationSupplementary Information Titles
Supplementry Informtion Titles Journl: Nture Medicine Article Title: Corresponding Author: Modelling colorectl cncer using CRISPR-Cs9-medited engineering of humn intestinl orgnoids Toshiro Sto Supplementry
More informationSUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationsupplementary information
DOI:.38/n83 k Mouse Ch8 lous 8 9 Stop CHD8L 75 CHD8L Chromoomins Helise/ATPse omin DNA ining omin 5 kd NIH 3T3 MEF 93T HeL HCT UOS SOS.. CHD8L IB: CHD8 8 5 L S Reltive mrna mount 3... Reltive mrna mount.8.
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationa3 Chains of type V collagen regulate breast tumour growth via glypican-1
Reeive 5 Aug 16 Aepte De 16 Pulishe 19 Jn 17 3 Chins of type V ollgen regulte rest tumour growth vi glypin-1 Guorui Hung 1, Goxing Ge 1,w, Vlerio Izzi & Dniel S. Greenspn 1 DOI: 1.138/nomms1351 OPEN Periellulr
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationAbortion frequency (%) Ovary position on ear Ovary volume (mm 3 )
ortion frequeny (%) 5 1 Ovry position on er 3 1 WW WD pex Bse Ovry volume (mm 3 ) Figure S1. Ovry volume (thik lines) n ortion frequeny (thin lines) s funtion of position long the er, 15 ys fter silk emergene
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More information% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
More informationSonic Hedgehog promotes proliferation of Notch-dependent monociliated choroid plexus tumour cells
Soni Hedgehog promotes prolifertion of Noth-dependent monoilited horoid plexus tumour ells Li Li, Ktie B. Grusm,2, Jun Wng 3, Melody P. Lun 4,5, Jsmin Ohli 6, Hrt G. W. Lidov 4, Moni L. Clihio 4, Erling
More informationToolkit for evaluating genes required for proliferation and survival using tetracycline-regulated RNAi
Toolkit for evluting genes required for prolifertion nd survivl using tetryline-regulted RNAi Johnnes Zuer,5, Ktherine MJunkin,,5, Christof Fellmnn,4, Luks E Dow, Meredith J Tylor, Gregory J Hnnon 3 &
More informationSUPPLEMENTARY INFORMATION
DOI:.3/nc37 This Supplementry Informtion file ws updted with new reference (ref. 3) on Decemer WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved logfc SUPPLEMENTARY INFORMATION
More informationThe Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression
Reserh Artile The Hippo/ pthwy interts with EGFR signling nd HPV onoproteins to regulte ervil ner progression Chuno He 1,, Dgn Mo 1,3, Guohu Hu 1,, Xingmin Lv 1, Xingheng Chen, Peter C Angeletti 5, Jixin
More informationLETTER. Impaired hydroxylation of 5-methylcytosine in myeloid cancers with mutant TET2
doi:.8/nture98 Impired hydroxyltion of -methylytosine in myeloid ners with mutnt TET Myunggon Ko {, Yun Hung {, Ann M. Jnkowsk, Utz J. Ppe,, Mmt Thilini, Hozef S. Bndukwl, Jungeun An {, Edwrd D. Lmperti,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More informationProgestin effects on cell proliferation pathways in the postmenopausal mammary gland
Wood et l. Brest Cner Reserh 213, 15:R62 http://rest-ner-reserh.om/ontent/15/4/r62 RESEARCH ARTICLE Open Aess Progestin effets on ell prolifertion pthwys in the postmenopusl mmmry glnd Chrles E Wood 1,
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture99 Dy Dy Dy 3 Dy 4 Bleed INDO INDO INDO INDO INDO INDO INDO INDO 3 7 CFU-GM/ml lood 6 4 3 Indomethcin Biclein + Indo + Bcln c WBC PMN LYMPH MONO RBC PLT Ctrl 7.4±.9.4±.8.4±.39.37±.6 8.88±.
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationSupplementary Information
Supplementry Informtion A new lss of plnt lipid is essentil for protetion ginst phosphorus depletion Yozo Okzki 1, Hitomi Otsuki 1, Tomoko Nrisw 1, Mkoto Koyshi 1, Storu Swi 2, Yukiko Kmide 1, Miyko Kusno
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationRegulatory T cells prevent catastrophic autoimmunity throughout the lifespan of mice
Regultory T ells prevent tstrophi utoimmunity throughout the lifespn of mie Jeong M Kim 1, Jeffrey P Rsmussen 1 & Alexnder Y Rudensky 1,2 Mie lking the trnsription ftor ( ) lk regultory T (T reg ) ells
More informationLETTERS. Chfr is required for tumor suppression and Aurora A regulation
25 Nture Pulishing Group http://www.nture.om/nturegenetis Chfr is required for tumor suppression nd Auror A regultion Xiohun Yu 1, Ktherine Minter-Dykhouse 1, Liviu Mlurenu 2, Wei-Meng Zho 3, Dongwei Zhng
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi: 1.138/nnno.211.41 Sili nd titnium dioxide nnoprtiles use pregnny omplitions in mie Kohei Ymshit, Ysuo Yoshiok, Kzum Higshisk, Kzuy Mimur, Yuki Morishit, Mstoshi Nozki, Tokuyuki
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture10754 Supplementry note 1 To ompre our dt with previous studies, we mesured the width of spikes from identified dopminergi neurons nd unidentified neurons from DATCre mie. Previous studies
More informationThe microrna mir-31 inhibits CD8 + T cell function in chronic viral infection
A rt i l e s The mirorna mir-3 inhiits CD8 + T ell funtion in hroni virl infetion Howell F Moffett, Adm N R Crtwright, Hye-Jung Kim, Jernej Gode, Json Pyrdol, Trmo Äijö 3, Gustvo J Mrtinez,6, Anjn Ro,
More informationSupplementary Information. Title: RAS-MAPK dependence underlies a rational polytherapy strategy in EML4-
Supplementry Informtion Title: RAS-MAPK dependence underlies rtionl polytherpy strtegy in EML4- ALK positive lung cncer Authors: Gorjn Hrustnovic, Victor Olivs, Evngelos Pzrentzos, Asmin Tulpule, Surh
More informationTiffany A. Katz Shauna N. Vasilatos Emily Harrington Steffi Oesterreich Nancy E. Davidson Yi Huang
Brest Cner Res Tret (214) 146:99 18 DOI 1.17/s1549-14-312-9 PRECLINICAL STUDY Inhiition of histone demethylse, LSD2 (KDM1B), ttenutes DNA methyltion nd inreses sensitivity to DNMT inhiitorindued poptosis
More informationInterplay of LRRK2 with chaperone-mediated autophagy
Interply of with hperone-medited utophgy Smnth J Orenstein,, Sheng-Hn Kuo,, Inmuld Tsset,,, Espernz Aris,, Hiroshi Kog,, Irene Fernndez-Crs, Etty Cortes,5, Lwrene S Honig,5, Willim Duer 6, Antonell Consiglio,7,
More informationAMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
More informationChloride Nutrition Regulates Water Balance in Plants
XII Portuguese-Spnish Symposium on Plnt Wter Reltions Chloride Nutrition Regultes Wter Blne in Plnts Frno-Nvrro JD 1, Brumós J, Rosles MA 1, Vázquez-Rodríguez A 1, Sñudo BJ 1, Díz- Rued P 1, Rivero C 1,
More informationSupplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection
Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine
More informationSUPPLEMENTARY INFORMATION
~ 5 % ltion > 99 % ltion 25 2 15 5 Gly yemi (mmol/l) 3 7 15 3 Time fter -ell ltion (dys) Survivl (%) & ~ 5 % ltion 75 > 99% ltion 5 25 25 5 (dys) 7.4 d 1.25 lood ph 73 7.3 7.2 7.1 7. 7d ody weight h nge
More informationThe Ia-2β intronic mirna, mir-153, is a negative regulator of insulin and dopamine secretion through its effect on the Cacna1c gene in mice
Dietologi (5) 58:98 36 DOI.7/s5536838 ARTICLE The I introni mirna, mir53, is negtive regultor of insulin nd dopmine seretion through its effet on the Cn gene in mie Hunyu Xu & Liron Auhtzir & Gilerto N.
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationDGCR8 is essential for microrna biogenesis and silencing of embryonic stem cell self-renewal
7 Nture Pulishing Group http://www.nture.om/nturegenetis DGCR is essentil for mirorna iogenesis n silening of emryoni stem ell self-renewl Yngming Wng, Rostislv Mevi, Collin Melton, Ruolf Jenish & Roert
More informationInhibiting Stat3 signaling in the hematopoietic system elicits multicomponent antitumor immunity
2 Nture Pulishing Group http://www.nture.om/nturemediine Inhiiting Stt3 signling in the hemtopoieti system eliits multiomponent ntitumor immunity Mrin Kortylewski 1,4, Miej Kujwski 1,4, Tinhong Wng 2,
More informationSupplementary Figure 1
Supplementry Figure 1 Ncor1 Expression 2. 1.5 1..5. Muscle Liver Lmi Ppropi Kindey Pncres Lung Testis Bone Mrrow Thymus Spleen Peripherl Lymph nods Smll Intestine Ncor1 Expression 1.5 1..5. DN DP SP CD8
More informationEffects of exercise training on hepatic steatosis in high fat diet-induced obese mice
Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid
More information